Study location
This cross sectional study was carried out in University of Calabar Teaching Hospital, Cross River State, Nigeria. Cross River State is located in Southern Nigeria [26] in the Niger Delta Region. It is bounded in the north by Benue State, the west by Ebonyi and Abia State, the east by Cameroon Republic and the south by Akwa Ibom State and the Atlantic Ocean [27]. Cross River State has an area of 21,787km2 and a population of 2,892,988 (2006 census) [28]. University of Calabar is sited in Calabar Metropolis which is a fusion of Calabar south local government and Calabar municipality. Calabar has a geographical coordinates of 8019’37.02E with an estimated population of 375,196 (2006 census). [28]. The map showing the study area is in indicated in figure 1.
Study population
One hundred HIV-infected clients attending antiretroviral therapy (ART) clinic of University of Calabar Teaching Hospital were purposively recruited for this study. Positive subjects who have been confirmed and are on ART treatment who gave their consent were included while HIV negative and HIV positive subject who withheld consent were excluded.
DNA extraction
DNA was extracted using gDNA mini prep DNA extraction kit supplied by Inqaba Biotechnological South Africa. Frozen samples were thawed at room temperature. One hundred microliter (100µL) of whole blood was pipette into a microcentrifuge. About 400µL of the genomic lysis buffer was added to it. The samples were mixed by votexing for 5 seconds and were allowed to stand at room temperature for 10 minutes. The mixtures were transferred to a zymo-spin container in a collection tube. It was then centrifuged at 12,000 rpm for 1 minute. The flow through and collection tubes were discarded. The zymo-spin columns were transferred to a new collection tube and 200µL of DNA pre-wash buffer was added and centrifuged at 12,000 rpm for 1 minute. Five hundred microliter (500µL) of d—DNA was buffered and was added to the spin column and centrifuged at 12,000 rpm for 1 minute. The spin column was then transferred into another micro-centrifuge tube and 50µL of DNA elution buffer added to the spin column and incubated at room temperature for 5 minutes followed by centrifugation for 30 seconds to elute the DNA. The eluted DNA was hten subjected to nano-dropping.
CCR5 gene amplification
A portion of the CCR5 gene was amplified by polymerase chain reaction (PCR) utilizing primers that flank the 32-base pair deletion; primary: P1: P1:5'CAAAAGGTCTTCATTACACC3’ and secondary: P2: P2:5’CCTGTGCCTCTTCTCATTTC–3’. The PCR mixture included 1X master mix (which contains Tq polymerase, DNTPS, MgCl2), forward and reverse primers at concentration of 0.4 mM and 3 µL of the extracted DNA. Dnase free water of 6.36 µL was used to make up the PCR components to final volume of 20 µL. The PCR conditions used for the amplification of the gene was as follows: 940C for 3 minutes (initial denaturation), 940C for 45 seconds (denaturation), 550C for 45 seconds (annealing), 720C for 1.5 seconds (initial extension) and an extension of 720C for 5 minutes. First denaturation, annealing and initial extension was done for 5 cycles. The second was done for 35 cycles at 940C for 30 seconds (denaturation), 600C for 30 seconds (annealing) and 720C for 30 seconds (extension) carried out in a 9700 ABI Thermocycler. A 5µl aliquot of each amplicon were resolved on 4% agarose gel at 120V for 20 minutes and visualized in an ultraviolet trans-illuminator. The presence of a single fragment of 185 bp was considered to represent homozygote for CCR5 gene.
HIV-V3 region amplification
In a sterile PCR work station, the following per sample where combined; 1X master mix, 0.5mM of forward and reverse primers, 0.05 mM MgCl2, 3µl of the DNA (template) and 5.8µl of Dnase free water were added to make it to a final volume of 20µl. The PCR condition use for primary amplification was 95oC for 5minutes (initial denaturation), 35cycles of 94oC for 30seconds (denaturation), 53oC for 45 seconds (annealing) and 72oC for 45seconds (initial extension). After the 35th cycle, there was then a final extension at 72oC for 7minutes.
Agarose gel electrophoresis
Agarose gel prepared from ethidium bromide was used to run PCR amplicons as follows: five microliters (5µL) of each amphicons were loaded into the wells of the gel using a micropipette with disposable tips. A 100 bp molecular ladder was used alongside with the tank and ran at 120 V for 30 minutes. The amplicons with the lowest molecular weight moved faster than those with high molecular weight. The gel was then viewed in UV trans-illuminator and the record of the base pair taken.
Sequencing of CCR5 and HIV-V3 gene
The sequencing of the V3 gene and CCR5 was done using the Big Dye Terminator kit on ABI 3500 sequence by Inquoba, South Africa.
Phylogenic analysis
Obtained sequences were edited using the Bioinformatic software Bioedit. Similar sequences were downloaded from the National Centre for Bioinformatics Information (NCBI) using Blast N. Downloaded sequence were aligned using the alignment software MAFT and the evolutionary relationship was eliminated at 500 bootstrap using MEGA.
Statistical analysis
Data generated were expressed as frequencies and percentages