Rat care and AMI surgery
All animal experiments in the study were approved by the Institutional Animal Care and Use Committee at Shanghai University of Traditional Chinese Medicine (SHUTCM). Eight-week-old male Sprague–Dawley (SD) rats purchased from Slaccas Laboratory Animal Corporation (Shanghai, China) were maintained in a specific-pathogen-free facility of the animal experiment center of SHUTCM, with free access to food and water before use. After 1 week of acclimating to environments, the rats were anesthetized with isoflurane (5% induction and 2% maintenance), and endotracheal intubation connecting to the rodent ventilator (model UGO BASILE 7025, Milan, Italy) was performed. Once signs of discomfort or pain was no longer observed, the chest of rats was opened between the left fourth and fifth intercostal spaces by thoracotomy. After the heart was clearly exposed by a dilator, the left anterior descending coronary artery (LAD) was ligated 2mm below the left auricle to induce AMI as previously described [15]. The appearance of the left anterior myocardium converting from sanguine to paleness indicated successful establishment of an AMI model. The same procedures were performed in the sham-operated animals except LAD ligation.
Acupuncture intervention
Neiguan (PC6) was located at the distal 1/6 point on the imaginary midline connecting the palm crease and cubital crease of inner forelimb [16]. On the second day after AMI, the rats were randomly assigned into three groups: sham, control, and Acu (n = 6 per group). All the animals were separately restricted in special cylindrical devices with limbs stretching out. For the rats in the Acu group, sterilized Huatuo needles (0.25 mm×13 mm; Suzhou Medical Appliance Manufactory, Jiangsu, China) were perpendicularly inserted in bilateral PC6 at a depth of 2–3 mm and manually rotated back and forth in situ for 5 min, with a frequency of 120 times/min. For the control group, similar operations were performed at the tail non-acupoint of the rats. The sham-operated animals were only restrained without acupuncture intervention. Acupuncture or sham treatment was performed once daily for 6 days.
GW4869 treatment in acupuncture-intervened rat
GW4869 was used to inhibit exosome secretion to clarify the roles of exosomes in the effects of acupuncture. It was dissolved in DMSO (0.005%). On the second day after AMI, the rats were randomly assigned into four groups: sham, control, Acu, and Acu plus GW4869 (n = 6 per group). The first three groups were treated as above. The rats in the Acu plus GW4869 group were intraperitoneally injected with GW4869 at one dose of 1.5 mg/kg 1 h before daily acupuncture.
Histological examination
Seven days after AMI, all the animals were anesthetized with isoflurane as described above. The rats were transcardially perfused with 0.1 M PBS followed by 4% paraformaldehyde. The hearts were then cut transversely at the widest parts of the infarcted regions. Tissues were embedded in Tissue Tek OCT compound (Sakura, Tokyo, Japan), snap-frozen with liquid nitrogen, and stored at − 80°C. The blocks were serially sliced into 5µm sections by cryostat microtome (Thermo Scientific, USA). Ten continuous sections from each block were stained using Masson’s trichrome (Masson). Images were acquired using a light microscope (Olympus, Japan). The infarct size and left ventricular wall thickness were analyzed as previously described [15].
Terminal deoxynucleotidyl transferase (TdT)-mediated dUTP nick-end labeling (TUNEL) assay
The TUNEL method was used to identify apoptotic cells in the infarcted tissues in accordance with the instructions of the manufacturer (Beyotime, Shanghai, China). Sections were washed thrice with PBS and then incubated with 0.5% TritonX-100 for 5 min at room temperature. The TUNEL reaction mixture containing TdT and FITC-dUTP was added to the specimens and reacted for 60 min in a dark humidified atmosphere. After the nuclei were stained by DAPI, the results of TUNEL assay were observed under the fluorescence microscope (Olympus IX50, Japan).
Western blot analysis
Frozen tissues of the left ventricle anterior wall were homogenized in ice-cold RIPA lysis buffer that contained a protease inhibitor cocktail and a phosphatase inhibitor cocktail. The tissue lysates were centrifuged at 12,000×g for 20 min at 4°C. After the protein concentration of the supernatants was determined by BCA analysis (Beyotime, Shanghai, China), proteins (40 µg) were separated on a 12% SDS-polyacrylamide gel and transferred on NC membrane (Merck, Darmstadt, Germany). The membrane was incubated with primary antibodies, such as anti-CC3 antibody (Cell Signaling Technology, USA), anti-Bcl-2 antibody (Abcam, USA), or anti-BAX antibody (Cell Signaling Technology, USA), at 4°C overnight and incubated with secondary antibodies conjugated with peroxidase for 1 h at room temperature. Afterwards, the bands on the membrane were visualized using enhanced chemiluminescence Western blot detection reagents (NCM Biotech, Suzhou, China). Meanwhile, images were acquired using the Molecular Imager system (Bio-Rad, California, USA). The relative value of band density was analyzed by ImageJ software.
MiRNA sequencing and analysis of PC6 acupoint
The rats were sacrificed by euthanasia on the seventh day after MI to clarify the changes in the miRNA expression of PC6 acupoint. The PC6 tissues, including skin, subcutaneous tissue, and muscle tissue, were harvested. A total of nine samples from the sham, control, and Acu group were immediately frozen in liquid nitrogen and transported to Shanghai Majorbio Bio-pharm Technology Co., Ltd. for miRNA sequencing. The bioinformatics data were analyzed through the cloud platform of Majorbio Bio-Pharm Technology Co., Ltd.
Plasma exosome isolation and identification
Exosome was isolated from rat plasma as described [17]. Blood sample was collected from the abdominal aorta of the anesthetized rats before they were sacrificed and then centrifuged for 30 min at 1000 g in a tube with anticoagulant added. The plasma was then transferred to a new tube and centrifuged at 2000 g for 15 min at 4°C to deplete cell debris. Thereafter, it was centrifuged at 10,000 g for 30 min at 4°C to remove large micro vesicles. Anequal volume of 16% polyethylene glycol (PEG) with Mn of 6000 (Sigma, USA) was added to the supernatant and let stand at 4°C overnight after mixing thoroughly. On the next day, the samples were centrifuged at 16,000 g for 1 h at 4°C. The precipitations were suspended in 1 mL PBS and ultracentrifuged (100,000 g) for 70 min to wash the particles of the contaminated protein and PEG. The resulting pellet was suspended in 50 µL of particle-free PBS (pH 7.4) and stored at – 80°C for further use.
The morphology of exosomes was observed using the Tecnai G2 Spirit Biotwin transmission electron microscope (FEI, Hillsboro, USA). The size distribution and concentration of exosomes were measured by nanoparticle tracking analysis (NTA) with Zeta View Particle Metrix 110 (Particle Metrix, Meerbusch, Germany) after diluting 10 µL exosomes in 1 mL PBS. The marker proteins of exosomes (CD9, CD63 CD81, and Alix) were detected by Western blot. The quantity of exosomes was determined using a BCA kit (YEASEN, Shanghai, China) for measurement of total protein. A PKH26 red fluorescent labeling kit (Umibio, Shanghai, China) was used in accordance with the manufacturer’s instructions to label the purified exosomes.
RT-PCR detection
The RNAiso for Small RNA kit (Takara, Dalian, China) was utilized to extract the total small RNA from exosomes and tissues. First-strand cDNA was reverse-transcribed with Mir-X miRNA First-Strand Synthesis Kit (Takara, Dalian, China). For miRNA quantification, TB Green Advantage RT-PCR Premix and mRQ 3′ Primer (Takara, Dalian, China) were used in real-time RT-PCR, and the delta-delta Ct method was applied to determine the relative expression of each miRNA to the level of U6 snRNA. All specimens were analyzed in triplicate. The following forward primers were used for the miRNAs of interest: miR-21-5p 5′ ACGTTGTGTAGCTTATCAGACTG 3′; miR-21-3p 5′ TGCGCCAACAGCAGTCGATGGG 3′; miR-27-5p 5′ GCGGCGGAGGGCTTAGCTGCTTG 3′; miR-31-5p 5′ CGGCGGAGGCAAGATGCTGGCA 3′; miR-142-5p 5′ GGCCCATAAAGTAGAAAGC 3′; miR-142-3p 5′ CTCCTGTAGTGTTTCCTAC 3′; miR-223-5p 5′ TCGCGTGTATTTGACAAGCTGAGTTG 3′; miR-223-3p 5′ GAAGTTCGTCCTGTCAGTTTGTC 3′.
Cell culture
H9c2 cells (Cobioer, Nanjing, China), derived from embryonic rat cardiomyoblast, were cultured in complete DMEM containing 10% exosome-depleted FBS, 100 U/mL penicillin, and 100 µg/mL streptomycin and incubated at 37°Cin a humidified atmosphere of 5% CO2 in air.
H2O2 treatment
H9c2 cells were seeded in a 96-well plate at a density of 1×104 per well and pretreated with exosomes (40µg/mL) isolated from the sham, control, and Acu groups for 24 h. After the complete culture medium was replaced by serum-free medium, the plate was incubated with 400 µM H2O2 for 2h. The cell viability of H9c2 cells was detected by CCK-8 assay (YEASEN, Shanghai, China) in accordance with the manufacturer’s instruction. The H9c2 cells were seeded in a six-well plate, with 5×105 cells per well, and similar experiments were performed as described above to investigate the protein expression these cells treated with H2O2.
Target gene prediction and identification
The online tools (miRanda, miRDB and TargetScan) were used to predict the target genes of rat miR-142-3p. Among the possible miR-142-3p target genes, this study focused on CFL2, which is involved in MI and the apoptosis pathway. Dual-luciferase reporter gene assay was performed to identify the target gene in 293 T cells. In brief, 3′ UTR and its site-specific mutated forms of CFL2 were cloned into the XbaI/XbaI site of the GV272 vector (GeneChem Biotechnology Company, Shanghai, China), which contains firefly luciferase reporter genes. Then, 1×105 293 T cells were seeded in a 24-well plate. The recombinant plasmid constructs (CFL23′-UTR and CFL23′-UTR-mut, 0.1 µg) were separately transfected into the 293 T cells with Renilla luciferase internal control plasma (pRL-TK, 0.02 µg) and miR-142-3p (0.4 µg) or the negative control of mimic plasma (NC mimic, 0.4 µg) by X-tremegene HP DNA transfection reagents (1 µl, ROCHE, Basel, Switzerland) as follows: Luc-CFL23′-UTR-NC + miR-142-3p-NC, Luc-CFL23′-UTR-NC + miR-142-3p-NC, Luc-CFL23′-UTR-NC + miR-142-3p, Luc-CFL23′-UTR-Mut + miR142-3p-NC, and Luc-CFL23′-UTR-Mut + miR142-3p. The firefly luciferase activity and Renilla luciferase activity were examined at 48 h post-transfection by using the dual-luciferase reporter assay system (Promega, Madison, USA) in accordance with the manufacturer’s instructions. Each treatment was performed in triplicate at least three times.
Lentivirus preparation and transfection
The miRNA-142-3p mimic, miR-142-3p sponge, and scrambled control lentiviruses, which all carried Cherry red expression constructs, were designed and synthesized by GeneChem Biotechnology Company (Shanghai, China). H9c2 cells were seeded in 24-well plates with a density of 5×104 cells per well. When the cells reached 70% confluence, lentiviral vectors were added to culture medium at an MOI of 50, followed by 5 µg/mL polybrene. The miRNA-142-3p-overexpressing cells, miR-142-3p sponge-expressing cell, and scrambled control cells were selected using either puromycin or neomycin.
Statistical analysis
Each experiment was repeated at least three times independently, and all derived statistical values were presented as the mean ± SEM. The statistical significance between sets of data was determined using GraphPad Prism 6 (GraphPad, San Diego, CA). Student’s t-test was applied to compare two groups. For comparison of multiple groups, ANOVA followed by Tukey’s multiple comparison test was used. Differences were considered statically significant at a P value of < 0.05.