1.1 Study subjects
Recruited were CPAM children and their healthy parents who were admitted to the Department of Cardiothoracic Surgery, Children's Hospital Affiliated to Nanjing Medical University, from October 2018 to January 2019. CPAM was diagnosed by surgery and pathology in all children. Exclusion criteria: cases with other congenital lesions or known chromosomal aberrations; maternal gestational diabetes mellitus, eclampsia, phenylketonuria, smoking during pregnancy, alcoholism, use of teratogenic drugs, history of exposure to chemical teratogens, etc. The study followed the tenets of the Helsinki Declaration and was approved by the Medical Ethics Committee of Nanjing Medical University. Informed written consent was obtained from the children or their parents.
2.2 WES and sanger sequencing
Blood was sampled from the family pedigree and preserved in EDTA tubes. Genomic DNA was extracted from blood samples using the DNA Blood Min Kit (QIAGEN, Valencia, CA) following the manufacturer's standard procedures. WES was conducted by Annoyouda Biotechnology Co. Ltd. Variant detection and genotyping were performed with GATK (https://software.broadinstitute.org/gatk/) and annotated with ANNOVAR. Common variants, such as intergenic, upstream, downstream, intronic, and synonymous variants, and variants with minor allele frequency (MAF) > 1% in the 1,000 genome, ExAC, and gnomAD databases, were filtered out. PolyPhen2, SIFT, Provean and phyloP were used to predict the impact of variants on protein function and structure. All potential variants were validated by Sanger sequencing. Primer-BLAST was used to design primers online. The primers were synthesized by Nanjing Qingke Biotechnology Co., Ltd., and listed in Table 1. Variants were amplified under an optimal condition for each primer pair and then validated by Sanger sequencing using a machine of ABI-3500DX sequencer from Applied Biosystems Inc.
Table 1
Primers for Sanger verification of OBSCN mutations
Mutation | Primer | Sequence (5'-3') |
OBSCN c.3376(exon11)G > A | chr1-1054-F | CAGGAACAGGGCAGGCTTGTG |
chr1-1054-R | AGAGGCAATTAGGTGGCACC |
OBSCN c.15499(exon58)C > T | chr1-5973-F | GGATCTGTGCTTGTGAGCAC |
chr1-5973-R | GTATGTCTCCGTATCCAGCAG |
OBSCN c.22423(exon97)G > A | chr1-4800-F | CTCCTTCTATGAGGTCAAGG |
chr1-4800-R | GCTCCGTGGAACAGAAGCCTC |
OBSCN c.26510(exon115)G > C | chr1-6037-F | GACAGCCTTCATCATGTGAGTC |
chr1-6037-R | TCTGTTAGCCACGGGCACTG |
2.3 Experimental animals
C57BL/6 mice (10 males and 20 females) were purchased from the Experimental Animal Center of Nanjing Medical University. After acclimatation to the environment, the mice were caged together (female to male ratio = 2:1). The day when the female mice presented vaginal plugs was set as the baseline date (0.5th day of gestational age [E 0.5]). The lung tissues of fetal rats at E 10.5, E 11.5, E 13.5, E 15.5, E 18.5, Postnatal 0.5 days (P 0.5), P 3.5, and P 11.5 were collected.
2.4 RNA extraction and RT-PCR
Total RNA was extracted from lung samples of fetal or newborn mice using TRIzol reagent (Takara Biotechnology, Shiga, Japan). The qRT-PCR was performed using ChamQTM SYBR® qPCR Master Mix (Vazyme, Nanjing, China) on Roche LightCycler480. Primer sets included: forward primer 5'-GCTCTGTGCTGGTCGTAGTG-3' and reverse primer 5'-CCTCCTCGATGCCGTACTT-3'. The primers for β-Actin were forward primer 5'-GTGACGTTGACATCCGTAAAGA-3' and reverse primer 5'-GCCGGACTCATCGTACTCC-3'.
2.5 Protein preparation and Western blotting
The lung tissues of fetal or neonatal mice were taken and added to cell lysate (Beyotime Biotechnology, Jiangsu, China) and protease inhibitor (Roche, Mannheim, Germany), fully homogenized, and centrifuged at 12,000 rpm for 30 min. The protein concentration was detected using the BCA protein assay kit. 30 µg of protein was electrophoresed on sodium dodecyl sulfate-NuPAGE gel, transferred to polyvinylidene fluoride membranes. OBSCN antibodies (ABclonal, wuhan, China) and β-Actin antibodies (Abcam, Cambridge, MA, USA) (diluted at 1:1 000) were used and incubated overnight. After washing, secondary antibodies (diluted at 1:1000) were added and incubated at room temperature for 1 h. Immunoreactive bands were visualized with a chemiluminescence detection kit. The relative abundance of immunoreactive bands was determined with densitometry using the Image J software (NIH, Bethesda, MD, USA).