Establishment of BRAF mutant cell lines
Endogenous BRAF gene in MC38 cells was knockout by lenti-CRISPR Cas9 technique. The BRAF WT and mutant plasmids were purchased from Shanghai Jikai Gene Chemical Technology Co., LTD. Briefly, the WT BRAF (NM_004333) gene sequence was synthesized by whole gene synthesis technique. Sequences of V600E (T1799A), G469V (G1406T) and D594A (A1781C) were obtained by point mutation technique. The recombinant plasmids were transfected into BRAF knockout MC38 cell lines respectively according to the instructions (Cat Nr. 101000046, Polyplus, France). Neomycin was added into medium to obtain positive clones (Cat Nr. E859-5G, Amresco).
Cell culture
MC38 cell line was purchased from ATCC (American Type Culture Collection). The cell line was verified by Short Tandem Repeat (STR) profiling (Shanghai Biowing Applied Biotechnology Company). Mycoplasma were detected routinely. MC38 cells were cultured in DMEM (Gibco) medium contained 10% fetal bovine serum (FBS, Gibco). The medium also supplemented with 100 U/mL penicillin (Cat Nr. SV30010, Hyclone, USA) and 100 µg/mL streptomycin (Cat Nr. SV30010, Hyclone, USA). Cells were maintained in a humidified atmosphere at 37 ˚C with 5% CO2.
Quantitative reverse transcription polymerase chain reaction (qRT-PCR)
Cells were digested with trypsin (Cat Nr. 03-050-1A, BI, Israel) and washed using PBS. RNA was extracted with TRIzol reagent (Cat Nr. R401-01-AA, Vazyme, China), and reversed transcription into cDNA according to manufacturer's instructions (Cat Nr. RR036A, TaKaRa, Japan). Primers were designed using Primer-BLAST (PubMed) and synthesized from Genewiz Corporation (China). qRT-PCR reactions were performed in triplicate (LightCycler® 480 System, Roche, USA). The expression was normalized using β-actin (5′-GCTACGAGCTGCCTGACGG-3′ for forward primer, and 5′-TGTTGGCGTACAGGTCTTTGC-3′ for reverse primer). The relative expression of genes was calculated by 2−△Ct.
Western blotting analysis
The protein extraction, concentration measurement and imaging were performed referring to the method described before (16). Rabbit monoclonal anti-mouse BRAF, THBS1, p-ERK, p-MEK, ERK, MEK and Cyclin D1 (Cat Nr. 14814, 37879, 4370, 9154, 4695, 4694 and 2978, Cell Signaling Technology, Germany), rabbit monoclonal anti-rabbit β-actin (Cat Nr. AC026, ABclonal, USA) were used as primary antibodies in the study.
Colony-forming assay
Exponential growth phase of BRAF WT and mutant MC38 cells were collected. 1,000 cells were seeded in 35 mm dish. The culture medium was changed every 3–4 days. After 10–12 days, clones were washed by PBS gently and fixed using 4% paraformaldehyde for 15 min at room temperature. After that, clones were washed again and stained by 0.1% crystal violet reagent for 20 min. The dishes were washed gently with PBS until the background was clean. Inverted microscope was used to count and photograph.
Cell viability assay
Cell viability was evaluated by CCK-8 assay (Cat Nr. K1018, APExBio, USA). Cells (2,000 cells/well) were seeded into 96-well plate and incubated at 37˚C for 24, 48 and 72 h, respectively. Four replicates were performed. 10 µL CCK-8 reagent was added to each well. After incubation at 37˚C for 2 h, the OD values at 450 nm of each well was measured. The data was analyzed by GraphPad Prism 8.0.
Cell apoptosis assay
Cells (300,000 cells/well) were seeded into 6-well plate and cultured for 24 h. The trifluoromethoxy carbonylcyanide phenylhydrazone (FCCP) reagent (Cat Nr. S8276, Selleck, USA) was added to induce cell apoptosis for 24 h. All the cells were collected and stained by the APC-Annexin V Binding Apoptosis assay kit (Cat. Nr. 22837; AAT Bioquest, Sunnyvale, CA, USA) according to the manufacturer's protocol. The proportion of apoptotic cells was analyzed by flow cytometry.
Cell migration and invasion assays
Transwell chamber (Cat Nr. 3422, Corning, USA) was used in the migration and invasion assay. Before the invasion assay, 100 µL diluted matrigel was added into the upper chamber. Cells were resuspended in DMEM medium (without FBS) at the concentration of 100,000 cells/100 µL or 300,000 cells/100 µL and added to the upper chamber. DMEM medium (600 µL) supplemented with 15% FBS was added in the lower chamber of each well. After incubation for 24 h, cells on the upper chamber were fixed using 4% paraformaldehyde for 15 min. The upper chamber was washed twice with PBS, and stained with 0.1% crystal violet for 20 min. Cells on the upper surface of the filter were wiped by cotton swabs. Cells passing through the transwell membrane were observed and photographed under an inverted microscope.
Detection of the sensitivity of BRAF mutant and WT cells to MAPK inhibitors
Tumor cells in exponential growth stage were collected. 4,000 cells were seeded into 96-well plate and incubated overnight. On the second day, Sorafenib, Trametinib and SCH772984 (Cat Nr. S7397, S2673 and S7101, Selleck, USA) were serially diluted to the concentrations as 100 µM, 80 µM, 60 µM, 40 µM, 20 µM, respectively, and were added into the wells of each group. Three replicates were performed. The cells were treated with the inhibitors for 24 h, 48 h and 72 h, respectively. The OD values at 450 nm were obtained using CCK-8 method. IC50 values were calculated and the sensitivity of different mutant cell models to MAPK inhibitors were analyzed.
EGF stimulation experiment
Cells (300,000 cells/well) were incubated in 6-well plate overnight. The culture medium was discarded. The plate was washed gently by pre-warmed PBS. The cells were starved by culturing in FBS-free DMEM medium. After 36 h, the medium in the wells were replaced by 2 mL DMEM medium containing 100 ng/mL EGF for 15 min at 37°C. The whole protein was extracted immediately using RIPA. The control group was avoided contacting with FBS throughout the operation.
ELISA test for CXCL9 and CXCL10
Cells (300,000 cells/well) were incubated in 6-well plate. 20 ng/mL IFN-γ was added in the culture medium on the second day and treated for 48 h. The supernatant of tumor cells was collected and centrifuged at 4˚C, 4,000 rpm for 10 min to discard the cell debris. The concentrations of CXCL9 (Cat Nr. EK5306, Signalway Antibody, USA) and CXCL10 (Cat Nr. abs520013, Absin, China) were detected using ELISA method follow the manufacturer's instructions. The OD values at 450 nm and 570 nm were detected. The standard curve was drawn and the concentrations of CXCL9 and CXCL10 were calculated.
Detection of the expression of PD-L1 and MHC Class I in tumor cells by flow cytometry
Tumor cells (300,000 cells/well) were seeded in 6-well plate and incubated overnight. The culture medium was replaced by fresh complete medium containing 20 ng/mL IFN-γ. The tumor cells were harvested 48 h later and washed by PBS. Anti-mouse-PD-L1 antibody (Cat Nr. 17-5982-82, Invitrogen, USA) and anti-mouse-MHC Class I antibody (Cat Nr. 141603, Biolegend, USA) were diluted using FACS buffer (PBS containing 10% FBS) at the ratio of 1:200. The cells were resuspended by the dye solution and stained for 25 min on ice. After washing with FACS buffer, cells were resuspended by FACS buffer and filtered by nylon membrane. The single cell suspension was analyzed by BD LSRFortessa™ Cell Analyzer (BD Biosciences, USA). The data was processed using flowjo Vx 10.0 software.
Detection of the function of T cells co-cultured with tumor supernatant by flow cytometry
The supernatant of tumor cells was collected as above. Lymph nodes from OT-1 mice were grinded, and T cells were collected to be activated with IL-2 and N4-peptide for three days. Live T cells were collected by density gradient centrifugation. 500,000 T cells were incubated in medium containing equal volume of T cells culture medium and tumor supernatant. Three replicates were performed. After co-culture for 48 h, the expression of functional markers of CD8+ T cells, TNF-α, IFN-γ, PD-L1 and TIM3 were detected by flow cytometry.
PD-1 (Cat Nr. 46-9981-82, Invitrogen, USA) and TIM3 (Cat Nr. 25-5870-82, Invitrogen, USA) were detected as above. For the detection of secretory TNF-α and IFN-γ, T cells were firstly incubated in culture medium containing PMA (5 ng/mL), Ionomycin (500 ng/mL), Brefeldin A (1: 1,000) and Monensin (1: 1,000) for 4 h at 37°C. T cells were collected and resuspended by FACS buffer. Fixable viability dye efluor 506 (Cat Nr. 65-0866-18, Invitrogen, USA) was added for staining for 25 min on ice. Then T cells were washed and resuspended in 1 mL freshly prepared Fix/Perm solution (BD Biosciences) for 20 min at 4°C. After being washed with Perm/Wash buffer (BD Biosciences), T cells were stained with anti-TNF-α (Cat Nr. 506304, Biolegend, USA) and anti-IFN-γ (Cat Nr. 505810, Biolegend, USA) for 25 min, washed and filtered. All samples run on a flow cytometer and analyzed using flowjo Vx 10.0 software.
Establishment of the animal models and anti-PD-L1 treatment
C57BL/6 and BALB/C Nude female mice were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. and Cavens Biogle Model Animal Research Co.,Ltd. (Suzhou), respectively. BRAF mutant and WT cell lines at exponential growth stage were prepared and resuspended by PBS. 1,000,000 cells were injected subcutaneously on the right flank of the mice. Tumor volumes were measured every 2–3 days. The long diameter (L) and short diameter (W) of the tumors were measured, and tumor volume was calculated as: volume = (LW2) /2. All animal procedures were conducted in accordance with the guidelines of the Animal Care and Welfare Committee of Nanjing medical university.
In the ICIs sensitivity experiment, tumor cells were injected subcutaneously as above. The mice were randomly divided into two groups on day 9. 200 mg Atezolizumab was injected intraperitoneally three times per week to each mouse of the experimental group. The tumor growth curve was drawn according to tumor volumes. The tumors were weighed when the mice were sacrificed.
Analysis of TILs by flow cytometry
Once the mice were sacrificed, the tumors were dissected and grinded. Isolated cells were resuspended in FACS buffer and incubated with Fc-block for 20 min first. Monoclonal antibodies of CD45, CD3, CD4, CD8, NK1.1, Ly6G, Ly6C, CD25, CD103, PD-1 and TIM3 were added for surface staining. The procedure of flow cytometry was as mentioned above.
Immunohistochemistry (IHC) staining for CD8α
Tumor tissues were harvested from tumor-bearing mice and stored in formalin at 4°C. The tissue was embedded in paraffin and prepared into serial slices. After dewaxing and antigen retrieval, the background was blocked. The slices were then incubated with primary antibody specific to CD8α (Cat Nr. 98941, Cell Signaling Technology, Germany) in a wet box at 4°C overnight. The slices were washed with PBS for 4 times and incubated with secondary antibody at 37°C for 15 min. The color reaction was performed using DAB Substrate kit (DA1010, Solarbio, China). The slices were observed and photographed under an inverted microscope. The positive cells were counted and analyzed by GraphPad Prism 8.0.
RNA sequencing
BRAF WT and D594A mutant MC38 cells were harvested at exponential growth stage. Total RNA was isolated using Trizol reagent. RNA quality and integrity were confirmed via an Agilent Bioanalyzer 2100. Then, mRNA libraries were established and sequenced at Genewiz Corporation (China).
Establishment of THBS1-overexpressing cells
THBS1-overexpressing plasmid (pMSCV-THBS1) was constructed based on pMSCV-PIG (Cat Nr. 18751, Addgene) by homologous recombination technique (Cat Nr. C112, Vazyme, China). Briefly, the sequence of THBS1 was obtained by cloning the MC38 cDNA template using the following primers; forward primer, 5′-gccggaattagatctctcgagATGGGGCTGGCCTGGGGACTA-′3 and reverse primer, 5′- gtagaattcgttaacctcgagTTAATGGTGATGGTGATGATGGGGATCTCTACATTCGTATTTCAGGT-′3, and recombined to linearized pMSCV-PIG at XhoI restriction site. THBS1-overexpressing (hTHBS1) and control (hctrl) cell lines were established by transfecting either pMSCV-THBS1 plasmid or pMSCV-PIG into MC38 cells using jetPRIME reagents (Cat Nr. 101000046, Polyplus, France). qRT-PCR was used to determine THBS1 mRNA expression using the following primers: forward primer, 5′- GGGGAGATAACGGTGTGTTTG-′3, and reverse primer, 5′- CGGGGATCAGGTTGGCATT-3′. Western blot was used to detect the THBS1 protein expression in cells.
Establishment of THBS1 knockdown cells
The shRNA sequences targeting THBS1 were as following; sense: CCGGTGAAACCGATTTCC GACAATTCTCGAGAATTGTCGGAAATCGGTTTCATTTTTGA; anti-sense: ATTCAAAAATGAAACCGATTTCCGACAATTCTCGAGAATTGTCGGAAATCGGTTTCA. THBS1-knockdown plasmid (pLKO.1-shTHBS1) was constructed based on pLKO.1 (Cat Nr. 8453, Addgene) by homologous recombination technique. THBS1-knockdown (siTHBS1) and control (sictrl) cell lines were established by transfecting either pLKO.1-shTHBS1 or pLKO.1 plasmid into D594A mutant MC38 cells using jetPRIME reagents (Cat Nr. 101000046, Polyplus, France). Cells were maintained in a culture medium containing 400 µg/mL neomycin (Cat Nr. E859-5G, Amresco) for two weeks. qRT-PCR and western blot were used to determine the mRNA and protein levels of THBS1.
T cells migration assay
Transwell chamber (Cat Nr. 3422, Corning, USA) was used in the T cell migration assay. CD8+ T cells were resuspended in DMEM medium at the concentration of 500,000 cells/120 µL and added into the upper chamber. Culture supernatant (600 µL) from tumor cells was added to the lower chamber of each well. 0.1 µg/mL CXCL9 and CXCL10 neutralizing antibody were used. After incubation for 3 h, cells that migrated through the filter was counted and photographed under an inverted microscope. Three replicates were performed.
Mice models treated by CXCL9 or CXCL10 neutralizing antibody
hTHBS1 and hctrl cells were injected subcutaneously into C57BL/6 mice respectively. The mice injected hTHBS1 cells were divided into three groups randomly. Two experimental groups were given 5 µg/100 µL CXCL9 and CXCL10 neutralizing antibody by injecting intraperitoneally, respectively. The remaining group was given 100 µL PBS. The injection was performed on day 8, 11 and 14 after tumor transplantation. The tumor growth curve was drawn and the tumors were weighed. TILs were analyzed by flow cytometry.
Statistics
All experiments were repeated at least three times. Data were expressed as the mean ± standard deviation. The differences between two groups were analyzed by non-parametric t-test. P < 0.05 was considered to indicate a statistically difference. All statistical analyses were two-sided and performed by GraphPad Prism 8.0. Figures were drawn using GraphPad Prism 8.0.