Human Tissue
GC tissues and paired noncancerous tissues were obtained from patients undergoing surgery in Tianjin Medical University Cancer Institute and Hospital (Tianjin, China). Both tumor tissues and noncancerous tissues were histologically confirmed. The pathological type of cancer tissues was confirmed as adenocarcinoma. Written consent was provided by all of the patients, and all aspects were approved by the Ethics Committee of Tianjin Medical University Cancer Institute and Hospital. Tissues were immediately frozen in liquid nitrogen after surgery and stored at -80℃.
Tumor Models
Our experimental procedures were approved by Institutional Animal Care and Research Advisory Committee of Tianjin Medical University. Female mice (BALB/c, 4 weeks) were purchased from Model Animal Center of Nanjing University. barrier facilities on a high efficiency particulate air (HEPA) filter rack. Feeding in the middle. 3×106 MFC cells were injected to the subcutaneous region of the left groin area of each mouse, 5 mice in each group. On the 14th day, a tumor model was established subcutaneously in nude mice (n = 15), when the tumor grows to a diameter of about 8 mm, 20ug of different exosomes (suspended in 40ul PBS) or PBS are injected through the tail vein every 2 days, and 5 mg/kg DDP is injected intraperitoneally every 4 days (Figure 6A). The long and short diameters of tumors were recorded every other day and then calculated tumor volume.
Cell Culture
SGC7901(human gastric adenocarcinoma cell line) and HEK293T (human embryonic kidney epithelial cell line) were acquired from the Chinese Academy of Sciences Cell Bank in Shanghai, China. The mycoplasma contamination was excluded. Cells were incubated in a humidified incubator (95% air and 5% CO2 at 37℃). DMEM (GIBCO) containing 10% fetal bovine serum (GIBCO) and 1% penicillin/streptomycin (Solarbio, China). Six pairs of gastric cancer tissues and adjacent normal tissues were collected from patients at the Tumor Research Institute and Hospital of Tianjin Medical University (Tianjin, China). Specimens of this study were approved by the Ethics Committee of Tianjin Medical University Cancer Institute and Hospital and the informed consent of patients was provided.
Isolation of Exosomes from Cell Culture Medium
After transfection of HEK293T cells for 48h, the cell culture medium was centrifuged at 3,000g for 20 minutes to remove cell debris, the supernatant was then centrifuged at 10,000g for 20 minutes to remove larger vesicles. Finally, centrifuged the supernatant at 110,000g for 80 minutes, discarded supernatant and added 100ul PBS in it, gently pipetting several times and filtered by a 0.2mm filter to obtain the exosome suspension. All steps were performed at 4 °C.
Transmission Electron Microscopy
Exosomes were immersed in a droplet of 2.5% glutaraldehyde and fixed at 4℃ for more than 12hrs. Samples were washed in PBS for 3 times and fixed in 1% osmium tetroxide for 1 hour (RT), embedded in 10% gelatin and fixed in glutaraldehyde at 4℃ and then cut into small pieces (<1 mm3). Dehydrated specimens with increasing concentrations of alcohol (30%, 50%, 70%, 90%, 95%, and 100%; ×3), replace the pure alcohol with propylene oxide and then infiltrate the samples in increasing concentrations (25%, 50%, 75%, and 100%) of Quetol-812 epoxy resin mixed with propylene oxide. Then, specimens were embedded in pure Quetol-812 epoxy resin. Ultrathin cyttings (100 nm) were cut with a Leica UC6 ultramicrotome, followed by stained with uranyl acetate (10min) and lead citrate (5 min) at RT before observation via FEI Tecnai T20 transmission electron microscope (120 kV).
Cell Transfection
SGC7901 was seeded in 6-well plates, HEK293T was in 10cm dishes, transfected with Lipofectamine 2000 (Invitrogen) and Opti-MEM (GIBCO) according to manufacturer’s instructions. For miRNA upregulation and downregulation, a 100-pmol dose of miR-15a/16 mimics, inhibitors, and NC was transfected, then cell culture medium was replaced with complete medium 4-6hrs after transfection.
Immunohistochemistry assay
Paraffin-embedded tissue samples (8 pairs, total 16 samples) of gastric cancer tissues and paired adjacent noncancerous tissues were sliced and stained with a 1:50 dilution of anti-PD-L1 monoclonal antibody (Santa Cruz Biotechnology). Positive staining was identified using the DAB system (Zhongshan Jinqiao, China). Five regions were randomly selected for each sample.
Protein Extraction and Western Blot
The expression of PD-L1was assessed by Western blot and normalized to β-actin. Cells and tissues were lysed in RIPA buffer with freshly added Protease inhibitor cocktail. The pyrolysis product was separated on SDS-PAGE Gel and then transferred onto polyvinylidene fluoride Membrane (Millpore). Immunoblots were blocked with 2% BSA for 0.5h at RT, then incubated with anti-PD-L1 (1:150, Santa Cruz Biotechnology) and anti-GAPDH (1:3000, Abcam) antibodies at 4 °C for more than 12hrs. After incubation with corresponded secondary antibody, membranes were visualized by enhanced chemiluminescence system Kit (Millipore, USA).
RNA Isolation and qRT-PCR
Total RNA from cultured cells and tissues was extracted with TRIzol reagent (Invitrogen). cDNA was obtained via avian myelobastosis virus (AMV) reverse transcriptase (TaKaRa) and the reaction process was as follows: 30 min at 16℃, 30 min at 42℃ and 5 min at 85℃. Real-time qPCR was then initiated at 95℃ for 5min; the cDNA was denatured at 95℃ for 15s and then extended at 60℃ for 1 min, which was performed for 40 cycles. All the reactions assayed in triplicate. The cycle threshold (Ct) data was calculated according to the formula of △Ct = Ct gene _ Ct control. The relative levels of genes were normalized using the equation 2-△Ct . The PD-L1 and GAPDH primers were designed as follows:
5’- GCTCCAAAGGACTTGTACGTG -3’ (PD-L1, sense),
5’- TGATCTGAAGGGCAGCATTTC -3’ (PD-L1, anti-sense),
5’- AGGTCGGTGTGAACGGATTTG -3’ (GAPDH, sense),
5’- TGTAGACCATGTAGTTGAGGT -3’ (GAPDH, anti-sense).
Flow Cytometry
Spleen T lymphocytes were isolated from wild-type BALB/c mice and then resuspended in PBS. In brief, fluorescein isothiocyanate(FITC)-conjugated monoclonal antibodies against mouse INFγ+ and phycoerythrin(PE)-conjugated monoclonal antibodies against mouse CD8+ (eBioscience, Thermofisher Scientific, San Diego, CA, USA) were incubated with isolated cells at 4 °C for 20 min. Cells were washed and purified to 99% by flow cytometry (Fig. 6A).
Statistical Analyses
All experiments were repeated in parallel at least three times and datas were expressed as mean ± SE. P < 0.05 was considered statistically significant by Student's t test: * p < 0.05; ** p < 0.01; and *** p < 0.001.