Study area
The study was conducted in selected general hospitals within the three Senatorial Districts of Kaduna State, Nigeria. Blood samples were collected from patients in Hajiya Gambo Sawaba General Hospital Zaria (Kaduna North Senatorial District), Barau Diko Teaching Hospital (Kaduna Central Senatorial District) and General Hospital Kafanchan (Kaduna South Senatorial district). Kaduna lies at latitude 10°20′ north and longitude 7°45′ east and covers an area of 45,711.2 km2. It has a population of 6,113,503 and a population density of 130 people/km2. It accounts for 4.3% of Nigeria’s total population. Kaduna lies in the savanna ecological belt. It experiences a rainy (wet) season between April and October and a harmattan (dry and dusty) season between November and March. The area experiences an average annual rainfall of 1099 mm and average daily temperature of 28 °C. Malaria occurs all year round, with peaks during the middle to late rainy season [21].
Study Design
The study was a cross-sectional study that lasted for six months (May to October 2018).
Inclusion Criteria And Exclusion Criteria
All febrile patients presenting symptoms of malaria that were directed to the laboratory for malaria parasite (MP) test and gave consent were included. All patients directed to the laboratory for laboratory tests other than malaria test and those who did not give consent were excluded.
Sample Size
The sample size was determined using a prevalence of 22.4% [21] and the following formula as described by [22]:
n=
n = number of samples
p = prevalence rate of previous study = 22.4%=0.224
z = standard normal distribution at 95% confidence limit = 1.96
d = absolute desired precision of 5%=0.05
z = 1.96
n = 1.962 *0.224(1-0.224)
0.052
n = 3.8416 *0.224*0.776
0.0025
n = 267 samples
The sample size was increased to 300; 100 blood samples were collected from each hospital within the three senatorial districts.
Administration Of Consent Forms And Structured Questionnaire
Consent forms and structured questionnaire were administered to consenting individuals who met the inclusion criteria. This was used to obtain bio-data and information relevant to this research.
Sample Collection And Preparation Of Blood Films
Two milliliter (2 ml) of venous blood was collected by a trained laboratory technician and transferred into an EDTA container. Thick and thin blood films were prepared immediately after the samples were collected according to the technique outlined by [23]. A drop of each blood sample was placed in the center of a grease-free clean glass slide, and spread immediately using a smooth edged slide spreader to make a thin film. The thin film was allowed to air dry before being fixed with methanol. The thick film was made by transferring a drop of blood to another clean slide and spread in such a way that it was possible to see (but not read through) newsprint, it was then allowed to dry properly. The blood films were stained using 10% Giemsa working solution for 30 minutes. After staining the blood films, they were allowed to air-dry [23].
Examination Of Stained Blood Film Slides
The stained blood films were examined under the microscope using 100X objective lens after focusing. Presence of ring forms, trophozoites or gametocytes of Plasmodium falciparum or other Plasmodium sp was recorded as positive results. A blood smear was considered negative if no parasite was seen after 10 minutes of search or examination under 100X high power fields of microscope.
The prevalence of malaria was determined by the number of positives over the number of specimens collected.
Prevalence rate = Number of positives x 100
Total number of samples
Deoxyribonucleic Acid (dna) Extraction
Total DNA was extracted from one third (25 samples) of the 75 malaria positive blood samples using Zymo Research Quick-DNA TM Miniprep Plus Kit, Irvine, California.
Determination Of Haemoglobin Genotype
Cellulose acetate method of haemoglobin electrophoresis was carried out on all malaria positive samples as follows: A drop of blood from all malaria positive blood samples was placed on a clean white tile and mixed with three drops of water to lyse the red blood cells. With the aid of an applicator, the haemolysate was placed on a cellulose acetate paper. This was followed by electrophoresis in Tris buffer solution for 15 minutes at electromotive force of 250v. Haemolysates from blood samples of Hb AS and AC were run as controls [24].
Primers Used For Polymerase Chain Reaction
The genes and primer sequences used for the polymerase chain reaction are shown below in Table 1. The target genes were; Plasmodium falciparum resistance transporter (pfcrt) gene which is a single copy, 13-exon gene, localised on chromosome 7 and codes for a digestive vacuole trans-membrane protein, which plays a key role in chloroquine resistance. Plasmodium falciparum multidrug resistance transporter 1(pfmdr1) gene which codes for a large 12 transmembrane domain ABC-transporter (PfMRP1), located in the parasite plasma membrane [25], Plasmodium falciparum dihydrofolate reductase (pfdhfr) gene (codes for P. falciparum dihydrofolate reductase enzyme), Plasmodium falciparum dihydropteroate synthase (pfdhps) gene which codes for dihydropteroate synthase enzyme of P. falciparum and P.falciparum atpase6 gene (pfatpase6).
Table 1
Primer sequences used for polymerase chain reaction
S/N | Gene | Primer sequence | Size (bp) | SNPs (codons) | Reference |
1 | Pfcrt | F: GGAGGTTCTTGTCTTGGTAAAT R: ATATTGGTAGGTGGAATAGATTCT | 315 | 391T/A,392G/C, 399G/T 400A/G,402T/A,404A/C (codons C72S, M74I,N75E, K76T) | [26] |
2 | Pfmdr1 | F: TGTTGAAAGATGGGTAAAGAGCAGA R: TCGTACCAATTCCTGAACTCACTT | 514 | 256A/T,257A/T (Codon N86Y/F) | |
3 | Pfdhps | F: GATTCTTTTTCAGATGGAGG R: TTCCTCATGTAATTCATCTGA | 770 | 1482T/G,1483C/T/G,1486C/G,1794A/G,1918C/G,2013G/T/A, (codon S436A/F/C, A437G, K540E, A581G, A613S/T) | |
4 | Pfdhfr | F: TGATGGAACAAGTCTGCGACGTT R: CTGGAAAAAATACATCACATTCATATG | 594 | 148T/C,152A/T,153T/C, 175T/C, 323G/A/C,490A/T (codons C50R,N511, C59R, S108, I164L) | |
5 | Pfapse6 | F: AAAATAAATACCACATCAACACAT R: TCAATAATACCTAATCCACCTAAA | 437 | 2306G/A (codon769N) | |
Detection of genetic markers of Plasmodium falciparum
The primer sequences in Table 1 were used to amplify pfcrt, pfmdr1, pfdhfr, pfdhps and pfatpaes6 genes by multiplex PCR as follows: Multiplex PCR master mix cocktail was prepared by adding 3.0 µl of the extracted DNA, 2.5 µl of 10X PCR buffer, 1.5 µl of 50 mM MgCl2, 1.0 µl of 2.5 Mm DNTPs, 1.0 µl of Taq polymerase (5 µ/ µl), 5 µl of nuclease free water, 1.0 µl each of 5pMol of each of the forward and reverse primers in Table 1 to give a total volume of 25 µl. This was run using the following programme: Initial detauration at 94o C for 5 minutes followed by 9 cycles of denaturation at 94 o C for 15 seconds, annealing at 65oC for 20 seconds, extension at 72 o C for 30 seconds and another 35 cycles of denaturation at 94 o C for 15 seconds, annealing at 55 o C for 20 seconds, extension at 72 oC for 30 seconds, final extension at72 o C for 7 minutes.
The PCR amplicons were separated by electrophoresis on a 1.5% (w/v) agarose gel stained with ethidium bromide. The gel was visualised on UV transilluminator gel imaging system and system photographed, band positions were determined and compared to molecular weight markers.
Amplification and Sequencing of pfatpase6 Gene
The pfatpase6 gene was amplified using the pfatpase6 primers in Table 1 above as follows: The master mix cocktail was prepared by adding 2.0 µl of 100 ng/ul DNA, 2.5 µl of 10x PCR buffer, 1.5 µl of 50 mM MgCl2, 1.0 µl of DMSO, 2.0 µl of 2.5MmDNTPs, 0.15 µl of Taq Polymerase (5 µ/µl), 1.0 µl forward primer, 1.0 µl reverse primer and 13.85 µl nuclease free water to make a total of 25 µl. This was run using the following programme: Nine cycles of initial denaturation at 94˚C for 15 minutes, denaturation at 94˚C for 40seconds, annealing at 60˚C for 120 seconds, extension at 72˚C for 40 seconds. This was followed by another 35 cycles of denaturation at 94˚C for 40 seconds, annealing at 50˚C for 120 seconds, extension at 72˚Cfor 40 seconds, final extension at 72˚C for 10 minutes. The PCR amplicons were separated by electrophoresis and visualised on UV transilluminator gel imaging system (gel documentation unit), after which gel pictures were taken from which band positions were determined and compared to molecular weight markers.
Sequencing of pfatpase gene
Amplicon purification was done using QiaQuick DNA gel extraction kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. Five to 10 µl of purified PCR products were used to prepare the sequencing mix using the ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction Kit V3.1. (Applied Biosystem, Foster City, CA, USA).
Phylogenetic Analysis
The multiple sequence alignment programme Clustal W was used to obtain an optimal nucleotide sequence alignment file after comparing with sequences deposited in GenBank. Phylograms were obtained by MEGA X based on aligned nucleotide sequences.