Reagents and Cell Culture
Ginsenosides monomers (purity 98%) and total ginsenosides extract (TGS) were bought from Jilin University (Changchun, China). The composition of TGS has been tested experimentally [30]. Ginsenosides Rh2 and Rg3 were dissolved in DMSO at a series of concentrations. TGS was dissolved in RPMI 1640 medium and filtered through a 0.22 µm membrane, with a final concentration of 100 mg/ml. 3-methyladenine (3-MA,Cat.No.M9281), Chloroquine (CQ,Cat.No.C6628), DMSO (Cat.No.D4540), monodansylcadaverine (MDC,Cat.No.30432), and rapamycin (Rapa,Cat.No. 553210) were purchased from Sigma Aldrich (St Louis, MO); Lipofectamine 3000 (Cat.No.L300015), ATG7 siRNA (Cat.No.HSS116182), BECN siRNA (Cat.No. HSS112741) and control siRNA (medium GC,Cat.No.12935300) were purchased from Invitrogen Trading Shanghai Co. (Shanghai, China). Cell Counting Kit 8 (CCK-8, Cat.No. K009-500) was purchased from Zeta life (California, USA). RPMI 1640 medium (Cat.No.C11875500BT) was from GIBCO (California, USA). Fetal bovine serum (FBS,Cat.No.FCS 500) was purchased from ExCell Biotechnology Co., Ltd(Shanghai, China).BCA Protein Assay Kit (Cat.No.0012), Hoechst 33342 (Cat.No.C1022), Phenylmethanesulfonyl fluoride (PMSF, Cat.No. ST507-10ml), Phosphate buffered saline (PBS, Cat.No. ST448-1L), RIPA lysis buffer (Cat.No. P0013B),Triton X-100 (Cat.No.ST795) and other reagents were from Beyotime Biotechnology (Shanghai, China).
Human NSCLC A549 and PC-9 cell lines were bought from the American Type Culture Collection (ATCC) (Maryland, USA) and cultured in RPMI 1640 medium containing 10% FBS, 100 µg/ml streptomycin and 100 U/ml penicillin at 37°C with 5% CO2.
Cell Proliferation Assay
96 well plate was used to culture A549 and PC-9 cells, and when the density reaches 80%, cells were treated with ginsenosides Rh2, Rg3 and TGS with indicated concentrations for 24 or 48 h, cytotoxicity was tested using CCK-8 kit according to instruction. The absorbance at 450 nm was measured using a BioTek, Synegy H1 Hybrid Reader (Vermont, USA), cell inhibition rates are displayed as percentages compared to the control group.
Cell Morphological Observation
NSCLC cells with 80% confluence in 12-well plates were treated with ginsenoside Rh2, Rg3 and TGS for 12 h, cells were washed with PBS and observed using Leica DMI3000B fluorescence microscope (Bensheim, Germany) in the brightfield.
Western Blotting Analysis
A549 cells were treated with ginsenoside Rh2, Rg3 and TGS, and the total protein levels in cell lysates were measured using protein quantification kit. Boiled cell lysates contained 60 µg total protein were loaded to 8%-12% gradient polyacrylamide gels (Bis-Tris Midi Gel, Life Technologies, USA) and analyzed by western blotting with corresponding antibodies. The same blots were tested with GAPDH antibody to normalize protein load. Developing photos of protein blottings are adjusted and cut using Image Lab software.
The primary antibodies anti-ATF4 (Cat.No.11815), anti-ATG5 (Cat.No.12994T), anti-ATG7 (Cat.No.8558), anti-BECN (Cat.No.4122S), anti-Bip (Cat.No.3177), anti-CHOP (Cat.No.5554),anti-LC3B (Cat.No.2775), anti-PERK(5683T) antibodies and secondary antibodies (Cat.No.7076/7074) were purchased from Cell Signaling Technology (Danvers, MA, USA), anti-IRE1 antibody (Cat.No.ab124945) was purchased from Santa Cruz Biotechnology (Dallas, MA,USA) and anti-GAPDH antibody (Cat.No.AP0063), anti-p62 (Cat.No.AF5312) was purchased from Beyotime Biotechnology (Shanghai, China).
Immunofluorescence
0.17 mm glass-bottom dishes were used to culture A549 cells, and when the density reaches 80%, cells were treated with agents for the indicated times, then cells were fixed with 4% formaldehyde for 30 min at 4°C, permeabilized with PBS/T (PBS containing 0.1% Tween-20) for 20 min at room temperature, blocked with 5% w/v BSA in PBS/T for 1 h at 37°C and then incubated with LC3B antibody overnight at 4°C, after washed with PBS/T for 4 times, cells were incubated with fluorescent secondary antibody for 1 h and Hoechst 33342 for 0.5 h in the dark, then cells were washes and observed with a Leica TCS SP8 confocal fluorescence microscope (Bensheim, Germany).
MDC(Monodansylcadaverine)Staining
12-well plates were used to culture A549 cells, and when the density reaches 80%, cells were treated with ginsenosides Rh2 and Rg3 and other agents for 12 h, then cells were cultured with 50 µM MDC in PBS for 30 min at 37°C, after washed with PBS for 4 times, cells were observed with a Leica DMI3000B fluorescence microscope (Bensheim, Germany).
Transmission Electron Microscope Observation
A549 cells were treated with indicate agents for 12 h, then cells were fixed with 2.5% glutaraldehyde and 1% osmium tetroxide successively, and dehydrated with a range of concentrations of acetone, after penetrated and embedded, cells were sliced on ultramicrotome and electronic dyed with sodium acetate and lead citrate, finally, slices were observed with Hitachi HT7800 transmission electron microscope (Tokyo, Japan).
Gene Knockdown
All transfections were performed using Lipofectamine 3000 according to its instructions. Cells were transfected with ATG7 siRNA (15 and 30 nM), BECN siRNA (25 and 50 nM), or negative control (medium GC) at concentrations of 20 nM siRNA. The sequences of siRNA duplex for ATG7 siRNA and BECN siRNA are shown as Table 1.
Table 1
The sequences of siRNA duplex for ATG7 siRNA and BECN siRNA
Gene | sense strand | antisense strand |
ATG7 BECN | 5’-GGUUUGGACGAAUUCCAACUUGUUU-3’ 5’-CCACUCUGUGAGGAAUGCACAGAUA-3’ | 5’-AAACAAGUUGGAAUUCGUCCAAACC-3’ 5’-UAUCUGUGCAUUCCUCACAGAGUGG-3’ |
Quantitative Real Time PCR Assay
Total RNA in cells was extracted using RNAiso Plus reagent (TaKaRa Biotechnology Co., Ltd, Dalian, China) according to the manufacturer’s instructions. The concentrations of RNA were tested by measuring their absorbance at 260 and 320 nm. Complementary DNA was reverse transcribed from 500 ng total RNA using FastKing RT Kit (Tiangen Biochemical Technology (Beijing) Co., Ltd). Quantitative real time PCR analysis was performed using Super Real PreMix Plus (SYBR green) (Tiangen Biochemical Technology (Beijing) Co., Ltd) in a reaction volume of 15 µl on LightCycler 480 II RT-PCR system (Basel, Switzerland). The annealing was carried out at 60°C for 30 seconds. Relative gene expression analysis was calculated using the 2(−ΔΔCt) method with GAPDH as a control. Each experiment was carried out in duplicates. The primer sequences are shown in Table 2. (Forward 5’-3’, Reverse 5’-3’).
Table 2
Primer sequences for quantitative RT-PCR Assay
Gene | Forward Primer | Reverse Primer |
GAPDH ATF4 CHOP Bip | CCAGGGCTGCTTTTAACTC GAAGGTCATCTGGCATGGTT ACCAAGGGAGAACCAGGAAACG GCTATTGCTTATGGCCTGGA | GCTCCCCCCTGCAAATGA AGTCCCTCCAACAACAGCAA TCACCATTCGGTCAATCAGAGC CGCTGGTCAAAGTCTTCTCC |
BECN | GTCGCTGAAGACAGAGCGAT | CGATGCTCTTCACCTCGGG |
ATG 5 | TGGATGGGATTGCAAAATGACA | AGTAAGACCAGCCCAGTTGC |
ATG 7 | AGTGCCTTGGATGTTGGGTT | AGACAGAGGGCAGGATAGCA |
Metabolomic Analysis
Sample preparation: A549 cells were cultured in 6-well plates and treated with TGS, ginsenosides Rh2 and Rg3 for 12 h. Cells were collected with 200 µl methanol and 3 times freeze-thaw cycles in a refrigerator at – 80°C. After which samples were centrifuged at 15000 rpm for 10 min and take the supernatant. Take 10 µl from each sample to make quality control samples by mixing. Four times the volume of ice methanol extract (4°C) containing Internal Standard (berberine, 200 ng/mL) was added to precipitate protein in the sample, vortex for 1 min, 15000 rpm, and centrifuge at 4 ° C for 10 min. Take the supernatant and add 60 µl 90% (vol/vol) (methanol: water) to redissolved, vortex for 1 min, 15000 rpm, centrifugation at 4°C for 10 min, take the supernatant for injection.
Liquid chromatography-mass spectrometry analysis method: The chromatographic column used is Accucore HILIC column (100 x 2.1mm 2.6 µm). The aqueous phase (A) is an aqueous solution containing 5 mM ammonium formate, and the organic phase (B) is acetonitrile: methanol: water (90:5:5, v/v). The flow rate is 0.40 ml/min, and the column temperature is 40 ° C. The gradient elution method is used for chromatographic separation which was shown in Table 3, and the injection volume is 5 µl. Q Active Orbitrap uses ESI ion source, positive ion mode, full MS-dMS2 mode to collect data, and the m/z scanning range is set to 50–750 Da. The injection voltage of the ion source is + 3.5kV and − 2.5kV respectively, the capillary temperature is 350°C, the heater temperature is 300°C, the sheath gas flow rate is 35 arb, and the auxiliary gas flow rate is 10 arb. The resolutions of Full MS and MS2 are 35000 and 17500 (FWHM) respectively, and the NCE is set to 15 V, 30 V and 45 V.
Table 3
Gradient elution procedure
Time (min) | Mobile phase |
A (%) | B (%) |
0 | 15 | 85 |
1 | 15 | 85 |
4 | 35 | 65 |
4.5 | 35 | 65 |
4.51 | 15 | 85 |
6 | 15 | 85 |
The original data was processed by Compound Discover 3.1 (Thermofisher, USA), and the mass deviation was set to 5 ppm. The compounds were initially identified, the obtained chromatographic peaks were automatically integrated and manually checked, and the retention time, peak area ratio, substance name, molecular formula and molecular weight matched by the software were exported. Export the data to metabianalyst for multivariate statistical analysis, and analyze the pathway of different metabolites.
Statistical Analysis
Data were showed as mean ± standard deviation (SD). Prism 9.3 statistical software was used for the analysis. The two-tailed Student t-test was used to reveal statistical significance. P < 0.05 was considered statistically significant.
Authors’ Contributions
Qiu-fang Chen and Yue Qiu conducted most of the experiments and data analysis. Qiu-fang Chen completed data processing and article writing. Lin Wang conducted metabolomics experiment and analysis. Bi-Li Liu and Min Zhao conceived the idea and supervised the entire project, including manuscript preparation and revision. All authors read and approved the final manuscript. Qiu-fang Chen and Yue Qiu contributed equally to this work.