A dual indexed approach to small RNA sequencing library preparation for PRO-seq

doi:10.21203/rs.3.rs-3112433/v1

Advances in next generation sequencing (NGS) technologies have vastly increased the number of samples that can be sequenced together and reduced the cost per sample. To fully utilize the increased capacity of standard sequencers, samples must be multiplexed. Sample multiplexing allows libraries to be pooled and sequenced together on a single sequencing run. Multiplexing requires libraries that have been prepared with a unique 6-12 bp sequence (index). The most efficient and cost-effective sequencing platforms rely on paired end sequencing methodologies to improve multiplexing efficiency. While libraries with a single index can be sequenced on paired end sequencers they reduce the efficiency of demultiplexing and increase the sequencing cost due to index mis-assignment. However, some specialized library preparation protocols, like the TruSeq Small RNA protocol, that rely on custom sequencing adapters have not been updated by Illumnia to include a second index. Commercially available kits for creating small RNA paired end libraries are expensive and do not provide the level of transparency required to adapt the kits to custom protocols. Here, we provide a dual-indexed approach to small RNA library preparatio that reduces the cost per library by nearly half (compared to the NEXTFLEX v3 kit) and includes all sequences for the oligonucleotides required. While this workflow was developed for PRO-seq libraries, deviations from the original TruSeq Small RNA library preparation protocol are denoted and alternate reagents are provided to facilitate adaptation of existing protocols.

Epigenetics & Genomics

PRO-Seq

Dual-indexed libraries

NovaSeq

TRUseq Small RNA

Advances in next generation sequencing (NGS) technologies have vastly increased the number of samples that can be sequenced together and reduced the cost per sample. To fully utilize the increased capacity of standard sequencers, samples must be multiplexed. Sample multiplexing allows libraries to be pooled and sequenced together on a single sequencing run. Multiplexing requires libraries that have been prepared with a unique 6–12 bp sequence (index). The most efficient and cost-effective sequencing platforms rely on paired end sequencing methodologies to improve multiplexing efficiency. While libraries with a single index can be sequenced on paired end sequencers they reduce the efficiency of demultiplexing and increase the sequencing cost due to index mis-assignment (Illumnia, 2018). However, some specialized library preparation protocols, like the TruSeq Small RNA protocol, that rely on custom sequencing adapters have not been updated by Illumnia to include a second index. Commercially available kits for creating small RNA paired end libraries are expensive and do not provide the level of transparency required to adapt the kits to custom protocols. Here, we provide a dual-indexed approach to small RNA library preparation (Fig. 1) that reduces the cost per library by nearly half (compared to the NEXTFLEX v3 kit) and includes all sequences for the oligonucleotides required. While this workflow was developed for PRO-seq libraries, deviations from the original TruSeq Small RNA library preparation protocol (Illumina, 2016) are denoted and alternate reagents are provided to facilitate adaptation of existing protocols.

Illumina indexed primers consist of three functional parts: the capture site, the index, and the read primer site. Two primers (P5 and P7) are required for amplification of dual-indexed libraries. The P5 primer includes the P5 capture site, the i5 index, and the Read1 primer site. The P7 primer includes the P7 capture site, the i7 index, and the Read2 primer site (Fig. 2A). In addition to the standard components, the small RNA workflow requires homology to the RNA adaptors that facilitate reverse transcription (Fig. 2B). To adapt the original TruSeq Small RNA primers for paired end platforms we replaced RNA PCR Primer (RP1) with an indexed primer (PS-P5-xxx). The insertion of an index may disrupt the Read1 priming site therefore PS-P5-xxx includes a 4 base pair addition between the index and read 1 primer site (Fig. 2B). We also updated the RNA PCR Primer Index xx (RPI-xx) to include an 8-mer index (PS-P7-xxx) instead of the original 6-mer index to improve multiplexing (Fig. 2B). The original RPI-xx can be paired with PS-P5-xxx to create dual indexed libraries but this will increase the likelihood a library will have an index that conflicts with another user’s library. The indexes used to make these primers are based on the NEBNext Multiplex Oligos for Illumina (NEB #E6440) and follows their nomenclature (i.e. PS-P5-A01 contains the i5 index from well A01). We provide sequences for 5 P5 and 5 P7 primers but this can easily be expanded to fit the user’s multiplexing needs by changing the index sequences.

Table 1. Commercially Available Reagents.

Commercially available reagents are provided in the table below. Estimated cost is based on information from supplier websites as of May 2023 and does not include institutional discounts.

Reagent	Supplier	Cat #	$	# of Libraries	$ per Library
Acrylamide (29:1)	Bio-Rad	1610156	78	312 (2/gel)	0.25
APS	RPI	A20500	24.75	1000 (2/gel)	0.03
Betaine (5M)	Fisher Scientific	AAJ77507UCR	54.34	150	0.36
dNTP Solution Set	NEB	N0446S	189	1333	0.14
EDTA, pH 8.0 (0.5 M)	ThermoFisher	R1021	25	250000	0.00
Ethanol (200 proof)	Decon Labs	2701	153	20000	0.00
Glycogen (20mg/mL)	Millipore Sigma	10901393001	176	500	0.35
Mini-pestle	Fisher Scientific	12-141-364	138.00	100¹	1.38
Molecular Biology Grade (MBG) H₂O	Corning	46-000-CM	139.60	3529	0.04
NaCl (5M)	ThermoFisher	AM9760G	52.5	6944	0.01
NaOAc, pH 5.5 (3M)	Ambion	AM9740	54.5	5000	0.01
NEXTFLEX sRNA UDI i5+i7 (30 µM)²	PerkinElmer	NOVA-513223	---	---	---
Phenol:Chloroform: Isoamyl Alchohol 25:24:1	Sigma-Aldrich	P3803	114	500	0.23
Phusion Polymerase (includes buffer)	NEB	M5030S	120	100	1.20
Rnase Inhibitor	Applied Biosystems	N8080119	114	40	2.85
Spin-X Column	Sigma-Aldrich	CLS-8162	276	96	2.88
Superscript III Reverse Transcriptase (includes buffer/DTT)	Invitrogen	18080044	448	50	8.96
SYBR Gold	Invitrogen	S11494	231	400 (2/gel)	0.58
T4 RNA Ligase 1 (indcludes buffer/ATP)	NEB	M0204S	71	50	1.42
Reagent	Supplier	Cat #	$	# of Libraries	$ per Library
TEMED	RPI	T18000	27	5000 (2/gel)	0.01
Tris-Borate-EDTA buffer (TBE) (10X)	ThermoFisher	15581028	353	132 (2/gel)	2.68
Ultra Low Range DNA Ladder (includes buffer)	Invitrogen	10597012	110	40	2.75
Total Cost			2948.69		26.13

[1] Mini-pestles can be soaked in water to remove any remaining gel pieces, dried, and reused.

[2] NEXTFLEX sRNA UDI i5+i7 (30 µM) is a custom sequencing primer mix required for sequencers using the reverse complement chemistry (i.e. HiSeq 3000/4000, NovaSeq 6000 v1.5) sequencers using the forward strand chemistry (i.e. MiSeq, NovaSeq 6000 v1.0, NovaSeqX ) can use standard Illumina sequencing primers. VANTAGE will provide this reagent for users.

Required equipment:

□ 2100 Bioanalyzer Desktop (Agilent: #G2940CA)

□ Benchtop microcentrifuge (General lab supplier)

□ Centrifugal Vacuum Concentrator (General lab supplier)

□ Cooler block or 96-well working rack for 200 µl tubes (General lab supplier)

□ Dark Reader transilluminator or UV transilluminator (General lab supplier)

□ Electrophoresis power supply (BioRad #645050 or similar)

□ Micropipettes P2, P20, P200, P1000 (General lab supplier0

□ Mini-PROTEAN Tetra Cell (BioRad #1658004EDU or similar

□ Room temperature tube shaker or tube rotator (General lab supplier)

□ Thermal cycler with heated lid (General lab supplier)

Table 2

Oligonucleotide Sequences All custom oligonucleotides were synthesized by IDT and HPLC purified.
Name	Sequence (5' → 3')	Ordering Notes
PS-P5-A01	AATGATACGGCGACCACCGAGATCTACACCGAATACGACACGTTCAGAGTTCTACAGTCCGA
PS-P5-A02	AATGATACGGCGACCACCGAGATCTACACTCTAGGAGACACGTTCAGAGTTCTACAGTCCGA
PS-P5-A03	AATGATACGGCGACCACCGAGATCTACACCGCAACTAACACGTTCAGAGTTCTACAGTCCGA
PS-P5-A04	AATGATACGGCGACCACCGAGATCTACACCGTATCTCACACGTTCAGAGTTCTACAGTCCGA
PS-P5-A05	AATGATACGGCGACCACCGAGATCTACACGTACACCTACACGTTCAGAGTTCTACAGTCCGA
PS-P7-A01	CAAGCAGAAGACGGCATACGAGATTTACCGACGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
PS-P7-A02	CAAGCAGAAGACGGCATACGAGATAGTGACCTGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
PS-P7-A03	CAAGCAGAAGACGGCATACGAGATTCGGATTCGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
PS-P7-A04	CAAGCAGAAGACGGCATACGAGATCAAGGTACGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
PS-P7-A05	CAAGCAGAAGACGGCATACGAGATTCCTCATGGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
Rev3/ VRA3	GAUCGUCGGACUGUAGAACUCUGAAC/inverted dT/	5’ phosphorylated 3′ inverted dT
VRA5³	CCUUGGCACCCGAGAAUUCCA	5’ not phosphorylated

Table 3

Custom oligo substitutions in established protocols Provided below is a table with the custom oligos used in this protocol and the oligos they replace in established protocols.
Custom	TruSeq Small RNA	NEXTFLEX Small RNA v3
PS-P5-xxx	RP1	NEXTFLEX RT Primer and UDI primer 2
PS-P7-xxx	RPI-xx	UDI primer 1
Rev3/ VRA3³	RA3	NEXTFLEX 3’ 4N adapter
VRA5³	RA5	NEXTFLEX 5’ 4N adapter

[3] Rev3/VRA3 and VRA5 are the reverse complement of RA5 (5’ GUUCAGAGUUCUACAGUCCGACGA UC 3’) and RA3 (5’ UGGAAUUCUCGGGUGCCAAGG 3’) respectively. This change was made due the need to sequence PRO-seq libraries from the 3’ end. These oligos should be adjusted accordingly based on the users sequencing needs. RA3 should be phosphorylated at the 5’ and include an inverted dT at the 3’ end if adhering to original protocol (Illumina, 2016; Mahat et al., 2016).

This workflow has been adapted from the Illumina TruSeq Small RNA Workflow) for PRO-seq library preparation (Mahat et al., 2016). Major deviations from the Tru-seq protocol will be denoted and described in the footnotes. Adapter concentrations are dependent on amount of input RNA and should be titrated for other applications.

3’Adaptor Ligation:

Occurs after base hydrolysis and streptavidin pulldown.

1. Dilute 1μL Reverse 3’ RNA adaptor (Rev3, 10 μM)⁴ in 4 μL MBG H₂

2.Dissolve RNA pellet in 5 μL of diluted Rev3. Pipette up and down to mix.

3. Incubate the tube at 65°C for 20 seconds and then immediately place the tube on ice.

Note: It is very important to keep the Rev3 mix on ice after the 65°C incubation to prevent secondary structure formation.

4. Pre-heat the thermal cycler to 20°C.

5. Prepare the following master mix in a separate tube on ice. Make 10% extra reagent if you are preparing multiple samples.

Table 4

3' Ligation Master Mix
Reagent	1X Vol (µL)	8X Vol (µL)
Water	1	8.8
10X T4 RNA ligase buffer	1	8.8
RNase Inhibitor	1	8.8
T4 RNA Ligase 1⁵	1	8.8
10 mM ATP	1	8.8
Total Volume	5	44

6. Add 5 µL master mix to RNA/Rev3 mixture (from step 3). Pipette up and down to mix.

7. Incubate the tube on the pre-heated thermal cycler at 20°C for 6 hours and then 4°C overnight.

Note: May be shortened to 1–2 hour incubation at 25°C.

8. Proceed with streptavidin pulldown and enzymatic modification of the RNA 5’ ends.

5’ Adaptor Ligation:

Occurs after 5’ hydroxyl repair.

1. Dilute 1 µL Reverse 5’ RNA adaptor (VRA5, 10 µM)⁶ in 4 µL MBG H₂O per sample.

2. Dissolve RNA pellet in 5 µL of diluted VRA5. Pipette up and down to mix.

3. Incubate at 65°C for 20 seconds and then immediately place the tube on ice.

Note: It is very important to keep the VRA5 mix on ice after the 65°C incubation to prevent secondary structure formation. When VRA5, pipette from one tube on ice to another tube on ice and pipette mix the reactions.

4. Pre-heat the thermal cycler to 20°C.

5. Prepare the following master mix in a separate tube on ice. Make 10% extra reagent if you are preparing multiple samples.

Table 5

5' Ligation Master Mix.
Reagent	1X Vol (µL)	8X Vol (µL)
Water	1	8.8
10X T4 RNA ligase buffer	1	8.8
RNase Inhibitor	1	8.8
T4 RNA Ligase 1	1	8.8
10 mM ATP	1	8.8
Total Volume	5	44

6. Add 5 µL master mix to RNA/VRA5 mixture.

7. Incubate the tube on the pre-heated thermal cycler at 20°C for 6 hour and then 4°C overnight.

Note: May be shortened to 1–2 hour incubation at 25°C.

8. Proceed with third streptavidin pulldown.

Reverse Transcription:

Occurs after third streptavidin pulldown.

1. Dilute 0.5 µL of the i5 Indexed PCR primer (PS-P5-XX, 50 µM)⁷ in 4.5 µL MBG H₂O per sample.

Note: PS-P5-XX contains the i5 index. Each sample will require a unique combination of i5 an i7 Indexed PCR primer (PS-P7-XX, Amplification step) to be multiplexed.

2. Dissolve RNA pellet in 5 µL of dilute PS-P5-XX. Pipette up and down to mix.

3. Incubate the tube on the pre-heated thermal cycler at 65°C for 5 minutes and then immediately place the tube on ice.

4. Pre-heat the thermal cycler to 48°C.

5. Prepare master mix in separate tube. Make 10% extra reagent if you are preparing multiple samples. (see next page)

Table 6

Reverse Transcription Master Mix.
Reagent	1X Vol (µL)	8X Vol (µL)
5X First Strand Buffer	2	17.6
12.5 mM dNTP mix	0.5	4.4
100 mM DTT	1	8.8
RNase inhibitor	0.5	4.4
Total Volume	4	35.2

6. Add 4 µL master mix to each sample. Pipette up and down to mix.

7. Incubate in pre-heated thermal cycler at 48°C for 3 minutes.

8. Transfer to ice.

9. Add 1 µL Superscript III Reverse Transcriptase to each sample. Pipette up and down to mix.

10. Place in thermal cycler using the following program

a. 20 minutes at 44°C

b. 45 minutes at 52°C

c. Hold at 4°C

11. Add 8 µL MBG H₂O to the RT product.

Note: RT product can be stored at -20°C.

Proceed with Full Scale Amplification.

Full Scale Amplification:

Occurs after Reverse Transcription.

1. Preheat thermal cycler.

2. Prepare the PCR master mix in a separate tube on ice. Make 10% extra reagent if you are preparing multiple samples.

Table 7

PCR Master Mix.
Reagent	1X Vol (µL)	8X Vol (µL)
Water	10.5	92.4
5X Phusion HF Buffer	10	88
5M Betaine	10	88
12.5 mM dNTP	1	8.8
Phusion DNA Poymerase	0.5	4.4
Total Volume	32	281.6

3. Add 1 μL of an i5 Indexed PCR primer (PS-P5-xxx, 12.5 μM)⁸ and 1 μL of an i7 Indexed PCR primer (PS-P7-xxx, 12.5μM)⁹ to each sample.

Note: PS-P5-xxx and PS-P7-xxx contain the i5 and i7 indexes respectively. Each sample will require a unique combination of i5 an i7 Indexed PCR primer to be multiplexed. Use the same PS-P5-xxx primer used during Reverse Transcription Step 1 for each sample. Index combinations are listed in the next section.

4. Pipette up and down to mix and then place on ice.

5. Add 32 µL of PCR master mix to each sample. Pipette up and down to mix.

6. Amplify the tube in the thermal cycler using the following PCR cycling conditions:

a. 2 minutes at 95°C.

b. 21 cycles of:

i. 30 seconds at 95°C

ii. 30 seconds at 56°C

iii. 30 seconds at 72°C

c. 10 minutes at 72°C

d. Hold at 4°C

Library Purification:

This step describes a PAGE size selection. Gel-free size selection for PRO-seq libraries has been described here (Judd et al., 2020). Gel-free size selection is sensitive to excess primer dimers which will appear as a band around 130 bp (Fig. 3A).

1. Ethanol precipitate the final PCR product.

a. Add 150 µL MBG H₂O to PCR product.

b. Add 1 µL glycogen (15–20 mg/mL).

c. Add 14.4 µL NaCl (5M).

d. Add 600 µL 100% Ethanol.

e. Incubate at -80°C for 30 minutes and spin down at max speed for 35 minutes at 4°C.

f. Wash pellet in 75% Ethanol and spin down at max speed for 5 minutes at 4°C.

g. Air dry pellet

h. Resuspend in 10 µL MBG H₂O.

2. During precipitation pour 8% native polyacrylamide gels.

Table 8

8% PAGE Gel Master Mix.
Reagent	1X Vol	4X Vol
30% Acrylamide (29:1)	3.2 mL	12.8 mL
H₂O	6.4 mL	25.6 mL
5X TBE	2.4 mL	9.6 mL
10% APS	200 µL	800 µL
TEMED	10 µL	40 µL
Total Volume	12.23 mL	48.84 mL

3. Assemble the gel electrophoresis apparatus per the manufacturer’s instructions. Fill with 1X TBE buffer.

4. Add 2 µL of 6X loading buffer to each 10 µL sample.

5. Load gel.

Note: Load 2 libraries per gel with ≥ 1 empty well between each ladder and library.

6. Run gel at 70 V for 1.5 hours at room temperature. Check progress every 30 minutes.

7. Stain gels individually in SYBR Gold in 1X TBE (1:10,000).

8. Image gel and cut out library from 150 bp to 500 bp and place into a new tube.

9. Crush each gel piece with a mini-pestle.

10. Add 1 mL soaking buffer and incubate at 37°C overnight with agitation.

11. Spin samples at max speed for 5 minutes at room temperature.

12. Aliquot 600–800 µL supernatant to new tube and store at 4°C.

13. Add 400 µL fresh soaking buffer to gel pieces and incubate at 37°C for 4 hours with agitation.

14. Spin samples at max speed for 5 minutes at room temperature.

15. Collect as much supernatant as possible to new tube.

16. Add 500–700 µL at a time to a Spin X column and spin at 4000 rpm for 4 minutes at room temperature. Repeating until entire sample (combine like from step 12 and 15) have been run through the column. Moving flow through to new tube. KEEP FLOW THROUGH.

17. Reduce the volume to the flow through using the centrifugal vacuum concentrator.

Note: If you do not have access to a centrifugal vacuum concentrator, you can split the libraries into two 1.5 mL micro centrifuge tubes and perform separate phenol-chloroform precipitations recombining like libraries at 75% ethanol wash stage. We recommend using a P1000 with a cut tip to transfer pellets.

18. After volume reduction perform phenol-chloroform precipitation.

a. Add equal volume of phenol-chloroform to the filtrate. Shake vigorously to mix.

b. Spin at max speed for 5 minutes at 4°C.

c. Move aqueous phase to new tube.

d. Add 1 µL glycogen (15–20 mg/mL).

e. Add 3 M NaOAc (1/10 of the starting volume).

f. Add 100% ethanol (3X the starting volume).

g. Incubate at -20°C for 10 minutes and spin down at max speed for 40 minutes at 4°C.

h. Wash pellet in 75% Ethanol and spin down at max speed for 5 minutes at 4°C.

i. Air dry pellet

j. Resuspend in 10 µL 1 mM EDTA.

19. Submit samples to sequencing facility or store at -20°C.

Library Validation and Sequencing:

The following quality control and sequencing measures are performed by the core for VANTAGE users. Sequencers using the reverse complement chemistry (i.e. HiSeq 3000/4000, NovaSeq 6000 v1.5) will require the NEXTFLEX sRNA UDI i5 + i7 primer mix. Sequencers using forward strand chemistry (i.e. MiSeq, NovaSeq 6000 v1.0, NovaSeqX) do not require custom sequencing primers. Users submitting these libraries to VANTAGE for sequence-ng on the NovaSeq 6000 v1.5 should request the NextFlex protocol to ensure that the custom sequencing primers are used.

1. Load 1 µL resuspended library on an Aligent Technologies 2100 Bioanalyzerr using a High Sensitivity DNA chip.

2. Assess the size, purity, and concentration of the library.

Note: For VANTAGE users, the libraries need to be approved for sequencing after the Bioanalyzer analysis.

3. Normalize library concentration to 2 nM using Tris-HCL 10 mM, pH 8.5.

Note: For storage add Tween 20 to the final library for a final concentration of 0.1% Tween-20.

4. Load on sequencer.

Note: The standard sequencing reagents can be used on sequencers using the forward strand chemistry (i.e. MiSeq, NovaSeq 6000 v1.0, NovaSeqX). The NEXTFLEX sRNA UDI i5 + i7 primer mix is required on sequencers using the reverse complement chemistry (i.e. HiSeq 3000/4000, NovaSeq 6000 v1.5).

Note: Sequencing data from the 3’ end will be in the Read1 file.

[4] Rev3 replaces RA3 (see footnote 3)

[5] T4 RNA Ligase 1 replaces T4 RNA Ligase 2, truncated (available from NEB).

[6] VRA5 replaces RA5 (see footnote 3)

[7] PS-P5-XX replaces RP1. PS-P5-XX includes an i5 index allowing for more efficient demultiplexing on paired end sequencers.

[8] PS-P5-xxx replaces RP1. PS-P5-xxx includes an i5 index allowing for more efficient demultiplexing on paired end sequencers.

[9] PS-P7-xxx replaces RPI-x. PS-P7-xxx includes an 8-mer i7 index allowing for more efficient demultiplexing on paired end sequencers.

Table 9. Unique Index Combinations.

Primer Set (i5-i7)	i5	i7
A01-A01	CGAATACG	TTACCGAC
A01-A02	CGAATACG	AGTGACCT
A01-A03	CGAATACG	TCGGATTC
A01-A04	CGAATACG	CAAGGTAC
A01-A05	CGAATACG	TCCTCATG
A02-A01	TCTAGGAG	TTACCGAC
A02-A02	TCTAGGAG	AGTGACCT
A02-A03	TCTAGGAG	TCGGATTC
A02-A04	TCTAGGAG	CAAGGTAC
A02-A05	TCTAGGAG	TCCTCATG
A03-A01	CGCAACTA	TTACCGAC
A03-A02	CGCAACTA	AGTGACCT
A03-A03	CGCAACTA	TCGGATTC
A03-A04	CGCAACTA	CAAGGTAC
A03-A05	CGCAACTA	TCCTCATG
A04-A01	CGTATCTC	TTACCGAC
A04-A02	CGTATCTC	AGTGACCT
A04-A03	CGTATCTC	TCGGATTC
A04-A04	CGTATCTC	CAAGGTAC
A04-A05	CGTATCTC	TCCTCATG
A05-A01	GTACACCT	TTACCGAC
A05-A02	GTACACCT	AGTGACCT
A05-A03	GTACACCT	TCGGATTC
A05-A04	GTACACCT	CAAGGTAC
A05-A05	GTACACCT	TCCTCATG

Competing interests: The authors declare no competing interests.

Illumina, 2016. TruSeq Small RNA Library Prep Reference Guide (Reference Guide No. 15004197 v02).
Illumnia, 2018. Effects of Index Misassignment on Multiplexing and Downstream Analysis (White Paper No. 770-2017- 004- D).
Judd, J., Wojenski, L.A., Wainman, L.M., Tippens, N.D., Rice, E.J., Dziubek, A., Villafano, G.J., Wissink, E.M., Versluis, P., Bagepalli, L., Shah, S.R., Mahat, D.B., Tome, J.M., Danko, C.G., Lis, J.T., Core, L.J., 2020. A rapid, sensitive, scalable method for Precision Run-On sequencing (PRO-seq). https://doi.org/10.1101/2020.05.18.102277
Mahat, D.B., Kwak, H., Booth, G.T., Jonkers, I.H., Danko, C.G., Patel, R.K., Waters, C.T., Munson, K., Core, L.J., Lis, J.T., 2016. Base-pair-resolution genome-wide mapping of active RNA polymerases using precision nuclear run-on (PRO-seq). Nat. Protoc. 11, 1455–1476. https://doi.org/10.1038/nprot.2016.086

Provided below is the TruSeq adapter file for trimming adapters from sequencing data. This can be copied and saved as a .txt file.

>D701

GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTACTCGATCTCGTATGCCGTCTTCTGCTTG

>D701_rc

CAAGCAGAAGACGGCATACGAGATCGAGTAATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC

>D702

GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGGAGAATCTCGTATGCCGTCTTCTGCTTG

>D702_rc

CAAGCAGAAGACGGCATACGAGATTCTCCGGAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC

>D703

GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGCTCATTATCTCGTATGCCGTCTTCTGCTTG

>D703_rc

CAAGCAGAAGACGGCATACGAGATAATGAGCGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC

>D704

GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGATTCCATCTCGTATGCCGTCTTCTGCTTG

>D704_rc

CAAGCAGAAGACGGCATACGAGATGGAATCTCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC

>D705

GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCAGAAATCTCGTATGCCGTCTTCTGCTTG

>D705_rc

CAAGCAGAAGACGGCATACGAGATTTCTGAATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC

>D706

GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAATTCGTATCTCGTATGCCGTCTTCTGCTTG

>D706_rc

CAAGCAGAAGACGGCATACGAGATACGAATTCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC

>D707

GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGAAGCTATCTCGTATGCCGTCTTCTGCTTG

>D707_rc

CAAGCAGAAGACGGCATACGAGATAGCTTCAGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC

>D708

GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAATGCGCATCTCGTATGCCGTCTTCTGCTTG

>D708_rc

CAAGCAGAAGACGGCATACGAGATGCGCATTAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC

>D709

GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGCTATGATCTCGTATGCCGTCTTCTGCTTG

>D709_rc

CAAGCAGAAGACGGCATACGAGATCATAGCCGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC

>D710

GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGCGAAATCTCGTATGCCGTCTTCTGCTTG

>D710_rc

CAAGCAGAAGACGGCATACGAGATTTCGCGGAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC

>D711

GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCTCGCGCATCTCGTATGCCGTCTTCTGCTTG

>D711_rc

CAAGCAGAAGACGGCATACGAGATGCGCGAGAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC

>D712

GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCGATAGATCTCGTATGCCGTCTTCTGCTTG

>D712_rc

CAAGCAGAAGACGGCATACGAGATCTATCGCTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC

>D501

AATGATACGGCGACCACCGAGATCTACACTATAGCCTACACTCTTTCCCTACACGACGCTCTTCCGATCT

>D501_rc

AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGCTATAGTGTAGATCTCGGTGGTCGCCGTATCATT

>D502

AATGATACGGCGACCACCGAGATCTACACATAGAGGCACACTCTTTCCCTACACGACGCTCTTCCGATCT

>D502_rc

AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGCCTCTATGTGTAGATCTCGGTGGTCGCCGTATCATT

>D503

AATGATACGGCGACCACCGAGATCTACACCCTATCCTACACTCTTTCCCTACACGACGCTCTTCCGATCT

>D503_rc

AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGATAGGGTGTAGATCTCGGTGGTCGCCGTATCATT

>D504

AATGATACGGCGACCACCGAGATCTACACGGCTCTGAACACTCTTTCCCTACACGACGCTCTTCCGATCT

>D504_rc

AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTCAGAGCCGTGTAGATCTCGGTGGTCGCCGTATCATT

>D505

AATGATACGGCGACCACCGAGATCTACACAGGCGAAGACACTCTTTCCCTACACGACGCTCTTCCGATCT

>D505_rc

AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTCTTCGCCTGTGTAGATCTCGGTGGTCGCCGTATCATT

>D506

AATGATACGGCGACCACCGAGATCTACACTAATCTTAACACTCTTTCCCTACACGACGCTCTTCCGATCT

>D506_rc

AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTAAGATTAGTGTAGATCTCGGTGGTCGCCGTATCATT

>D507

AATGATACGGCGACCACCGAGATCTACACCAGGACGTACACTCTTTCCCTACACGACGCTCTTCCGATCT

>D507_rc

AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTACGTCCTGGTGTAGATCTCGGTGGTCGCCGTATCATT

>D508

AATGATACGGCGACCACCGAGATCTACACGTACTGACACACTCTTTCCCTACACGACGCTCTTCCGATCT

>D508_rc

AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGTCAGTACGTGTAGATCTCGGTGGTCGCCGTATCATT

A dual indexed approach to small RNA sequencing library preparation for PRO-seq

Status:

Version 1

Abstract

Figures

Introduction

Primer Design Strategy

Reagents and Equipment

Custom Oligonucleotide Sequences

PRO-seq Workflow

Index Combinations

Declaration

References

Appendix

Status:

Version 1