2.1 Animals
Eight-week-old, male Wistar rats (280g-320g) were obtained from the Experimental Animal Center of Hebei Medical University. The rats were housed two per cage in an air-conditioned room at temperature 25 ± 2°C. The rats were maintained in a 12-h light/12-h dark cycle with access to food and water ad libitum. All the animal studies were approved by the Laboratory Animal Ethical and Welfare Committee of Hebei Medical University (Approval No. IACUC-Hebmu-2020013). We tried our best to minimize the suffering and the number of rats used in the experiments. Adult rats were sacrificed by decapitation under inhalation anesthesia with 4–5% isoflurane for the sampling of fresh brains.
2.2 Global brain ischemia
The global brain ischemia model was established by four-vessel occlusion [35]. Briefly, the bilateral vertebral arteries of the rats were permanently electrocauterized under isoflurane anesthesia (2-2.5%). Two days later, the bilateral common carotid arteries of the rats were exposed under isoflurane anesthesia and then clamped for either 3 min for CIP or 8 min for ischemic insult (II). When CIP was followed by II, the interval between them was 2 days. Only rats with dilated pupils, loss of consciousness and righting reflex after four-vessel occlusion were used in the subsequent experiments. The body temperature of the rats was maintained at about 37°C during the operations until the rats recovered. Sham operation only includes the electrocauterization of bilateral vertebral arteries under isoflurane anesthesia (2-2.5%).
2.3 Intracerebroventricular injection
Intracerebroventricular injections were administered as described in our previous study [36]. Briefly, adeno-associated virus (AAV) carrying Klotho shRNA (sh-KL; titer: 1.60×1012 V.G./ml; 3 µl; GenePharma, Shanghai, China), AAV carrying STAT4 shRNA (sh-STAT4; titer: 8.34×1012 V.G./ml; 3 µl; GenePharma, Shanghai, China), and AAV carrying negative control shRNA (sh-NC; titer: 1.18×1012 V.G./ml; 3 µl; GenePharma, Shanghai, China) were respectively injected into the right lateral ventricle 14 d before CIP using microinjector under isoflurane. Recombinant Klotho (density:1µg/3µl; 3µl; Cat No. ab84072, abcam, UK) and its control solvent, normal saline (NS; 3µl), were respectively injected into right lateral ventricle 1 d before ischemic insult. The injection sites were located 0.8 mm posterior to the bregma, 1.5 mm lateral to the midline, and 3.8 mm ventral to the surface. The sequences of AAV-shRNA were listed in Table 1.
Table 1
The sequences of AAV-sh-RNA
Name | AAV-sh-RNA (5′ ~ 3′) |
AAV-GP-NC | TTCTCCGAACGTGTCACGT |
AAV-sh-KL | CAAACCGTCTATTAAACAT |
AAV-sh-STAT4 | GGAGAAATTACAGGAGCAA |
NC: negative control; KL: Klotho |
2.4 Plasmid and reporter gene construct
The plasmid pcDNA3.1-STAT4 (NM_001012226) and pcDNA3.1 vector were purchased from Changsha Youbao Biotechnology Co., LTD and the rat KL promoter region (− 2000 ~ + 10) was cloned into the pEZX-basic reporter (cat: ZX001, GeneCopoeia, Guangzhou, China), named as Full KL. We identified five putative binding sites with a binding probability of higher than 95% on the KL promoter through Jaspar database, including S1 (− 324/- 311), S2 (− 682/- 669), S3 (− 881/- 868), S4 (− 1679/- 1666), S5 (− 1861/- 1848). With reference to the five putative binding sites, a series of deletions in 5′ region of the KL promoter was constructed by inserting PCR product into pEZX-basic by homologous recombination in our study. They were named as Full KL (− 2000/+ 10), KL-1 (− 1689/+ 10), KL-2 (− 1061/+ 10), KL-3 (− 692/+ 10), and KL-4 (− 442/+ 10) (the first number of each construct indicating the first nucleotide of the KL promoter) (Genecefe Biotechnology, Jiangsu, China). To test the binding specificity, the predictive STAT4 binding site (S3) in the KL-2 was mutated (TTTATAGGAAGGAC replaced with CCCGCGAAGGAAGT). All primers are listed in Table 2.
Table 2
Name | Sequence |
FULL KL forward primer | AGTGCAGGTGCCAGAACATTTCTCTACTAGTTAGATCCCCAGCCTCAAC |
FULL KL reverse primer | TGTTCTTAGCATCGGCCATGGTGGCGGATCCCGGGAGCCGGGAGGGCACCGCGCCG |
KL-1 forward primer | AGTGCAGGTGCCAGAACATTTCTCTACTAGTTGACTGTGAGGTTGCAGGAAGTAAT |
KL-1 reverse primer | ditto |
KL-2 forward primer | AGTGCAGGTGCCAGAACATTTCTCTACTAGTTTCAAAGGGCCTTGAGAGA |
KL-2 reverse primer | ditto |
KL-3 forward primer | AGTGCAGGTGCCAGAACATTTCTCTACTAGTGGAAGAGAGGATGCAGGGAAA |
KL-3 reverse primer | ditto |
KL-4 forward primer | AGTGCAGGTGCCAGAACATTTCTCTACTAGTAAAGATTCCCCTGAGTGGAA |
KL-4 reverse primer | ditto |
2.5 Cell culture and transfection
PC12 (Cat No.: CL-0481) cells and HEK-293T cells (Cat No.: CL-0005) were obtained from Procell Life Science and Technology. The cells were cultured in RPMI-1640 (PM150110) medium with 10% FBS (164210-500) and 1% P/S (PB180120), in a 37°C incubator containing 5% CO2. PC12 cells were transfected with pcDNA3.1-STAT4 plasmid and small interfering RNA (siRNA) with Lipofectamine 2000 transfection reagent (Invitrogen) according to the manufacturer’s introduction. Following transfection, RT-qPCR and western blotting were performed for cells. The sequences of siRNA are listed in Table 3.
Table 3
Name | sense (5′ ~ 3′) | Antisense (5′ ~ 3′) |
SiRNA STAT4 | GGAGAAAUUACAGGAGCAATT | UUGCUCCUGUAAUUUCUCCTT |
Negative control | UUCUCCGAACGUGUCACGUTT | ACGUGACACGUUCGGAGAATT |
2.6 Reverse transcription-quantitative real-time PCR (RT-qPCR)
Total RNA was isolated from cells using E.Z.N.A.® Total RNA Kit II (ref.# R6934-01, Omega BIO-TEK, USA). RNA concentrations were measured, and the quality was determined at 260/280 nm absorbance using a microplate reader (BioTek, USA). Reverse transcription was performed using HiScript® III SuperMix for qPCR (Code No. R323-01, Vazyme, China). qPCR assay was performed using ChamQ Universal SYBR qPCR Master Mix (Code No. Q711-03, Vazyme, China) in CFX96TM Real-Time system (Bio-Rad, California, USA). The expression of GAPDH was used as control. The mRNA levels of STAT4 and Klotho were respectively calculated using 2−ΔΔCt method. The primer information was listed in Table 4.
Table 4
Sequence of primers used for RT-qPCR and ChIP-qPCR
Name | Forward Primer | Reverse Primer |
STAT4 | CTATCAGCTCTGCCATTCGC | GTCGGTCTTGAAACTTCGCA |
Klotho | ACTTTCTTCTGCCCTATTTCACG | CCAGGTAATCGTTGTATTTTATCGG |
GAPDH | ATGTTCCAGTATGACTCTA | CACCCCATTTGATGTTAG |
KL-2 | GGCCTTGAGAGAACTGAGGA | ACACCACTCTGGAGGGAAAG |
NC probe | GCCTAACCGACGTAGGAGAA | GCGAATGATTGCCCAAGAGT |
2.7 Western blotting
The CA1 region of hippocampal tissues and cells were lysed in RIPA buffer and the protein contents were determined by BCA Protein Assay Kit (Cat No. PC0020, Lot No. 20210901, Solarbio®, China). Equivalent amounts of each protein extract were separated on 10% sodium dodecyl sulphate polyacrylamide gelelectrophoresis, and transferred onto a polyvinylidene fluoride membrane. After being blocked, membranes were treated with the primary antibodies overnight at 4℃. The primary antibodies were as follows: rabbit anti-Klotho polyclonal antibody (1:2000, Cat No. PA5-88303, Invitrogen, USA), rabbit anti-NLRP3 polyclonal antibody (1:1000, Cat No. 19771-1-AP, Proteintech, China), rabbit anti-GSDMD polyclonal antibody (1:1000, Cat No. AF4012, Affinity Biosciences, China), rabbit anti-pro-caspase-1 polyclonal antibody (1:1000, Cat No. ET1608-69, HUABIO, China), rabbit anti-cleaved caspase-1 polyclonal antibody (1:1000, Cat No. E2621, Cell Signaling, USA), mouse anti-STAT4 polyclonal antibody (1:1000, Cat No. 67568-2-1g, Proteintech, China), and rabbit anti-GAPDH polyclonal antibody (1:5000, Cat No. 10494-1-AP, Proteintech, China). The membranes were washed and then treated with the secondary antibodies for 60 min at 37℃. The secondary antibodies were as follows: goat anti-rabbit IgG (1:3000, Cat No. SA00001-2, Proteintech, China) for Klotho, NLRP3, GSDMD, pro-Caspase1, cleaved-Caspase1 and GAPDH; goat anti-mouse IgG (1:2000, Cat No. SA00001-1, Proteintech, China) for STAT4. After washing, proteins on membranes were detected using enhanced chemiluminescence (ECL, Vazyme, Nanjing, China) and photographed using an Amersham Imager 600 (Alpha Inotech, USA). The integral optical density (IOD) of each band was measured using a gel image analysis system (Alpha Image 2200, Alpha, USA).
2.8 Thionin staining
The thionin staining was performed as previously described [36]. In brief, the rats were perfused with 4% paraformaldehyde under isoflurane anesthesia and sacrificed at 7 d after cerebral ischemia. The brain tissues were subsequently sectioned at 5 µm thickness and stained with thionine. The number of surviving pyramidal neurons in hippocampal CA1 region within 1 mm linear length was counted, which was named as neuronal density (ND).
2.9 Immunohistochemistry
Immunohistochemistry was performed as previously described [37]. Briefly, the brain slices were incubated with rabbit anti-Klotho polyclonal antibody (1:50, Cat No. PA5-88303, Invitrogen, USA), rabbit anti-GSDMD polyclonal antibody (1:100, Cat No. AF4012, Affinity Biosciences, China), and mouse anti-STAT4 polyclonal antibody (1:100, Cat No. 67568-2-1g, Proteintech, China) overnight at 4℃. Brain sections were washed three times with PBS and subsequently incubated with secondary antibodies (Cat No. SP-0022, Bioss, China) for 60 min at 37℃. Then, the brain sections were incubated with horseradish peroxidase-conjugated streptavidin working solution (Cat No. SP-0022, Bioss, China) for 60 min at 37℃. After being washed with PBS, the slices were treated with a DAB substrate (Cat No. ZLI-9017, Zhongshan, China). Photomicrographs were obtained using a microscope (Olympus, BX63, Japan) and then analyzed using ImagePro Plus software. Experimenters were blind to the treatments.
2.10 Immunofluorescence
Immunofluorescence was performed as previously described [38]. The preparation of paraffin sections of brains had been described above in 2.8 (thionin staining). Paraffin-embedded sections of brain tissue (5 µm) were deparaffinized, and Citrate Antigen Retrieval solution (0.01 M) was used for antigen retrieval. The sections were blocked with 5% goat serum for 1 h at 37℃, and then were incubated with the NLRP3 (1:50, Cat No. 19771-1-AP, Proteintech, China), GSDMD (1:50, Cat No. 20770-1-AP, Proteintech, China) and NeuN (1:100, Cat No. 66836-1-Ig, Proteintech, China) antibody at 4℃ overnight. After being washed with PBS, the sections were incubated with Alexa Fluor 594 goat anti-rabbit IgG (1:200, Cat No. SA00013-4, Proteintech, China) and Alexa Fluor 488 goat anti-mouse IgG (1:200, Cat No. SA00013-1, Proteintech, China) in the dark at 37℃ for 1 h. Sections were washed in PBS and then sealed with DAPI mount (Cat No. S2110, Solarbio, China). Images of the sections were taken by the Olympus fluorescence microscope (IX71) and then analyzed using Image J software.
2.11 Transmission electron microscopy
Transmission electron microscopy analysis was performed as previously described [38]. Briefly, fresh brain tissues were cut into 1 mm sections, pre-fixed in 2% glutaraldehyde, and fixed in 1% osmium tetroxide. Subsequently, the samples were dehydrated through a graded series of ethanol, embedded in the epoxy resin and propylene oxide overnight, and then polymerized. After being sliced into 70-nm-thick sections and stained with lead citrate, the samples were observed by H-7800 transmission electron microscope (Hitachi H-7800, Japan).
2.12 Bioinformatics Analysis
The promoter sequences of rat Klotho gene (KL) (the base sequence of 2000 bp in the upstream of the transcriptional start position of KL ) were downloaded from NCBI website (https://www.ncbi.nlm.nih.gov/nuccore/NC_051347.1?report=fasta&from=490402&to=531417). The transcription factors of KL were predicted using Animal TFDB (https://bioinfo.life.hust.edu.cn/humanTFDB) and ALGGEN-PROMO (http://alggen.lsi.upc.es/cgibin/promo_v3/promo/promoinit.cgi?dirDB=TF_8.3). Pearson correlation coefficient was used to analyze the relevance of KL to transcription factors gene expression in brain lower grade glioma (LGG) by Chipbase2.0 (https://rna.sysu.edu.cn/chipbase/index.php). The potential binding sites of targeted transcription factors on KL promoter with a binding probability of higher than 95% were predicted using Jaspar databases (https://jaspar.genereg.net/).
2.13 Double luciferase reporter gene assay
Dual-luciferase reporter gene analysis was used to identify the interaction targets between transcription factor STAT4 and KL promoter. HEK-293T cells were co-transfected with full length or truncated of KL reporters and the pcDNA3.1-STAT4 using Lipofectamine 2000 reagent. The concentration of full length or truncated of KL promoter luciferase reporter gene plasmid was 100 ng and the concentrations of pcDNA3.1-STAT4 were 100 ng, 200 ng or 400 ng. 24 h after transfection, relative luciferase activities of cell lysate were detected using a Dual-Luciferase® Reporter Assay System (Promega, USA).
2.14 Chromatin immunoprecipitation (ChIP) assay
According to the manufacturer’s instruction, ChIP was performed using ChIP Assay kit (cat: P2078, Beyotime Biotechnology, China). After being transfected with pcDNA3.1-STAT4 or pcDNA3.1 for 24 h, PC12 cells were harvested, washed with precooled PBS, and then cross-linked by 1% formaldehyde. Crosslinking reactions were halted by adding glycine. Diluted lysates were prepared and sonicated to yield fragments of 200–1000 bp. The sheared cross-linked chromatin fragments were immunoprecipitated with STAT4 antibody (1ug, Cat No. E2653, Cell Signaling, USA) or IgG (control, 1ug, Cat No. 30000-0-AP, Proteintech, China) overnight, then collected, washed, and reverse cross-fixed at 65°C. Purified DNA was collected from Spin Columns and analyzed by qPCR. The Fold enrichment is calculated as 2Ct (lgG)-Ct (STAT). The sequences of primers for ChIP-qPCR were listed in Table S3.
2.15 Statistical analysis
GraphPad Prism v.7 was used for statistical analysis. All experiments were repeated at least five times independently. Data were presented as mean ± standard error of the mean from at least 3 independent experiments. The normality and equal variance of the data were tested respectively by Shapiro-W test and the Levene test. Comparisons between the two groups were conducted by two-tailed unpaired Student t-test. One-way analysis of variance with Bonferroni posttest was used for comparisons of multiple groups. The threshold for statistical significance was P < 0.05.