Chemicals and antibodies
Chemicals were obtained as follows: eeyarestatin-1 (Eer1), LY294002, PD98059, U0126, SP600125, and SB203580 from Calbiochem (EDM Millipore Corp., Billerica, MA, USA); CB-5083 from Biovision (Milpitas, California, USA); NMS-873 from APExBIO (Houston, TX 77014, USA); z-VAD-fmk from R&D Systems (Minneapolis, MN, USA); Necrostatin-1 (Nec-1), 3-methyladenine (3-MA), bafilomycin A1 (Bafilo), chloroquine (CQ), Ferrostatin-1 (Ferro), and cycloheximide (CHX) from Sigma-Aldrich (St. Louis, MO, USA); PP242 and Torin1 from Selleckchem (Houston, TX 77014, USA); TRAIL from KOMA BIOTECH (Seoul, South Korea); MitoTracker-Red (MTR), tetramethylrhodamine methyl ester (TMRM), 4′,6-diamidino-2-phenylindole (DAPI), and propidium iodide (PI) from Molecular Probes (Eugene, OR, USA). The following antibodies were used: VCP (#2648), GFP (#2555), p-eIF2α (#9721), eIF2α (#9722), CHOP (#2895), Nrf1(#8052), p-ERK1/2 (#9101), ERK (#9102), p-Akt (S473) (#9271), Akt (#9272), p-Akt (T308) (#9275), p-p70S6K (#9234), p70S6K (#2708), p-4EBP1 (#9451), 4EBP1 (#9452), Raptor (#2280), Rictor (#2114), and ATF4 (#11815) from Cell Signaling Technology (Danvers, MA, USA); β-actin (sc-47778), cytochrome C (sc-13156), Tom20 (sc-11415), ubiquitin (sc-8017), ATF4 (sc-200), and Mcl-1 (sc-819) from Santa Cruz (Dallas, TX, USA); α-Puromycin (MABE343) from Millipore (Billerica, MA, USA); Calnnexin (CNX; PA5-19169) from Invitrogen (Carlsbad, CA, USA); Tim 23 (611222) from BD biotechnology (San Jose, CA, USA); Caspase-3 (ADI-AAP-113) from Enzo Life Sciences (Farmingdale, NY, USA); poly (ADP-ribose) polymerase (PARP; ab32071), and Bap31 (ab37120) from Abcam (Cambridge, UK). Ras (clone RAS10, #05-516) from Millipore; Used secondary antibodies are as follows: anti-rabbit IgG HRP (G-21234) and anti-mouse IgG HRP (G-21040) from Molecular Probes, Inc. (Eugene, OR, USA); anti-rat IgG HRP from Sigma, A9037-1).
Cell culture
The human breast cancer cell lines, the MCF10A human mammary epithelial cell line, and HEK-293T cells were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA). All cell lines were routinely tested for mycoplasma contamination. The authenticity of the cell lines was verified using standard morphological examination with a microscope. Cells were cultured as follows: MDA-MB 231 and BT549 cells in RPMI-1640 medium (GIBCO-BRL, Grand Island, NY, USA); T47D, and MDA-MB 468 cells in DMEM with high glucose (Hyclone, Logan, UT, USA); MDA-MB 435S cells in DMEM with low glucose (Hyclone); Hs578T cells in 10 µg/ml insulin (Sigma-Aldrich, St. Louis, MO, USA)-containing DMEM high-glucose medium supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin (GIBCO-BRL); and MCF10A cells in DMEM/F12 medium supplemented with 5% horse serum, insulin, human epidermal growth factor, hydrocortisone, and cholera toxin (Calbiochem).
Cell viability assay
All the experiments were performed in a low-glucose DMEM medium to exclude the effects of high glucose concentrations. Cells cultured in 24-well plates (4x104 cells per well) were treated as indicated, fixed with methanol/acetone (1:1) at − 20°C for 5 min, washed with PBS, and stained with 1 µg/ml propidium iodide at room temperature for 10 min. The plates were imaged on an IncuCyte device (Essen Bioscience, Ann Arbor, MI, USA) and analyzed using the IncuCyte ZOOM 2016B software. The processing definition of the IncuCyte program was set to recognize attached (live) cells by their red-stained nuclei. The percentage of live cells was normalized to that of untreated control cells (100%).
Immunoblot analysis
Immunoblot analysis was performed as described previously (36). The fold change of each target protein level compared to β-actin was determined by densitometric analysis. The representative results from at least three independent experiments are shown. Unprocessed scans of immunoblots are provided as Source Data.
Immunofluorescence microscopy
After treatments, cells were fixed with acetone/methanol (1:1) for 5 min at − 20°C or with 4% paraformaldehyde for 10 min at room temperature. The fixed cells were blocked in 5% BSA in PBS for 30 min and incubated overnight at 4°C with primary antibodies diluted (1:500) in blocking buffer [anti-BAP31 (rabbit, ab37120 from Abcam), -Tim23 (mouse, 611222 from BD), -CNX (rabbit, GTX109669 from GeneTex), -cytochrome c (mouse, sc-13156 from Santa Cruz), or -Tom20 (mouse, sc-17764 from Santa Cruz)]. The cells were then washed and incubated with diluted (1:1000) anti-mouse or anti-rabbit Alexa Fluor 488 or 594 (Molecular Probes) for 1 h at room temperature. After being mounted on slides with ProLong Gold antifade mounting reagent (Molecular Probes), cells were observed with a K1-Fluo confocal laser scanning microscope (Nanoscope Systems, Daejeon, Korea) and an appropriate filter set (excitation bandpass, 488 nm; emission bandpass, 525/50).
Transmission electron microscopy
Cells were pre-fixed in Karnovsky’s solution (1% paraformaldehyde, 2% glutaraldehyde, 2 mM calcium chloride, 0.1 M cacodylate buffer, pH 7.4) for 2 h and washed with cacodylate buffer. Post-fixing was done with 1% osmium tetroxide and 1.5% potassium ferrocyanide for 1 h. After dehydration with 50–100% alcohol, cells were embedded in Poly/Bed 812 resin (Pelco, Redding, CA, USA), polymerized, and observed under an electron microscope (EM 902A, Carl Zeiss, Oberkochen, Germany).
Mouse xenograft studies
The animal experiment followed the guidelines and regulations approved by the Institutional Animal Care and Use Committees of Asan Institute for Life Science. Female BALB/c nude mice (nu/nu, 5 weeks old; Japan SLC, Hamamatsu, Japan) were injected in the right flank with MDA-MB 435S cells (5 × 106 cells/mouse). Tumors were allowed to grow for 3 weeks until the average tumor volume reached 100 ~ 150 mm3. Mice were randomized into three groups (n = 5 per group) and received oral administration (O.A.; qd4/3off) of vehicle (PBS containing 0.25% DMSO), 100 mg/kg CB-5083, or 150 mg/kg CB-5083. Researchers were blinded to the group allocations during the experiment and when assessing the outcome. Tumor size was measured twice a week for 2 weeks, and tumor volume was calculated using the formula [V = (L x W2) x 0.5, where V = volume, L = length, and W = width]. On the 15th day, mice were sacrificed, and the tumors were isolated, fixed in 4% paraformaldehyde, and embedded in paraffin. Tissue sections stained with H&E were observed under a K1-Fluo microscope (Nanoscope Systems) and photographed using a complementary metal-oxide-semiconductor (CMOS) camera.
Construction of the plasmids encoding mCherry-VCP WT and mCherry-VCP QQ
mCherry-VCP WT and mCherry-VCP QQ were generated from the plasmids VCP (wt)-EGFP (#23971) and VCP(DK0)-EGFP (VCP QQ) (#23974) (Addgene, Watertown, MA, USA), respectively, using the pENTRY/pDEST-mCherry system (Invitrogen). The fragments encoding VCP WT and VCP QQ were PCR amplified with appropriate primers (forward: ATGGCTTCTGGAGCCGATTCA, reverse: GCCATACAGGTCATCVATCATT) to generate the pENTRY-VCP WT and pENTRY-VCP QQ vectors. mCherry-VCP WT and mCherry-VCP QQ were generated by recombining the pENTRY-VCP WT or pENTRY-VCP QQ vector with a pCS-mCherry vector using a Gateway LR cloning system (Invitrogen).
Generation and preparation of the recombinant adenoviruses expressing VCP WT-EGFP and VCP QQ-EGFP
To generate replication-incompetent adenovirus expressing VCP WT-EGFP or VCP QQ-EGFP, the VCP WT-EGFP- or VCP QQ-EGFP-encoding DNA fragment was excised from the VCP WT-EGFP (#23971, Addgene) or VCP(DKO)-EGFP (#23974, Addgene) plasmid, respectively, using BamH1 and BglII and ligated with the BamH1-digested adenoviral shuttle vector, pCA14. The resulting adenoviral shuttle vector, pCA14/VCP WT-EGFP or pCA14/VCP QQ-EGFP, was linearized by PvuI digestion, and the E1/E3-deleted adenoviral vector, dE1-RGD, was linearized by BstBI digestion. The two linearized vectors were cotransformed into E. coli BJ5183 competent cells for homologous recombination. The resulting adenoviral plasmid, dE1/VCP WT-EGFP or dE1/VCP QQ-EGFP, was digested with PacI and transfected into 293A cells. Finally, adenoviruses expressing VCP WT-EGFP or VCP QQ-EGFP were propagated, amplified in 293A cells, and purified using cesium chloride density gradient centrifugation, as described previously (68, 69).
Small interfering RNA-mediated gene silencing
siRNA Negative Control (siNC) (Stealth RNAi™, 12935300) was purchased from Invitrogen (Carlsbad, CA, USA). VCP targeted siRNAs were purchased from QIAGEN (Hilden Düsseldorf, NRW, Germany): siVCP #1 (target sequence AACAGCCATTCTCAAACAGAA); siVCP #2 (target sequence ATCCGTCGAGATCACTTTGAA); siVCP #3 (target sequence AAGATGGATCTCATTGACCTA). CHOP (DDIT3) targeted siRNA was synthesized from Invitrogen: siCHOP (target sequence GAGCUCUGAUUGACCGAAUGGUGAA) and siATF4 (target sequence CCACUCCAGAUCAUUCCUU, GGAUAUCACUGAAGGAGAU, and GUGAGAAACUGGAUAAGAA, sc-35112) were from Santa Cruz. According to the manufacturer’s instructions, the pairs of siRNA oligonucleotides were annealed and transfected to cells using the RNAiMAX reagent (Invitrogen). Western blotting of the proteins of interest was performed to confirm successful siRNA-mediated knockdown.
Lentivirus-mediated shRNA transduction
To generate the lentiviral vectors encoding short hairpin RNA (shRNA), pLKO.1 neo plasmid (#13425: Addgene, Cambridge, MA, USA) was digested using AgeI and EcoRI. Two oligonucleotide strands were mixed, incubated at 95°C for 4 and 70°C for 10 min, and slowly cooled to room temperature using a PCR machine. The annealed oligo pair was ligated to digested pLKO.1 neo plasmid using T4 ligase at 20°C for 16 h. The sequences of the oligonucleotides used to knock down each target gene are listed in Supplementary Table 1. To produce the lentivirus containing each plasmid, HEK-293T cells were transfected with the lentiviral vector in the presence of pMD2.G /psPAX2.0 using linear polyethyleneimine (MW2,500; Polysciences, Warrington, PA, USA). After transfection, the virus-containing supernatants were filtered, combined with polybrene, and used to infect MDA-MB 435S cells. qRT-PCR and Western blot analyses validated the efficiency of transfection. The sequences of the shRNA are provided in Supplementary Table 1.
Quantitative real-time RT-PCR (qRT-PCR)
Total RNA was extracted using the TRIzol® reagent (Invitrogen). cDNA was synthesized from 1 µg of total RNA using an M-MLV cDNA Synthesis kit (EZ006S; Enzynomics, Daejeon, Korea). Quantitative real-time polymerase chain reaction (qRT-PCR) was performed using a Bio-Rad Real-Time PCR System (Bio-Rad, Richmond, CA, USA). Results were analyzed using the 2–ΔΔCt method (70). The primers used for qRT-PCR are listed in Supplementary Table 2.
Establishment of MCF10A cell lines stably expressing HRasG12V and KRasG12V
To establish cell lines stably expressing HRasG12V and KRasG12V, GP2-293 packaging cells were co-transfected with pVSV-G (#631530: Clontech, Mountain View, CA, USA) plus pBABE-puro, pBABE puro H-Ras V12, or pBABE puro K-Ras V12 (#9051, #9052, or #1764: Addgene) using a CalPhos™ Mammalian Transfection Kit (#631312, Clontech) according to the manufacturer’s instructions. Retroviral supernatants were used to transduce MCF10A cells in the presence of polybrene (5 mg/mL; Millipore, Burlington, MA, USA). Transduced cells were selected with puromycin (Invivogen, San Diego, CA, USA) for 3 weeks. Selected single cells were isolated, and the expression of HRasG12V and KRasG12V was confirmed by Western blotting.
Morphological examination of endoplasmic reticulum (ER) and mitochondria
Cell lines stably expressing fluorescence specifically in the ER lumen (YFP-ER cells), ER membrane (Sec61β-GFP cells), or mitochondria (YFP-Mito cells) were as previously described (16). YFP-ER cells were stained with 100 nM MitoTracker-Red (MTR) for 10 min to observe the ER and mitochondria simultaneously. Confocal microscopy was performed using a K1-Fluo confocal laser scanning microscope (Nanoscope Systems, Daejeon, Korea) and an appropriate filter set (excitation bandpass, 488 nm; emission bandpass, 525/50).
Analysis of protein synthesis by puromycin labeling
Semi-quantitative monitoring of protein synthesis was carried out based on the previously described SUnSET method (47). Briefly, newly synthesized peptides were labeled in cultured cells by adding 10 µg/ml puromycin for 10 min before cells were collected. Whole-cell extracts were prepared for Western blotting using an anti-puromycin antibody (Millipore) and anti-mouse IgG-HRP-linked antibody (Molecular Probes). The fold changes in the protein levels of interest compared to that of β-actin were calculated following densitometric analysis.
Statistical analysis
All experiments were repeated at least three times. Data were presented as the mean ± standard deviation. All the performed statistical analyses are described in each figure legend. Statistical p-values were obtained by application of the appropriate statistical tests using the GraphPad Prism 9 (Graph Pad Software Inc, San Diego, CA, USA). The normality of data was assessed by Kolmogorov–Smirnov tests and equal variance using Bartlett’s test. For a normal distribution, statistical differences were determined using an analysis of variance (ANOVA), followed by the Bonferroni multiple comparison test. If the data were not normally distributed, Kruskal–Wallis test was followed by Dunn’s test. For all tests, p < 0.05 was considered significant (ns: not significant, *p < 0.05, **p < 0.01, ***p < 0.001, **** p < 0.0001).