Human pituitary adenoma samples
Formalin-fixed, paraffin-embedded (FFPE) blocks from patients with pituitary adenoma and diagnoses of non-functional adenoma, acromegaly or Cushing’s disease who underwent transsphenoidal surgery (n = 8–10 per group) were used to evaluate NMB and NMBR expression.
Surgically resected human corticotroph tumor samples from patients who were diagnosed with Cushing’s disease or subclinical Cushing’s disease and underwent transsphenoidal surgery (n = 7, other than those whose FFPE blocks were used in the previous experiment) were used to evaluate the effect of PD168368 in primary cultures of patient-derived primary cells.
The procedure used for the diagnosis of Cushing’s disease and subclinical Cushing’s disease followed the published Japanese diagnostic criteria [31]. In all the patients, the presence of an ACTH-producing tumor was confirmed histologically after its resection.
RNA extraction from FFPE samples
RNA was extracted from FFPE samples of human pituitary adenomas using an AllPrep DNA/RNA FFPE kit (Qiagen, Hilden, Germany) and an RNeasy kit (Qiagen), according to the manufacturers’ protocols.
Immunohistochemistry
Immunohistochemical staining was performed to evaluate NMB, NMBR and cyclin E1 protein expression. Human corticotroph adenoma samples were embedded in paraffin and 5-µm-thick sections were prepared. After these were deparaffinized, hydrated with ethanol, and endogenous peroxidase activity was blocked, the sections were immunostained using rabbit anti-NMB (Sigma-Aldrich, St. Louis, MO catalog no. SAB1301059, RRID:AB_2619620), mouse anti-NMBR (Santa Cruz Biotechnology, Dallas, TX, catalog no. sc-374623, RRID:AB_10989220) or mouse anti-cyclin E antibodies (Santa Cruz Biotechnology, catalog no. sc-377100, RRID:AB_2923122). The sections were counterstained with hematoxylin. Images were acquired using a BZ-X710 microscope (Keyence, Osaka, Japan).
For immunofluorescence, tissue sections were incubated overnight at 4°C with the appropriate primary antibodies [rabbit anti-NMB antibody, mouse anti-NMBR, mouse anti-GH antibody (Santa Cruz Biotechnology, catalog no. sc-166696, RRID:AB_2111022) or mouse anti-ACTH antibody (Santa Cruz Biotechnology, catalog no. sc-57021, RRID:AB_785253)]. After rinsing with phosphate-buffered saline, the tissues were incubated with secondary antibodies for 30 minutes [Alexa Fluor 594-conjugated anti-mouse IgG (Molecular Probes, catalog no. A21203, RRID:AB_141633) or Alexa Fluor 488-conjugated antirabbit IgG (Molecular Probes, Eugene, OR, catalog no. A11008, RRID:AB_143165)]. The nuclei were counterstained with Vectashield HardSet mounting medium containing 4,6-diamino-2-phenylindole (DAPI) (Vector Laboratories, Newark, CA). Immunofluorescence was visualized using a BZ-9000 fluorescence microscope (Keyence).
Cell culture and reagents
AtT-20/D16v-F2 cells (RRID:CVCL_4109) were purchased from ATCC. AtT-20/D16v-F2 cells were cultured in DMEM (Thermo Fisher Scientific, Waltham, MA) containing 10% fetal bovine serum, penicillin and streptomycin in a 5% CO2-containing humidified atmosphere at 37°C. PD168368 was purchased from Santa Cruz Biotechnology (catalog no. sc-204166).
Animals
BALB/c-nu mice were purchased from Charles River Laboratories (Wilmington, MA) and were maintained under a 12-h light/dark cycle (lights on at 06:00 and off at 18:00). Food and water was provided ad libitum.
Tumor xenograft model
AtT-20/D16v-F2 cells (1×106 cells) in 1:1 ratio with Matrigel (BD Biosciences, Franklin Lakes, NJ) were subcutaneously injected into the dorsum of BALB/c-nu mice, then the mice were allocated to two groups of eight 1 week afterwards. The first group was administered 50 µL vehicle (polyethylene glycol 400 (PEG), Sigma-Aldrich) daily by intraperitoneal injection and the second group was administered 1.2 mg/kg PD168368 in PEG daily with reference to the previous report [32]. The mice were weighed and their tumor size was measured using calipers 0, 7 and 14 days later. Their tumor volumes were calculated using the equation length × width2 × 0.5. The mice were euthanized on day 14, between 08:30 and 12:30, by decapitation after anesthesia was induced using isoflurane. Blood samples were obtained from the left ventricle of each mouse by cardiac puncture and serum/plasma was stored at − 80°C until analyzed.
Patient-derived corticotroph adenoma cells
We isolated cells from corticotroph tumors of patients using Neural Tissue Dissociation Kits (Miltenyi Biotec, Bergisch Gladbach, Germany), according to the manufacturer’s protocol, then resuspended them in DMEM supplemented with 10% fetal bovine serum. After 24 h of incubation with concentrations of PD168368, we extracted RNA from the isolated cells and collected the medium.
Quantitative real-time PCR
RNA was isolated from AtT-20/D16v-F2 cells or patient-derived corticotroph adenoma cells using an RNeasy Mini Kit (Qiagen) and used this to prepare cDNA. Real-time PCR was performed in duplicate using a 7500 Fast Real Time PCR system and Fast SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA). RTarget mRNA expression was calculated relative to that of 18S mRNA for experiments performed in AtT-20/D16v-F2 cells, and relative to that of GAPDH for experiments performed in patient-derived corticotroph adenoma cells. The primer sequences used are listed in Table 1.
Table 1
Primers for real-time PCR
Gene name | Gene symbol | Forward Primer | Reverse Primer |
Human NMB | NMB | CAAATACTGCAGAAATGACACCAAT | AGGGTCCCATTCAGCACCTT |
Human NMBR | NMBR | AAGGTGGGCTGCAAACTG | CAGTGAGAGTGAACACGGAAACC |
Human POMC | POMC | CAGGACCTCACCACGGAAAG | CGGGAACATGGGAGTCTCG |
Human cyclin E | CCNE | GTGTCCTGGATGTTGACTGC | TGCAGTGAAGACATGTGGG |
Human GAPDH | GAPDH | GGATTTGGTCGTATTGGG | GGAAGATGGTGATGGGATT |
Mouse Pomc | Pomc | TGTACCCCAACGTTGCTGAG | AGGACCTGCTCCAAGCTAA |
Mouse cyclin E1 | Ccne1 | TGCACCAGTTTGCTTATGTT | CCGTGTCGTTGACATAGG |
Mouse cyclin-dependent kinase 2 | Cdk2 | TTGGAGTCCCTGTCCGAACT | CGGGTCACCATTTCAGCAAAG |
Mouse 18S ribosomal RNA | 18S | TGGCCAACGGTCTAGACAAC | CAGTGGTCTTGGTGTGCTGA |
DNA microarray analysis
cDNA was prepared from RNA and used in a Clariom S assay (Affymetrix, Santa Clara, CA), the results of which were analyzed according to the Affymetrix protocol. The scanned image files were visually inspected for artefacts and normalized using GeneChip Command Console Software (Affymetrix). The gene expression of vehicle and 1 µM PD168368-treated AtT-20/D16v-F2 cells was compared using Transcriptome Analysis Console software (Applied Biosystems).
Western blotting
After each treatment, AtT-20 cells were lysed in CelLytic M (Sigma Aldrich) supplemented with a protease and phosphatase inhibitor cocktail. Lysates containing the same amount of protein were mixed with 2× Laemmli Sample Buffer (Bio-Rad), separated on 4–20% polyacrylamide gels (Bio-Rad, Hercules, CA) and electroblotted onto polyvinylidene fluoride membranes (Millipore, Burlington, MA). The membranes were blocked in Bullet Blocking One for Western Blotting (Nacalai Tesque. Kyoto, Japan) for 30 minutes at room temperature, then incubated with the appropriate primary antibodies overnight at 4°C [mouse anti-POMC antibody (Santa Cruz Biotechnology, catalog no. sc-57021, RRID:AB_785253),, rabbit anti-cyclin E1 antibody (Cell Signaling Technology, Danvers, MA, catalog #20808, RRID:AB_2783554), rabbit anti-CDK2 antibody (Cell Signaling Technology, catalog #18048, RRID:AB_2923174) or rabbit anti-GAPDH (Cell Signaling Technology, catalog #5174, RRID:AB_10622025)]. Horseradish peroxidase-conjugated goat anti-rabbit antibody (Bio-Rad, catalog no. 170–5046, RRID:AB_11125757) and horse anti-mouse antibody (Bio-Rad, catalog no. 172–1011, RRID:AB_11125936) were used as the secondary antibodies. Signals were detected using ECL Western Blotting Detection Reagents (Cytiva, Tokyo, Japan) and an LAS-4000 imager (Fujifilm, Tokyo, Japam), and the specific band intensities were normalized to those of GAPDH. To quantify protein expression, densitometric analysis was performed using ImageJ software (NIH Image).
ACTH and corticosterone assays
Medium and mouse plasma ACTH concentrations were analyzed using an ELISA kit (MD Bioproducts, Zürich, Switzerland, catalog no. M046006), according to the manufacturer’s protocol. The medium ACTH concentration was normalized to water-soluble tetrazolium salt (WST)-1 (Takara Bio, Shiga, Japan) absorbance. Mouse serum corticosterone concentration was analyzed using an ELISA kit (Enzo Life Sciences, Farmingdale, NY, catalog no. ADI-900-097).
Cell proliferation analysis
For cell proliferation assays, 2×104 cells were seeded into each well of a 96-well plate, then following each treatment WST-1 reagent (Takara Bio) was added and the cells were incubated for 2 hours in the incubator. A microplate reader (SpectraMax Paradigm, Molecular Devices, San Jose, CA) was used to measure the absorbance of each well at 440 nm. All measurements were performed in duplicate or triplicate.
Statistics
Data are presented as mean ± SD. Comparisons between two groups were made using unpaired Student t-tests, and one-way ANOVA was used to compare values among multiple groups. If the ANOVA test showed significant differences, the Tukey-Kramer post-hoc test was used to compare two specific groups and Dunnett’s test was used to compare other groups with the control group. The results were considered to be statistically significant if the P-value was < 0.05. Statistical analyses were performed using JMP Pro software (version 16.0.0, SAS Institute Inc. Cary, NC).
Study approval
All the human samples were collected following the provision of written informed consent. The human sample study protocol and the consent procedure for the patients were approved by the Institutional Review Board of Hokkaido University Hospital, Sapporo, Japan (No. 018–0201). Animal experiments were approved by the Institutional Animal Care and Use Committee of the National University Corporation, Hokkaido University (No. 18–0141), and conducted according to the ethical guidelines of the National University Corporation Hokkaido University regarding animal experimentation and the safety guidelines for gene manipulation experiments.