Selection criteria of viral oligopeptide target for SELEX
This study aimed to design an aptamer that could bind to SARS-CoV-2 with high specificity. Factors like the sequence and length of viral oligopeptide can play a very important role in the development of a diagnostic kit. In addition, the selected sequence of viral oligopeptide must be stable under in vitro conditions and needs to mimic the conformation of the viral surface protein (spike protein of the SARS-CoV-2 virus). Thus, in this process of designing a suitable viral oligopeptide, multiple sequence alignment of spike proteins of three viral strains (MERS-CoV (AKN11074.1), SARS-CoV-1 (AAT74874.1) and SARS-CoV-2 (QII57161.1)) were performed. Based on the sequence analysis of residues ranging from 310 to 510, residues 479 and 480 located in the RBD region of the SARS-CoV-2 virus were selected as the conserved region (CR) (Fig. 2A). Further, two variable regions (VRs) of eight amino acids residues were selected on either side of CR. It is well-known that the secondary native conformation of any protein is generally stabilized by the number of α helices and the β pleated sheets. Thus, mimicking such secondary structures of designed oligopeptides during in vitro conditions with the native protein under study is a very important criteria for suitable selection and isolation of a specific aptamer using the SELEX technique. Further, during the formation of the α helix of a polypeptide chain, hydrogen bonds are formed at regular intervals with a carboxyl group of one amino acid and an amino group of the fourth amino acid within the same polypeptide chain 35, 36. Thus, the chosen viral oligopeptide target consisted of CR and VRs with a total of eighteen amino acids in length that may allow the formation of 3–4 α helixes to mimic the native conformation during the in vitro SELEX study. Molecular dynamics simulations of the oligopeptide performed here confirmed retention of the native structure of the SARS-CoV-2 S1-RBD reported in the crystal structure (Fig. 2B). Histidine-tagged viral oligopeptide (EIYQAGSTPCNGVEGFNCHHHHHH) was synthesized from Genscript, USA, for the identification of suitable aptamers using the SELEX procedure. The mass spectrum of synthesized histidine oligopeptide has been depicted in Fig. 3.
Screening of DNA-aptamers using SELEX and sequence analysis
SELEX is a conventional technique used for the isolation of the most fit aptamer molecules. From a pool of randomly synthesized aptamers (∼1017 molecules), suitable aptamers were screened using ten rounds of SELEX. Further, positive and negative selections were performed to obtain highly specific aptamers for the desired target under study. The obtained aptamers were amplified and subsequently converted into a single-stranded form, which was used for the next round of SELEX. After ten rounds of SELEX, finally, the PCR purified screened aptamers were cloned into a pET-32 Xa/LIC vector and sequence of screened aptamers were analyzed. The sequence of these screened aptamers with primer region (R, S, T, U, and W) and aptamers without primer region (J, K, L, M, and O) has been summarized in Table 1. In order to analyze the diagnostic potential, the aptamers (R, S, T, U, and W) were biotinylated and color was produced using a streptavidin-conjugated horseradish peroxidase (SA-HRP) secondary antibody in the presence of TMB substrate. Further, from the screened aptamers, R, S, T, U, and W aptamers have been selected for diagnostic potential studies because these were obtained inherently during SELEX, whereas aptamers R, T, J, and L have been used to determine their antiviral potentials because these aptamers have shown the best results during in vitro binding experiments using the SARS-CoV-2 virus.
Table 1
Screened aptamer sequences obtained through SELEX using viral oligopeptide.
S. No. | Sample code | Aptamer sequences flanked with and without primer region |
1 | R | GGTATTGAGGGTCGCATCGTTACTGGACCAAACAGCACAAAGGACGCCCATAAACCCGGATGGCTCTAACTCTCCTCT |
2 | S | GGTATTGAGGGTCGCATCGAAACAGGGCGTGATACGACGCGACGGCGTACTGTGGTGGGATGGCTCTAACTCTCCTCT |
3 | T | GGTATTGAGGGTCGCATCGTAATAGCGCATGTTGTGAGGCAGGCGCGAATCAGCTCGTGAGATGGCTCTAACTCTCCTCT |
4 | U | GGTATTGAGGGTCGCATCGTAATAGCGCATGTTGTGAGGCGGCGGAGTCATGTCGTGGGATGGCTCTAACTCTCCTCT |
5 | W | GGTATTGAGGGTCGCATCGACACCGGGAGTGATACGTCGCGAGCACGTACTGTGTTGGGATGGCTCTAACTCTCCTCT |
6 | J | GTTACTGGACCAAACAGCACAAAGGACGCCCATAAACCCG |
7 | K | GAAACAGGGCGTGATACGACGCGACGGCGTACTGTGGTGG |
8 | L | GTAATAGCGCATGTTGTGAGGCAGGCGCGAATCAGCTCGTGA |
9 | M | GTAATAGCGCATGTTGTGAGGCGGCGGAGTCATGTCGTGG |
10 | O | GACACCGGGAGTGATACGTCGCGAGCACGTACTGTGTTGG |
**Red color and green colors represent the forward primer and reverse primer region present in the screened aptamer, respectively.
Aptamers affinity for RBD using in vitro binding assay
To analyze the diagnostic potential of the screened aptamers (R, S, T, U and W), the binding efficacy of these aptamers were first tested using purified RBD. A histidine-tagged RBD was immobilized on magnetic Ni-NTA beads and then biotin-tagged aptamer samples were incubated with Ni-NTA@RBD. Finally, the binding efficacy of the screened aptamers were tested using a SA-HRP antibody and TMB substrate. The obvious color change (yellow to green as depicted in Fig. 4A) provided confirmation that binding occurred between the aptamers and RBD. Further, the binding of screened aptamers was also analyzed with an absorbance spectra during their incubation with RBD. Here, aptamers incubated in the absence of RBD served as a negative control. During the incubation of aptamer R with Ni-NTA@RBD, two conspicuous peaks appeared at 253 and 451 nm, respectively, while during incubation of aptamer R with Ni-NTA bead only (negative control), the peak appeared at 285 nm. The two conspicuous peaks at 253 and 451 nm disappeared when the aptamer was incubated with a magnetic bead only (Fig. 4A). During aptamer S incubation with Ni-NTA, peaks appeared at 285 and 369 nm respectively while it has been shifted to 253 and 451 nm during incubation of aptamer S with Ni-NTA@RBD (Fig. 4B). Similarly, when aptamer T was incubated with Ni-NTA@RBD, two conspicuous peaks appeared at 254 and 450 nm. However, during incubation with Ni-NTA, peaks at 254 and 450 nm disappeared, and two new peaks appeared at 281 and 370 nm (Fig. 4C). During aptamer U incubation with Ni-NTA@RBD, a clear shifting in the peak was not observed but peak intensity decreased considerably during aptamer incubation with and without RBD (Fig. 4D). In the case of aptamer W, a slight shift in the absorbance peak at 378 nm was observed during incubation with Ni-NTA@RBD as compared to the negative control. A new peak also appeared at 449 nm during aptamer W incubation with Ni-NTA only while no corresponding peak appeared during aptamer incubation with the Ni-NTA@RBD system (Fig. 4E). In summary, the binding assay of screened aptamers with RBD clearly suggest that the aptamers are efficiently binding with RBD which has been confirmed by the shifting, appearance, or disappearance of peaks during their incubation with RBD in comparison to their incubation in absence of RBD.
Aptamers R and T shows highest diagnostic potential with good binding efficacies with SARS-Cov-2
Designing a highly selective and robust “aptamer-based detection system” for the SARS-CoV-2 virus is of paramount importance in preventing pandemic waves. Identifying potential molecules that can serve in newly designed diagnostic kits with high antiviral activity is an arduous task but can provide large potential for simultaneous detection and treatment. Due to unique features of aptamers such as small size, high stability, low immunogenicity, safety, high binding specificity and affinity towards target molecule make them a potential theranostic candidate 37,38. Encouraged by the binding efficacy test of biotin-labeled screened aptamers (R, T, S, U, and W), their diagnostic potential was examined using the SARS-CoV-2 virus (Fig. 5). As discussed in the earlier section and shown in Fig. 4, all five selected aptamers have indicated RBD binding. Further, in an in vitro assay at three different reaction volumes (5, 10, and 15 µl having a concentration of 0.3 µM) using the SARS-CoV-2 virus, aptamers R and T showed the highest binding ability among the five screened aptamers as their corresponding absorbance at 450 nm was 0.83 and 0.74, respectively (Fig. 5). The reaction volume of 10 µl was identified to be the saturation point due to the decrease in absorbance for all five aptamers observed at 15 µl. However, the factors like the saturation of RBD at a particular viral load used or steric hindrance of the aptamer to bind with the RBD of the virus can also be attributed towards the decrease in absorbance peak at 15 µl. Additionally, the binding specificity of these aptamers were checked by taking chikungunya virus as a control. No significant absorbances were observed of aptamers in the presence of chikungunya virus (CHIKV). In summary, aptamer R and T were found to be a highly selective binder of RBD of the virus with good diagnostic potential. Hence, these can be excellent candidates for further development of theranostic agents against SARS-CoV-2.
Thermodynamics calculations of aptamer R
In general, the function of aptamers is affected by their ability to fold and maintain a favorable binding conformation with their binding partner 39. Thus, thermodynamically determining the folding free energy (ΔGfold) for a given aptamer sequence can provide a better understanding of aptamer stability, which is useful for predicting affinity and specificity during molecular detection and other assays 40. The current work used the mfold server 24 to predict ΔGfold for the biotin-labeled screened aptamers (R, T, S, U, and W). Analyzing the ΔGfold energy for the 5 aptamers suggested that aptamer R required higher energy to fold (approximately − 3.5 kcal/mol) than the other aptamers which had folding energies lower than − 5 kcal/mol (Table S1). Upon closer inspection of the sequences of all 5 aptamers it was found that aptamer R had the greatest amount of A-T base pairs and the smallest amount of G-C base pairs in comparison to the other 4 aptamer sequences (T, S, U, and W) (Figure S4, Table S2 and S3). In addition, aptamer R that had the highest number of bases (42 out of 78) which allowed the formation of 2 helices (Figure S5), this may suggest a greater entropic penalty for folding aptamer R relative to the other aptamers 41.
Aptamers showing antiviral potential against SARS-CoV-2
As, aptamer R and T (flanked with forward and reverse primer regions) showed high binding efficacy against SARS-CoV-2, thus, further antiviral studies were performed with aptamers R, T, J, and L (J and L have the same central sequence as aptamers R and T without the forward and reverse primer regions). To determine the antiviral effect of these aptamers, first the cytotoxicity was measured in the Vero cell line using MTT assay. The maximum non-toxic dose (> 90% cell viability) for aptamers R and T was found to be 4 µM while aptamers J and L showed a value of 8 µM (Fig. 6). Antiviral activity of these four aptamers were measured by qRT-PCR during the SARS-CoV-2 infection using the above-mentioned concentrations. The aptamers R and J exhibited 95.4% and 82.5% inhibition of viral infection, respectively indicating high antiviral potential against SARS-CoV-2 compared to aptamers L and T (Table 2, Fig. 7). As the aptamers were added during the infection, this reduction might be due to its interference in the viral entry stage inside the cell. Altogether, the data indicate that aptamers R and J can inhibit SARS-CoV-2 infection significantly by affecting the entry phase of the virus inside the cell.
Table 2
Antiviral activity of different aptamers against SARS-CoV-2.
Sample | Concentration (uM) | Ct Value | Copy number/ml | % Inhibition |
Infection (0.1 MOI) | | 25.398 | 43621.18581 | |
Aptamer R | 4 | 30.091 | 1994.156045 | 95.4 |
Aptamer T | 4 | 26.377 | 22917.9018 | 47.4 |
Aptamer J | 8 | 28.080 | 7480.607116 | 82.5 |
Aptamer L | 8 | 26.885 | 16410.86434 | 62.3 |
Aptamers inhibiting SARS-CoV-2 pseudovirus entry in cells expressing ACE2 receptors
As the aptamers showed binding to the spike protein in vitro and inhibition of SARS-CoV-2 infection in Vero cells, it could be presumed that the aptamers specifically act by blocking SARS-CoV-2 entry into the host cells. Hence, we tested their efficacy for inhibiting SARS-CoV-2 entry by using a pseudovirus-based entry assay. Previous reports indicated that HIV-1-based reporter lentiviruses with the firefly luciferase ZsGreen reporter genes in their genomic backbone and SARS-CoV-2 spike protein as the sole surface glycoprotein are suitable for studying viral entry into host cells 21, 42. Therefore, we have generated reporter viruses pseudotyped with SARS-CoV-2 S and treated them with different aptamers before infecting HEK293T cells overexpressing ACE2 receptors (HEK293T-ACE2) (Fig. 8A). The efficiency of viral entry and progression of the infection into the cells was determined by measuring the luciferase gene expression at 18 hpi. As expected, SARS-CoV-2 pseudoviruses showed preferential infection towards HEK293T-ACE2 cells over the regular HEK293T cells, originating from the specificity of the spike protein for the ACE2 receptors. Treatment with 5 µM of aptamer R resulted in a 59% reduction in viral entry (Fig. 8A) while, the aptamer T and aptamer L, at the same concentration, showed 21% and 34% reductions, respectively. To our surprise, aptamer J, which contains the identical central nucleotide sequence to aptamer R, did not show any significant reduction in the viral entry as compared to antiviral activity towards live SARS-CoV-2 (Fig. 8A). However, mechanism of the antiviral activity of aptamer J needs to be further investigated.
To investigate the entry inhibitory activity of the aptamers R and J in detail, the SARS-CoV-2 pseudoviruses were pre-treated with increasing concentrations of the said aptamers, before infecting HEK293T-ACE2 cells with them. Prior incubation with aptamer R resulted in a dose-dependent decrease in pseudovirus entry while aptamer J showed no such effect (Fig. 8B, and 8C). This data confirmed the efficacy of the aptamer R in inhibiting SARS-CoV-2 entry, possibly by direct interaction with the RBD of spike protein as evidenced in our in vitro binding assays (Figs. 4 and 5). To further confirm the specificity of this aptamer towards SARS-CoV-2 spike protein, we have generated reporter lentiviruses pseudotyped with Vesicular Stomatitis Virus (VSV) Glycoprotein (G) at their surface. As expected, the VSV G pseudotyped virus showed equal efficiency of infecting either HEK293T or HEK293T-ACE2 cells, thus confirming that the specificity towards the HEK293T-ACE2 cells is a sole attribute of the SARS-CoV-2 S pseudotyped virus. Furthermore, prior treatment of VSV G pseudotyped viruses either with aptamer R or aptamer J showed no reduction in viral entry into HEK 293T cells (Fig. 8D). This establishes the high specificity of aptamer R in blocking the entry of SARS-CoV-2. To nullify that the inhibitory activity of aptamer R is due to its toxic effect on the cells, we performed MTT assay and tested the toxicity of the aptamers upon the HEK cells. Our data indicated that both the aptamers are non-toxic at the concentrations used for the pseudovirus reporter assay (Fig. 8E).
Predicted binding interactions between screened aptamers and RBD
While the experimentally determined aptamer R efficiently inhibited SARS-CoV-2 through RBD binding, a better understanding of the specific binding site and important intermolecular interactions present in the aptamer-RBD system can be useful for future rational designs. Molecular docking studies of aptamer R with the S1 protein of SARs-CoV-2 performed here predicted binding to occur near the receptor binding motif (RBM) residues P479 and N487 of the S1 protein (Fig. 9A). Superimposing the most favorable docked pose of the RBD-aptamer R complex with the co-crystallized complex structure of the S1-ACE2 receptor (PDB ID: 6M0J) suggested that binding of the R aptamer at the RBM should interfere with the binding of the SARS-CoV-2 S1-RBD with the human ACE2 receptor (Fig. 9B). Interestingly, out of the top 10 docked poses of aptamer R to S1-RBD, it was observed that three poses were nearly identical (as they bind very close to the N487 and P479 residues) and adopted a conformation which may interfere with the binding of ACE2 receptor with S1-RBD in the presence of R aptamer (Figure S6A). The remaining seven binding poses of R aptamer did bind at the RBD but not near N487 or P479. Nevertheless, superimposition with the S1-RBD-ACE2 complex suggests that all docking conformations should interfere with the binding of S1-RBD to the ACE2 receptor (Figure S6B). Previous studies have shown that N487 of S1-RBD forms strong electrostatic interactions with Y83, Q324, Q325, E329, and N330 of the ACE2 receptor.26,43. Hence, designing an aptamer that binds near the N487 or P479 residues may weaken or inhibit the binding of S1-RBD with the ACE2 receptor.
As aptamer J has the same sequence as aptamer R, but without the forward and reverse primer regions, molecular docking was performed for aptamer J to assess the impact of the added primer region. Aptamer J was also predicted to bind close to residues P479 and N487 in the RBM of S1-RBD. However, the binding conformation of aptamer J was very different from aptamer R despite their similarities in sequence as R and J were bound vertically and perpendicular to the RBD, respectively (Fig. 9A and 10A). The most probable reason behind this difference may be the smaller length of aptamer J as compared to R. Nevertheless, superimposing the S1-RBD-aptamer J complex with the S1-RBD-ACE2 co-crystallized structure (PDB ID 6M0J) indicates that this compound should impede binding between S1-RBD and the ACE2 receptor (Fig. 10B). This observation was strongly supported by 5 out of the top 10 binding poses which also bind at the RBM and overlap with coordinates of the ACE2 receptor (Figure S7A). While the remaining 5 docked poses were observed to bind at the RBD, they were far away from the residues P479 and N487 and only one pose (shown in pink in Figure S7B) appears to interfere with the binding of the ACE2 receptor.
Molecular dynamics simulations of the binding mechanism of aptamer R and J
Biding affinity assays and molecular docking studies, while informative, lack the capability to provide detailed insight into prevalent interactions or potential conformational changes in the RBD protein that arise from aptamer binding. Hence, molecular dynamic (MD) studies of aptamers R and J in complex with S1-RBD were carried out. Root-mean-square deviations (RMSDs) of the backbone protein atoms within S1-RBD regions were examined (Figure S1-3) to understand the time scale required to stabilize the protein structure in response to aptamer binding. RMSD analysis showed that the aptamer R-S1-RBD complex reached equilibrium after 50 ns and aptamer J-S1-RBD took ~ 150 ns despite the shorter sequence in J compared to R (Figure S2). Cluster analysis for each system showed that the aptamer R-S1-RBD complex had only one major conformation present with an 83.5% population over 300 ns of MD simulation, whereas the aptamer J-S1-RBD complex existed primarily in two major conformations with populations of 55.2% and 22.5%. MD simulations of aptamer R-S1-RBD identified a conformational change that occurred in the RBM (residues 437–508) with the central core region of the aptamer R moving parallel to the RBM (Fig. 11A and 11B). A similar reorganization of the RBM was observed for the most dominate cluster (55.2%) of aptamer J-S1-RBD from the MD simulations, but the second largest cluster (22.5%) retained a RBM conformation similar to the initial docked complex (Fig. 11C). In addition, comparison of the central core regions of the S1-RDB complexes found the central core region adopted a folded structure when bound with aptamer J in contrast to aptamer R where only ~ 50% of the sequences were folded leading to a less rigid structure (Fig. 11D). The lack of primer regions in aptamer J reduces the sequence to 40 (from 78 in R) and consequently has one of the lowest numbers of unpaired base pairs compared to R and other aptamers (Table S3). Interestingly, while aptamer R has the highest number of paired base pairs, it has retained a highly flexible central core region (Fig. 11D) compared to the more rigid structure in aptamer J.
Calculated binding affinities for aptamers R and J
To follow up on these flexibility differences between the aptamers, binding energies (ΔGbind) were computed using MD simulations in conjunction with the Poisson–Boltzmann surface area continuum solvation (MM/PBSA) method for aptamers R and J bound to the S1-RBD of SARS-CoV-2. The ΔGbind values found that aptamer R binds ~ 3 times stronger to the RBM of S1-RBD in comparison to aptamer J (Table 3). To make sense of this substantial preference for aptamer R binding to S1-RBD, the individual energy contributions that compose the ΔGbind energies were examined. The calculations found the van der Waals energy (EvdW) and non-polar contributions Gnp to the solvation energy changes to be nearly identical for both aptamers. This suggests that the high selectivity observed between the aptamers is derived from the electrostatic energy change (Eel) and free energy polar contribution (Gpol) terms, which were both ~ 2 times greater for aptamer R compared to aptamer J (Table 3).
Table 3
Decomposition of the free energy of binding (ΔGbind in kcal/mol) for the binding of aptamers R and J bound at the S1-RBD of SARS-CoV-2.
complex | EvdW | Eel | Gpol | Gnp | ΔGbind |
R-RBD | -155.3 ± 31.3 | -3078.3 ± 266.3 | 3134.2 ± 272.2 | -17.5 ± 2.8 | -116.9 ± 29.3 |
J-RBD | -138.2 ± 19.1 | -1579.2 ± 179.0 | 1689.2 ± 182.5 | -14.9 ± 1.8 | -43.15 ± 22.4 |
EvdW = van der Waals energy, Eel = electrostatic energy, Gpol and Gnp = polar and nonpolar contributions to the solvation-free energies, respectively.
Analysis of the computed electrostatic interactions between the aptamers and S1-RBD found a greater hydrogen bonding population for the aptamer R-S1-RBD complex compared to aptamer J (Table S4). To clarify, aptamer R formed a large hydrogen bond population of ~ 75% with the glucose moiety attached to S1-RBD in comparison to aptamer J which formed a reduced population of ~ 27%. In addition, out of 25 different hydrogen bonds observed between aptamer R and S1-RDB, 17 of them were formed from the aptamer R central core region (nucleotide base pairs: 19–58). The binding of aptamer R induced a conformation change in both the RBM and the central core region of aptamer R which may suggest an induced fit mechanism.
While the binding free energy results offer one explanation for the preferred selectivity of aptamer R, additional atomic insight can be derived by numerically estimating the changes in residue conformation arising from aptamer binding. Accordingly, the root-mean-square-fluctuation (RMSF) of the complexes were used to examine which regions of protein diverged the most from the average structure. The RMSF analysis found that the aptamer J-S1-RBD complex had very high fluctuations compared to R, suggesting a high mobility for the system (Fig. 12). Conversely, the RMSF fluctuations computed for the aptamer R-S1-RBD system resembled the unbound state (apo) of S1-RBD with the exception of the high fluctuations observed around the aptamer binding region composed of residues 450–495. In addition, the % change in RMSF showed that same region in S1-RBD had the highest magnitude of localization effect in response to the binding of aptamer R (Figure S3A) and that the aptamer R primer region became more flexible (Figure S3B). This suggests that the presence of the forward and reverse primer regions may be essential in making aptamer R more selective towards S1-RBD.