2.1. Bacterial Isolates
In a descriptive study, 90 isolates of P. aeruginosa were collected from June 2015 to April 2016at Teaching Hospitals of Shahid Sadoghi University of Medical Science, Yazd, Iran. These isolates were originated from different clinical specimens of hospitalized patients, including blood, burn wounds, urine, lungs, etc. The study was approved by Shahid Sadoghi University of Medical Science, Yazd, Iran and ethical code was IR.SSU.REC.1391.24.
2.2. Antimicrobial Susceptibility Testing
After transferring the plate containing Gram-negative rod colonies to the Laboratory of Microbiology, suspected colonies were identified by Gram staining and conventional biochemical tests such as catalase, oxidase, and growth in 42 °C, Oxidative/fermentative test, and differential media such as TSI (Merck, Germany). Isolate identified as P. aeruginosa were stored at 70°C in trypticase soy broth (Merck) supplemented with 20°C glycerol unit.
2.3. Minimum Inhibitory Concentration and Phenotypic Confirmatory Tests
Antibiotic susceptibility testing of the isolates was performed using the disk diffusion method (Kirby-Bauer) according to Clinical and Laboratory Standard Institute guideline (CLSI, 2014) using Mueller-Hinton agar (Merck, Germany) and Imipenem, meropenem, ertapenem, ciprofloxacin, ceftazidime, Cefepime, ceftriaxone, gentamicin, and tobramycin (MAST, UK). P. aeruginosa ATCC27853 was used as quality control. The Minimum Inhibitory Concentration (MIC) of imipenem was performed by E. test strips (Liofilchem, Italy) as described in the manufacturer's instructions. MIC breakpoint was defined according to CLSI guideline (CLSI, 2014).
2.4. DNA extraction
DNA extraction was performed using by salting out method and was stored at -20°C until further use (18).
2.5. PCR for detection of oprD gene
The occurrence of oprD gene was screened in all isolates by PCR. primers were developed for each gene using Primer 3. The primers used for DNA amplification, as follows: 5΄- AGACATGCCGTGGATACAAA -3΄ for the forward and 5΄- AGTGCTACCTGCGGAAACC -3΄for the reverse primers. The final optimized PCR reaction consisted of 0.5 μl MgCl2 (100 mM), 0.5 μl dNTP (10 mM), 0.2 µl (1 unit) Taq DNA polymerase (Cinnagen, Iran), 1 µl of each primer (10 pmol) (Alpha DNA, Canada), 2.5 µl PCR buffer (10 X), and 0.5 μl of DNA template (100 μg/ml) in a total volume of 25 μl with double distilled water. DNA amplification was carried out with a thermocycler (Quanta Biotech, England), PCR amplification was performed as follows: one cycle at 95 °C for 300 seconds, then 30 cycles at 95 °C for 45 Sec, 56 °C for 45 Sec, and 72 °C for 60 Sec and a final extension at 72 °C for 10 min using an initial denaturation step for 5 min at 94°C (one cycle), followed by 35 cycles of 1 min at 94°C, 1 min at 50°C and 1min at 72°C. The amplified products were analyzed by 1.5% (w/w) agarose gel electrophoresis and were visualized on an ultraviolet illumination after staining with ethidium bromide. A mutation in the promotor and upstream coding region of OprD gene (Table 4) was identified by DNA sequencing.
2.6. DNA sequencing and analyses of sequence data
According to imipenem MIC results, 29 isolates were selected randomly for evaluation of the mutations. For DNA sequencing, upstream regions and fifty four (54) primary nucleotide of oprD gene were sequenced. The sequences results were aligned and analyzed using MEGA 6 software and CLUSTAL W2, Vector NTI Advance version9. 0.0 software (InforMax; Invitrogen). Protein alignments were carried out using. ClustalW2 (http://www.ebi.ac.uk/Tools/msa/clustalw2/). In every case, both the nucleotide and the amino acid sequences were compared between the clinical isolates, the PAO1 reference (strain NC 002516.2 and gb AE004091.2)
2.7. Statistical analysis
The data were analyzed using the Statistical Program for Social Sciences version 18. (SPSS Version. 18 IBM, Chicago, IL, USA). For the analysis of data, chi-square tests were employed to calculate the P-value. Statistical significance and levels were set at P<0.05.