Patients and tissue samples
This study was approved and supervised by the Research Ethics Committee of the Affiliated Hospital of Nantong University (Nantong, China). All patients provided their signed written informed consent. Paired GC and adjacent normal gastric tissues were obtained in 2017 and 2018 from 20 patients who underwent primary surgical GC resection at the hospital. All tissue samples were immediately frozen in liquid nitrogen until use.
The GC specimens were obtained from 183 GC patients at the Affiliated Hospital of Nantong University (Nantong, China) from 2012 to 2017. All patients had received their first diagnosis of GC but had not received any other treatment, including chemotherapy, before surgery. The clinicopathological data on the 183 GC patients comprised age, sex, degree of differentiation, histological type, lymph node metastasis, distant metastasis, and TNM stage (Table 1).
Table 1
Clinical characteristics of GC patients
Parameter | n |
Age(yr) | |
Media(range) | 63(38–86) |
Gender | |
Male | 128 |
Female | 55 |
Tumor diameter(cm) | |
≤ 4 | 118 |
༞4 | 65 |
Tumor Location | |
Up | 43 |
Middle | 35 |
Down | 105 |
Tumor differentiation | |
High | 18 |
Middle | 45 |
Low | 120 |
HP infection | |
Negative | 51 |
Positive | 132 |
T stage | |
1a | 16 |
1b | 23 |
2 | 27 |
3 | 102 |
4a | 12 |
4b | 3 |
N stage | |
0 | 65 |
1 | 27 |
2 | 44 |
3a | 35 |
3b | 12 |
TNM stage | |
ⅠA | 32 |
ⅠB | 15 |
ⅡA | 28 |
ⅡB | 24 |
ⅢA | 37 |
ⅢB | 29 |
ⅢC | 12 |
Ⅳ | 6 |
Five-year survival | |
Yes | 117 |
No | 66 |
Cell Line Cultures, Plasmids, And Transfection
Normal gastric epithelial (GES-1) and GC cell lines (MGC-803 and MKN-45) were purchased from the Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China). The cells were maintained in Roswell Park Memorial Institute (RPMI)-1640 medium supplemented with 10% fetal bovine serum (FBS, Gibco, Grand Island, NY, USA) according to manufacturer’s protocol. CIC complementary DNA (cDNA) that was cloned into pcDNA3.1 plasmid was purchased from General Biosystems (An Hui, China), and short heparin RNA for CIC (CIC-shRNA) was purchased from Gene Pharma Co., Ltd (Su Zhou, China).
GC cells were transfected with the CIC-overexpressed plasmid (CIC), CIC-shRNA, or a negative control (pcDNA3.1) at approximately 50% density using Lipofectamine 3000 reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol.
Quantitative Real-time Polymerase Chain Reaction
Total RNA was extracted from the cells or tissues using TRIzol reagent (Thermo Fisher Scientific, Carlsbad, CA, USA). Two micrograms of RNA were used with the High Capacity cDNA Reverse Transcription Kit to synthesize cDNA (Thermo Fisher Scientific). Quantitative real-time polymerase chain reaction (qRT-PCR) analysis for the indicated molecules was conducted using SYBR Green Supermix (Thermo Fisher Scientific). The primer sequences are shown in Table 2; β-actin was used as the internal control. The relative expression of each gene was quantified using the 2−ΔΔCt method as reported(22).
Table 2
Sequences of primers for qrt-pcr
| Forward (5' to 3') | Reverse (5' to 3') |
CIC | ACAGGTACAGAAGCCGAGGA | GCAGACAAACCTTGGAGGGA |
E-cadherin | GCTGGACCGAGAGAGTTTCC | CAAAATCCAAGCCCGTGGTG |
N-cadherin | TGGGAAATGGAAACTTGATGGC | AGTTGCTAAACTTCACTGAAAGGA |
Vimentin | ATTCCACTTTGCGTTCAAGG | CTTCAGAGAGAGGAAGCCGA |
β-actin | GCTCTCTGCTCCTCCTGTTC | CGACCAAATCCGTTGACTCC |
Western Blot Assay
Whole-cell extracts from the cultured cells transfected with the indicated molecule or tissues were prepared using radioimmunoprecipitation assay lysis buffer (Beyotime, Shanghai, China). Thirty micrograms of protein were separated by 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis and transferred into polyvinylidene fluoride membranes (Millipore, Billerica, MA, USA), which were then incubated with rabbit anti-CIC (cat. no. ab123822, dilution, 1:1000), mouse anti-β-actin (cat. no. ab8226, dilution, 1:5000), rabbit anti-pan-protein kinase B (AKT) (cat. no. ab8805, dilution, 1:1000), rabbit anti-pan-AKT (phospho T308) (cat. no. ab38449, dilution, 1:1000), mouse anti-vimentin (cat. no. ab8978, dilution, 1:1000), rabbit anti-E cadherin (cat. no. ab40722, dilution, 1:1000), and rabbit anti-N cadherin (cat. no. ab18203, dilution, 1:1000) (all purchased from Abcam, Cambridge, MA, USA). PI3 kinase p85 antibody (cat. no. 4292, dilution, 1:1000) and phospho-PI3 kinase p85 (Tyr458)/p55 (Tyr199) antibody (cat. no. 4228, dilution, 1:1000) were purchased from Cell Signaling Technology (Boston, MA, USA) and incubated at 4℃ overnights. After washing four times with Tween 20, the membranes were immunoblotted with goat anti-rabbit immunoglobulin (Ig)G or goat anti-mouse IgG secondary antibody, purchased from Jackson Immuno Research (Lancaster, PA, USA), at room temperature (RT) for 2 h. The expression levels of the indicated molecules were detected using chemiluminescent immunoassay, β-actin was used as the internal control.
Cell invasion assay
The 24-well Transwell plates were precoated with Matrigel (BD Biosciences Pharmingen, San Jose, CA, USA) at 37℃ for 30 min (BD Biosciences, San Jose, CA, USA). The cells transfected with the indicated molecules were cultured overnight, harvested, and resuspended with 2% FBS. Approximately 1 × 105 cells were added into the inner chamber, and the outer chamber contained RPMI-1640 medium with 20% FBS. After incubating at 37℃ for 24 h in 5% carbon dioxide, the cells on the upper surface of the inner chamber were washed with cold PBS and fixed with cold methanol at RT for 20 min. The cells were then rinsed with crystal violet at RT for 30 min. Those cells on the upper space of inner chamber were removed using cotton swabs, and those adhered to the lower surface of the inner chamber were counted using the Olympus BX-43 microscope (Tokyo, Japan).
Cell proliferation assay
Briefly, approximately 5,000 cells transfected with the indicated molecules and suspended in 100 μL RMPI-1640 medium were cultured in 96-well plates. After incubating separately for 0, 24, 48, 72, 96 h, 10 μL cell counting kit-8 (CCK-8) solutions was added to each well and let stand for 4 h. The absorbance of each well at 450 nm was detected using the Multiskan FC automated microplate reader (Thermo Fisher Scientific).
Statistical analyses
Statistical analyses were conducted using SPSS 19.0 (SPS Inc., Chicago, IL, USA). Patient survival rates were calculated using the Kaplan-Meier survival analysis method. Statistically significant differences were found using one-way analysis of variance. The results are expressed as the mean ± SD. P < 0.05 was considered statistically significant.