Immunohistology of human lung tissues
Human lung tissues were kindly provided by Prof. Hui-ping Li (Shanghai Pulmonary Hospital, Tongji University). Lung tissues from IPF patients undergoing lung transplantation were collected. Unused healthy donor lungs served as the controls. Written informed consent was obtained from all study participants. The study was approved by the Ethics Committee of Shanghai Pulmonary Hospital (Approval No: 2014FK04, Approved date: February 25th, 2014).
Lung tissue was fixed in formalin and embedded in paraffin. The expression levels of ATF6 and CHOP protein were visualized by immunohistochemistry. Positive expression was shown as a dark brown color. The sections were counterstained with hematoxylin and eosin. The percentages of ATF6- and CHOP-positive cells were examined under a light microscope (20×, LEICA SCN400).
Animal model and 4-PBA treatment
Specific pathogen-free grade wild-type male C57BL/6 mice (Shanghai SLAC Laboratory Animal Co. Ltd., Shanghai, China) were housed for 1-week acclimation under a 12h light/ 12h dark cycle, controlled temperature (22-24°C) and humidity (50-60%) with free access to water and standard rodent chaw (normal diets with 4% of energy from lipid, XieTong Organism, China). After 1-week acclimation, mice were randomly divided into three groups: BLM group, BLM+4-PBA group, and control group, with 20 mice in each group. The study protocol was approved by the Institutional Animal Care and Use Committee at Soochow University (Approval No.: K18-028).
On day 0, all mice were injected intraperitoneally with sodium pentobarbital (150 mg/kg body weight solution in saline, Bio-Light Biotech Co. Ltd., Shanghai, China). Following anesthetization, mice in both the BLM group and BLM+4-PBA group received intratracheal injections of BLM (5.0 U/kg body weight solution in saline, Nippon Kayaku Co. Ltd., Tokyo, Japan) to induce lung fibrosis, while mice in the control group received equivalent volumes of vehicle (saline). In accordance with previous protocols [21], the mice were injected intraperitoneally with 4-PBA (500 mg/kg body weight solution in PBS) daily starting from day 15 for 2 weeks. Mice in the BLM and control groups were injected with equivalent volumes of saline. The mice were followed up for 4 weeks and their survival until day 28 was recorded. The workflow is shown in Figure 1.
Mouse lung function
The mice underwent tracheostomies and were intubated with an 18G intravenous catheter under sodium pentobarbital anesthesia (intraperitoneal injection). The mice were then placed in a Pulmonary Maneuvers System body plethysmograph (DSI’s Buxco Electronics, Minnesota, USA) [22]. Lung function measurements were performed according to the manufacturer’s instructions as previously described. For each animal, the average of three acceptable measurements was used. The parameters that were of main interest were forced vital volume (FVC), forced expiratory volume in 50 milliseconds (FEV50), and dynamic compliance (Cdyn).
Lung Collagen Measurements
Total collagen content in mice lung tissue (30-40 mg) were quantified using a hydroxylproline assay (Nanjing Jiancheng Bioengineering Institute, Jiangsu, China) according to the manufacturer’s instructions. Hydroxyproline is a major component of the protein collagen. Using the alkaline hydrolysis method, hydroxyproline concentration is reflected as a colorimetric (550 nm) product that can be read with a spectrophotometer (Epoch2 microplate reader, BioTek, Vermont, USA), and then calculated using a standard formula according to the manufacturer’s protocol.
Histopathology of mice lung tissue
Mice were sacrificed using sodium pentobarbital anesthesia and cervical dislocation on day 21 or day 28 and the lung tissue was collected. Formalin-fixed and paraffin-embedded mice lung tissue was sectioned and mounted on adhesion microscope slides for staining with hematoxylin and eosin or Masson’s trichrome according to established protocols. The histopathological scoring for inflammation and fibrosis were performed by two experienced pathologists. The score standards were determined according to the Ashcroft score on lung histology [23].
Quantitative Reverse Transcription Polymerase Chain Reaction (qRT-PCR)
Total RNA was extracted by using the EZgeneTM Tissue RNA Miniprep Kit (BIOMIGA, San Diego, CA, USA) according to the manufacturer’s instructions. The ReverTra Ace qPCR RT Kit (TOYOBO, Osaka, Japan) was used for reverse transcription of RNA to cDNA. Quantitative real-time PCR was carried out using the ABI7500 system (Applied Biosystems). Primers for ATP6, CHOP, and β-actin (housekeeping gene) were obtained from Sangon Biotech (Shanghai, China) and their sequences are listed in Table 1. The PCR reaction was performed using the Thunderbird SYBR qPCR Mix Kit (TOYOBO, Osaka, Japan). The comparative cycle time (CT) method was used to determine the relative mRNA expression levels. The fold changes were calculated using the 2−△△CT method normalized to the housekeeping gene β-actin.
Western blot
Mice lung tissue was homogenized and the total protein extracted using the radioimmunoprecipitation assay (RIPA) lysis buffer (Solarbio, Shanghai, China). The lysate was centrifuged and the supernatant was collected. The bicinchoninic acid (BCA) Protein Assay Kit (Biotechwell, Shanghai, China) was used to determine the protein concentration. For the analysis of ATF6 and CHOP protein expression, 15-20 µg of lysates were separated on 10-12% SDS-PAGE Tris Bis gels and then transferred to nitrocellulose membranes (Millipore, Billerica, MA, USA). The membranes were incubated with 5% w/v bovine serum albumin in tris-buffered saline with Tween 20 (TBST; Sigma-Aldrich) to block non-specific binding for 2 h at room temperature. After three washes, the membranes were incubated with the following primary antibodies: anti-ATF6 Ab (1:1000, Abcam, Cambridge, USA), anti-CHOP Ab (1:1000, Cell Signaling), or anti-β-actin (1:2000, Arigo Biolaboratories, Shanghai, China) overnight at 4°C. The membranes were subsequently incubated with horseradish peroxidase-labeled secondary antibodies (1:2000, Huabio, Hangzhou, China) for 1 h at room temperature. The protein bands were visualized using the ChemiDoc™ XRS+ System (Bio-Rad, Hercules, CA, USA). Protein expression levels were determined based on the relative fluorescence intensity of the protein band and normalized to the housekeeping protein β-actin. Image analysis was carried out using Image Lab™ Software (Bio-Rad, Hercules, CA, USA).
Statistical analysis
All data were presented as the mean ± standard error (SEM). Comparison of continuous variables was carried out using the unpaired Student’s t-test for two groups or one-way analysis of variance (ANOVA) with Bonferroni’s post hoc analysis for multiple groups. Survival data for the mouse model was analyzed using Kaplan-Meier survival curves and log-rank test. p values ≤ 0.05 were considered statistically significant. All statistical analyses were performed using GraphPad Prism 5.0 (GraphPad Software, San Diego, CA).
Table 1 Primers used in quantitative real-time PCR assays.
Genes
|
Forward primers (5’→3’)
|
Reverse primers (5’→3’)
|
ATF6
|
CGGTCCACAGACTCGTGTTC
|
GCTGTCGCCATATAAGGAAAGG
|
CHOP
|
CTGGAAGCCTGGTATGAGGAT
|
CAGGGTCAAGAGTAGTGAAGGT
|
β-Actin
|
GGCTGTATTCCCCTCCATCG
|
CCAGTTGGTAACAATGCCATGT
|