Ezetimibe suppresses the migration and invasion of triple-negative breast cancer cells by targeting TGFβ2 and EMT

doi:10.21203/rs.3.rs-3139502/v1

Download PDF

Article

Ezetimibe suppresses the migration and invasion of triple-negative breast cancer cells by targeting TGFβ2 and EMT

https://doi.org/10.21203/rs.3.rs-3139502/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

In recent years, the important role of cholesterol in tumor metastasis has been revealed. Ezetimibe is the only selective cholesterol uptake inhibitor currently on the market. Here, we aimed to explore the effect of ezetimibe on breast cancer metastasis. The effects of ezetimibe on breast cancer cell migration, invasion, and EMT were examined by wound healing assay, invasion assay, and western blotting assay. After ezetimibe treatment of breast cancer cells, differentially expressed genes were investigated by transcriptome sequencing and validated by western blotting assay and qRT-PCR. Breast cancer cells overexpressing TGFβ2 were constructed, and the effect of TGFβ2 on the migration and invasion of ezetimibe-treated breast cancer cells was examined by wound healing and invasion assays. The study showed that ezetimibe inhibited the migration, invasion, and EMT of breast cancer cells and significantly suppressed the expression of TGFβ2 in breast cancer cells. Enhanced TGFβ2 expression reversed the inhibitory effect of ezetimibe on the migration and invasion of breast cancer cells. This study demonstrates that ezetimibe is a potential drug for the treatment of breast cancer metastasis.

Biological sciences/Cancer

Biological sciences/Cancer/Breast cancer

Breast cancer

Metastasis

Cholesterol

Ezetimibe

TGFβ2.

Cancer ranks second in mortality among chronic noncommunicable diseases worldwide ¹. In 2020, breast cancer had the highest mortality rate among female malignancies ². Current common treatments for breast cancer include surgical resection, radiotherapy, and chemotherapy ^3–6. However, current chemotherapeutics for breast cancer often cause drug toxicity, such as gastrointestinal adverse effects and liver and kidney function damage, while killing tumor cells ⁷, which brings great difficulties for clinical treatment. Therefore, it is urgent to develop safe and effective drugs for breast cancer.

Tumor metastasis is one of the major causes of clinical treatment failure and recurrence in breast cancer ^8,9. Studies have shown that cholesterol can promote tumor metastasis ^10,11. Cholesterol, a key component of cell membranes, is closely related to tumor progression ^12–14. Various studies have shown that high cholesterol can promote the growth and metastasis of lung adenocarcinoma and breast cancer ^15–19. In addition, high cholesterol levels are associated with breast cancer recurrence ^8,20. These results suggest that cholesterol promotes the metastasis of breast cancer.

Currently, drugs that interfere with cholesterol metabolism through different mechanisms have been used in antitumor research ²¹. Statins, the most common class of drugs that intervene in cholesterol synthesis, act by inhibiting HMG CoA reductase, the rate-limiting enzyme of the mevalonate pathway ²². Statins affect cancer cell plasticity, increasing metastatic seeding but reducing tumor formation and metastatic growth ²³. Studies have shown that breast cancer patients using lipophilic statins have significantly reduced rates of recurrence ²⁴ and mortality ²⁵. These results illustrate that cholesterol-lowering drugs can inhibit not only breast cancer growth but also breast cancer metastasis.

Ezetimibe, the only selective cholesterol absorption inhibitor currently on the market, can block the exogenous absorption pathway of cholesterol ²⁶, and its cancer-suppressing effects have been reported. In vivo experiments demonstrated that ezetimibe inhibited tumor growth in prostate cancer-bearing mice fed a high-cholesterol diet by reducing angiogenesis ²⁷. Kristine Pelton et al. found that in the breast cancer model of SCID mice, ezetimibe can improve the tumor microenvironment of breast cancer by inhibiting angiogenesis, thereby inhibiting the development of tumors ²⁸. These studies demonstrated in different tumor models that ezetimibe inhibits tumor growth mainly by reducing angiogenesis. However, the effect of ezetimibe on tumor metastasis was not investigated.

As described earlier, cholesterol promotes breast cancer metastasis, and cholesterol-lowering drugs, such as statins, can inhibit breast cancer metastasis and recurrence. Therefore, we were curious whether ezetimibe, also a cholesterol-lowering drug, would have similar effects. In this study, we will observe whether ezetimibe can inhibit the migration and invasion of breast cancer cells and explore the possible mechanisms.

Cell Culture. MDA-MB-231 (human, female) cells were maintained in DMEM (WISENT, catalog # 319-005-CL) with 10% fetal bovine serum (FBS) (WISENT, catalog # 086150035) and penicillin (WISENT, catalog # 450-201-EL): streptomycin solution (Gibco, catalog # 15140163). 4T1 (mouse) cells were maintained in RPMI 1640 (WISENT, catalog # 350-000-CL) with 10% FBS and penicillin: streptomycin solution. All cells were cultured at 37°C in a humid incubator with 5% CO².

Preparation of ezetimibe. The preparation of ezetimibe used and working concentrations was as follows: ezetimibe (MedChemExpress, catalog #HY-17376) was added to the sterile tube and dissolved in DMSO before being stored at 4°C for long-term use.

Cytotoxicity assay. Cells were first treated with different concentrations of ezetimibe for 48 h. Then, 10 µL of CCK8 solution was added, and the cells were incubated for 1 h at 37°C. The absorbance of each well was measured at OD450 nm using a multiwell plate reader.

Wound Healing Assay. Wounding healing assays were performed in 24-well culture plates with the culture insert (Ibidi, catalog #80206). A total of 4×10⁴ cells were seeded in every culture insert for 24 h. After pulling out the insert, the cells were washed with PBS twice and cultivated with serum-free medium containing different concentrations of ezetimibe at 37°C. The cells were photographed in four random fields by microscopy every 24 h.

Transwell Assays. Transwell assays were performed in 24-well culture plates with a Transwell chamber (Millipore, catalog #PIHP01250), and the upper compartment of the chamber was precoated with Matrigel (Corning, catalog #354230). A total of 8×10⁴ cells were suspended in 300 µL serum-free medium and plated in the upper compartment when 1 mL medium with 10% FBS was added to the lower compartment, and then the cells were treated with different concentrations of ezetimibe. After the cells were allowed to invade at 37°C for 24 h, the Transwell membranes were fixed with 4% paraformaldehyde and stained with 0.1% crystal violet at room temperature for 1 h. Cells invading the membranes were calculated in four random fields under the microscope.

Lentivirus overexpression. Cells were inoculated overnight in 12-well plates at a density of 5×10⁴ cells per well until cell confluency was 30%. According to the complex of infection (MOI) of the cells, a purified high-titer lentiviral suspension (GENEChem) was prepared with the appropriate virus dilutions, and the cells were subsequently infected for 24 hours (MOI = 10 for the two cell lines utilized) with virus dilutions. After changing the culture medium, the cell lines stably overexpressing TGFβ2 were screened by adding 2 µM puromycin. The protein expression level of TGFβ2 was detected by Western blotting.

Quantitative RT-PCR. Cells were inoculated overnight in 12-well plates at a density of 2 × 105 cells per well and cultured for 48 h. Total RNA was extracted using TRIzol reagent (Life Technologies, 15596-018), and reverse transcription was performed using the Transcriptase cDNA Synthesis Kit (Vazyme, R323) according to the manufacturer's instructions. Real-time PCR analysis was performed in an Applied Biosystems 7500 Real-Time PCR System using ChamQ SYBR qPCR Master Mix (Vazyme, Q341) according to the manufacturer's instructions. The primers (F, TGTCCCTGCTGCACTTTTGTA, and R, GGTGCCATCAATACCTGCAAATC) were synthesized to detect TGFB2 mRNA expression by GenScript.

Western blotting analysis. Cells were lysed in NP40 buffer on ice, and protein was extracted. The concentration of total protein was measured by the BCA method. Equal amounts of harvested total proteins were loaded onto sodium dodecyl sulfate-polyacrylamide gel electrophoresis and electrotransferred onto polyvinylidene difluoride membranes. Then, the membranes were blocked at room temperature for 2 h and incubated with primary antibodies at 4°C overnight, followed by HRP-conjugated secondary antibodies at room temperature for 2 h. After washing three times in TBST, protein bands were observed using an ECL chemiluminescence system (Bio-Rad). Primary antibodies against N-Cadherin(CST, 13116, 1:1000), E-Cadherin(CST,3195, 1:1000), Vimentin (CST, 5741, 1:1000), Snail(CST,3879, 1:1000), GAPDH(Biogot technology, MB001, 1:1000), TGFβ2(Abcam, ab167655, 1:1000).

Statistical analysis. The statistics were analyzed by GraphPad Prism 8.0. The variations between the two groups were compared using the independent t-test, and a statistically significant difference was defined as P < 0.05.

Ezetimibe inhibits the migration of MDA-MB-231 and 4T1 cells.

To determine the safe concentration of ezetimibe on MDA-MB-231 and 4T1 cells and evaluate its effect on the migration and invasion of MDA-MB-231 and 4T1 cells, we tested the effect of ezetimibe on the viability of MDA-MB-231 and 4T1 cells through CCK8 experiments. The viability plots of MDA-MB-231 and 4T1 cells after treatment with different concentrations of ezetimibe for 48 hours are shown in (Fig. 1a).The IC₅₀ of ezetimibe on MDA-MB-231 and 4T1 cells for 48 hours was 45.71 µM and 34.67 µM, respectively. When the concentration of ezetimibe was 10 µM for 48 hours of treatment, the cell viability of MDA-MB-231 and 4T1 cells was 88.17% and 85.99%, respectively. When the concentration of ezetimibe was 20 µM for 48 hours of treatment, the viability of MDA-MB-231 and 4T1 cells was 81.83% and 76.83%, respectively. Therefore, 10 µM and 20 µM ezetimibe had little effect on the viability of MDA-MB-231 and 4T1 cells. These two concentrations were selected to study the effect of ezetimibe on the migration and invasion of MDA-MB-231 and 4T1 cells. Then, the wound healing assay was used to assess the effect of ezetimibe on the migration of MDA-MB-231 and 4T1 cells, and we found that treatment with 10 µM and 20 µM ezetimibe on MDA-MB-231 and 4T1 cells for 24 h resulted in a significant decrease in the healing rate compared with the untreated group, and the cell healing rate showed a dose-dependent manner (Fig. 1b). The results indicated that ezetimibe could inhibit the migration ability of triple-negative breast cancer cells.

Ezetimibe inhibits the invasion of MDA-MB-231 and 4T1 cells.

After observing that ezetimibe could inhibit the migration of MDA-MB-231 and 4T1 cells, we further explored the effect of ezetimibe on the invasion of MDA-MB-231 and 4T1 cells. We evaluated the effect of ezetimibe on the invasion of MDA-MB-231 and 4T1 cells using transwell invasion assays. As shown in Fig. 2, the numbers of MDA-MB-231 and 4T1 cells treated with ezetimibe for 24 h that passed through the Matrigel were significantly fewer than those of untreated cells in a dose-dependent manner. The results illustrate that the invasive ability of MDA-MB-231 and 4T1 cells treated with ezetimibe was significantly reduced compared to that of untreated cells, and ezetimibe inhibited the invasion of triple-negative breast cancer cells.

Ezetimibe inhibits EMT in MDA-MB-231 and 4T1 cells.

We found that ezetimibe can inhibit the migration and invasion abilities of MDA-MB-231 and 4T1 cells, and epithelial-mesenchymal transition (EMT) plays an important role in the occurrence of invasion and subsequent metastasis of tumor cells. Therefore, we examined whether ezetimibe affects EMT in MDA-MB-231 and 4T1 cells. We first observed the cell morphology of ezetimibe-treated MDA-MB-231 and 4T1 cells after 24 hours by microscopy, as shown in (Fig. 3a). The ezetimibe-treated cells exhibited a cobblestone-like shape as opposed to the spindle-shaped DMSO-treated control cells, with a low infiltrative and migratory competent phenotype, indicating that ezetimibe slows the morphological transition of triple-negative breast cancer cells toward EMT. We detected the expression of EMT-related markers by Western blot assay in MDA-MB-231 and 4T1 cells. As shown in (Fig. 3b and Fig S2), compared with untreated cells, the levels of the mesenchymal markers N-cadherin, vimentin, and snail protein were significantly downregulated, while the expression of the epithelial marker E-cadherin was significantly increased in the ezetimibe-treated group. These results indicate that MDA-MB-231 and 4T1 cells treated with ezetimibe display lower levels of EMT and that ezetimibe can significantly inhibit EMT in triple-negative breast cancer cells, thereby affecting the migration and invasion abilities of triple-negative breast cancer cells.

Ezetimibe inhibits TGFβ in triple-negative breast cancer cells.

We have shown that ezetimibe can inhibit the migration and invasion abilities as well as EMT of triple-negative breast cancer cells, and to define the mechanism of ezetimibe's effect, we used transcriptome sequencing to compare the differential gene expression profiles between ezetimibe-treated and untreated MDA-MB-231 cells, and the gene expression profiles by transcriptome sequencing are shown in Table S1 and Fig S1. We screened 146 differentially expressed genes based on the fold change values and p values less than 0.05. Of these, 44 genes had a difference multiple of more than 2 times, and 102 genes had a difference multiple of less than 0.5. The differential gene cluster analysis plot and volcano plot of transcriptome sequencing is shown in( Fig. 4a, 4b, and Table S2). Based on the fold change values of upregulated gene ploidy greater than 2 and downregulated gene ploidy less than 0.52, we identified 6 upregulated genes and 14 downregulated genes in ezetimibe-treated cells with FPKM more significant than 1 and p values less than 0.05. We then further subjected these differentially expressed genes to pathway enrichment analysis.

The Gene Ontology analysis results are shown in (Fig. 4c and 4d), and according to the enrichment degree q value of the pathway, the upregulated gene is mainly related to the process of toxin metabolism (Fig. 4c), which may be a normal metabolic process after the treatment of cells with the cholesterol-lowering drug ezetimibe. This study focused on tumor migration and invasion; therefore, the downregulated genes were explored. Based on the enrichment degree q value of the pathway, the downregulated genes were related to cell morphology pathways, which are related to breast cancer cell migration, invasion, and EMT that we previously studied. We then filtered out two downregulated genes associated with cell morphology: il7r (interleukin 7 receptor) and tgfb2 (transforming growth factor beta 2) (Fig. 4d). Since il7r is associated with inflammation and immunity ²⁹, by reviewing the literature to analyze the correlation between each downregulated gene and tumor migration and invasion and considering the ranking of the fold change of genes, we found that TGFβ2 in downregulated genes is closely related to the metastasis of tumors. TGFβ2, as a member of the TGFβ family, plays a critical role in the EMT of cells ^30–32. Multiple studies have demonstrated that increased expression of TGFβ2 promotes breast cancer metastasis ^33,34. Notably, recent studies have noted that a high-cholesterol diet significantly induces TGFβ expression in the livers of mice ^35,36. These results guide us to further probe the relationship between ezetimibe and TGFβ in breast cancer cells. We validated the effect of ezetimibe on TGFβ2 mRNA by qRT-PCR, which showed a significant decrease in TGFβ2 mRNA in MDA-MB-231 and 4T1 cells treated with ezetimibe compared to untreated cells (Fig. 4e). We next tested the effect of ezetimibe on TGFβ2 protein expression by Western blot assay. The expression levels of TGFβ in MDA-MB-231 and 4T1 cells treated with ezetimibe were significantly decreased compared with those in untreated cells (Fig. 4f and Fig S3). These results demonstrate that the mRNA and protein expression levels of TGFβ were significantly decreased in MDA-MB-231 and 4T1 cells treated with ezetimibe.

Overexpression of TGFβ2 reverses the inhibitory effect of ezetimibe on the migration and invasion of MDA-MB-231 and 4T1 cells.

Sequencing results and validation experiments implicated the role of TGFβ2 in the ezetimibe-mediated inhibition of migration and invasion in triple-negative breast cancer cells. Given that previous studies have shown that increased TGFβ2 expression promotes breast cancer metastasis, we hypothesized that ezetimibe inhibits the migration and invasion of triple-negative breast cancer cells through TGFβ2.

First, we used lentiviral transfection to achieve TGFβ2 overexpression in MDA-MB-231 and 4T1 cells and verified it by real-time PCR and Western blot experiments. As shown in (Fig. 5a and Fig S4), TGFβ2-overexpressing MDA-MB-231 and 4T1 cells were constructed successfully. We next treated TGFβ-overexpressing MDA-MB-231 and 4T1 cells and control cells with ezetimibe. The migration ability of the cells was assessed by a scratch assay, and the healing rate of cells overexpressing TGFβ2 was significantly higher than that of control cells (Fig. 5b), illustrating that overexpression of TGFβ2 in triple-negative breast cancer cells resisted the inhibitory effect of ezetimibe on cell migration.

Similarly, we treated TGFβ2-overexpressing MDA-MB-231 and 4T1 cells and control group cells with ezetimibe, and then the invasive ability of the cells was assessed by Transwell invasion assay. We found that the number of TGFβ2-overexpressing MDA-MB-231 and 4T1 cells crossing the Matrigel was significantly higher than that of control cells (Fig. 5c), indicating that TGFβ overexpression significantly attenuated the inhibitory effect of ezetimibe on the invasion of triple-negative breast cancer cells. Overall, we demonstrated that overexpression of TGFβ2 can reverse the inhibitory effect of ezetimibe on the migration and invasion of triple-negative breast cancer cells. Thus, ezetimibe's ability to inhibit the migration and invasion of triple-negative breast cancer occurs through TGFβ2.

Tumor metastasis is a significant cause of clinical therapy failure and cancer recurrence, especially in breast cancer ^8,9. Multiple studies have demonstrated a positive association between high cholesterol levels and the risk of developing breast cancer ^11,37,38. Targeting cholesterol metabolism may be an effective way to inhibit cancer progression ²¹. For instance, ezetimibe, a drug that stops cholesterol absorption, has been found to inhibit the growth of prostate, breast, and liver cancers by inhibiting angiogenesis ^27,28,39. Our study showed that ezetimibe effectively inhibited triple-negative breast cancer cell migration, invasion, and EMT. Additionally, we discovered that ezetimibe significantly decreased TGFβ2 mRNA and protein levels. This finding implies that TGFβ2 may be a crucial factor in preventing breast cancer metastasis by ezetimibe. We further observed that overexpressing TGFβ2 in triple-negative breast cancer cells counteracted the inhibitory effects of ezetimibe on tumor cell invasion and metastasis. Our results suggest that TGFβ2 plays a critical role in metastasis and that ezetimibe prevents the metastasis of triple-negative breast cancer by suppressing the expression of TGFβ2.

Regarding the effect of ezetimibe on negative breast cancer cells, Kristine Pelton et al. ²⁸ found that inhibiting angiogenesis in triple-negative breast cancer with ezetimibe could block the promotion of tumor metastasis caused by a high cholesterol diet. This implies that high cholesterol concentrations are closely related to tumor vascularization and that cholesterol-lowering drugs could help prevent tumor metastasis by inhibiting tumor vascularization. However, our study discovered a novel mechanism for inhibiting tumor metastasis with ezetimibe: inhibiting the migration and invasion of triple-negative breast cancer cells by suppressing TGFβ2 expression. These findings suggest that ezetimibe might inhibit tumor metastasis independently of its cholesterol-lowering function.

In recent years, there has been some progress in the study of drugs targeting cholesterol metabolism in breast cancer metastasis ²¹. Colin H. Beckwitt et al. ⁴⁰ found that atorvastatin at a concentration of 20 µM inhibited migration by significantly inhibiting mesenchymal breast cancer cell proliferation. While the drug used in our study was ezetimibe, which directly inhibits cholesterol absorption, and ezetimibe did not affect breast cancer cell survival, the results indicated that ezetimibe inhibits the cholesterol absorption pathway of tumor cells and can directly inhibit EMT, migration, and invasion abilities of breast cancer cells. We speculate that breast cancer cell migration and invasion may be more dependent on exogenous cholesterol uptake and that directly inhibiting this pathway might play a more significant role in inhibiting these abilities.

In addition to statins, which inhibit cholesterol synthesis, and ezetimibe, which inhibits cholesterol absorption, inhibition of exogenous lipid uptake by inhibiting proprotein convertase subtilisin/kexin type-9 (PCSK9) is also a common strategy to lower cholesterol ⁴¹. Studies have demonstrated that overexpression of PCSK9 inhibited EMT in colorectal cancer cells to promote tumor metastasis ⁴². The ezetimibe used in this study can bind with high efficiency to the cholesterol carrier protein NPC1L1 and lower cholesterol in the blood by inhibiting the uptake of exogenous cholesterol. The results illustrate that inhibition of cholesterol synthesis or absorption pathways can effectively inhibit tumor metastasis.

Numerous studies have indicated that TGFβ2 facilitates breast cancer metastasis by promoting EMT and lipid storage in tumor cells ^33,34,43. To investigate how ezetimibe can impede TGFβ2 expression in breast cancer cells, we conducted RNA SEQ experiments on drug-treated cells. Our results showed that ezetimibe inhibits TGFβ2 expression in triple-negative breast cancer cells. Previous studies have established that agents inhibiting the TGFβ2 pathway can impede tumor metastasis ^44–46. For instance, ITD-1, a drug that suppresses TGFβ2, prevents Smad2/3 phosphorylation, thereby inhibiting glioma cell and gastric cancer cell invasion ^44,45. Similarly, our data revealed that ezetimibe restrains breast cancer cell migration and invasion, conceivably by targeting TGFβ2 and its downstream target Smad2/3, warranting further exploration.

Another mechanism by which TGFβ2 triggers tumor metastasis is by promoting angiogenesis ⁴⁷. Studies have found that inhibitors of TGFβ2, such as Trabedersen, can obstruct TGFβ2's interaction with angiogenesis-promoting factors to halt pancreatic tumor growth and angiogenesis ⁴⁶. Moreover, Kristine Pelton et al. demonstrated that ezetimibe stabilizes the vascular structure in a breast cancer mouse model by increasing pericyte coverage on vessels, thereby inhibiting angiogenesis and consolidating the tumor vasculature²⁸. These observations led us to hypothesize that ezetimibe restrains breast cancer cell migration and invasion by nullifying the angiogenic consequences of TGFβ2 and increasing perivascular cell coverage by trimming cholesterol absorption levels. Our findings about the novel potential effects of ezetimibe on tumor angiogenesis warrant further study.

In conclusion, this study demonstrates that ezetimibe inhibits breast cancer cell migration, invasion, and EMT and identifies TGFβ2's key role in this process. For the first time, this study reveals the effects of ezetimibe on tumor cell migration and invasion, and the underlying mechanism is the inhibition of TGFβ and EMT in cancer cells. This study provides new evidence for the regulation of cholesterol metabolism in tumor cells, which can inhibit their migration and invasion. Additionally, it presents new evidence for the use of drugs that regulate cholesterol metabolism to control the metastasis and recurrence of tumors. Furthermore, this study offers a basis for the clinical translation of ezetimibe for the treatment of breast cancer metastasis and recurrence.

Data availability

All data generated or analysed during this study are included in this published article.

Acknowledgements

This work was supported by the National Natural Science Foundation of China (82272819,81972888); the Research Project of Jinan Microecological Biomedicine Shandong Laboratory (JNL202219B, JNL202204A); the Primary Research & Development Plan of Jiangsu Province (BE2022840); the Open Project of Chinese Materia Medica First-Class Discipline of Nanjing University of Chinese Medicine (2020YLXK007); and the Shandong Provincial Laboratory Project (SYS202202).

Author contributions

J.W.: Conceptualization (lead); Writing-review and editing (equal). C.J.: Conceptualization (supporting); Writing-review and editing (equal). Q.H.: Investigation-performing the experiments (lead); Writing-original draft (lead). D.M.: Investigation-performing the experiments (supporting). L.K.: Writing-original draft (supporting). W.S.: Visualization-data presentation (equal). Q.X.: Investigation-performing the experiments (supporting). All authors agree to be accountable for all aspects of work ensuring integrity and accuracy.

Competing interests

The authors declare no competing interests.

Correspondence and requests for materials should be addressed to J.W.

Reprints and permissions information is available at www.nature.com/reprints. Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

The online version contains supplementary material

Cortes, J. et al. Enhancing global access to cancer medicines. CA Cancer J Clin 70, 105–124, doi:10.3322/caac.21597 (2020).
Siegel, R. L., Miller, K. D. & Jemal, A. Cancer statistics, 2020. CA Cancer J Clin 70, 7–30, doi:10.3322/caac.21590 (2020).
Hiller, J. G., Perry, N. J., Poulogiannis, G., Riedel, B. & Sloan, E. K. Perioperative events influence cancer recurrence risk after surgery. Nat Rev Clin Oncol 15, 205–218, doi:10.1038/nrclinonc.2017.194 (2018).
Wilson, W. R. & Hay, M. P. Targeting hypoxia in cancer therapy. Nat Rev Cancer 11, 393–410, doi:10.1038/nrc3064 (2011).
Couzin-Frankel, J. Breakthrough of the year 2013. Cancer immunotherapy. Science (New York, NY) 342, 1432–1433 (2013).
Horsman, M. R., Mortensen, L. S., Petersen, J. B., Busk, M. & Overgaard, J. Imaging hypoxia to improve radiotherapy outcome. Nat Rev Clin Oncol 9, 674–687, doi:10.1038/nrclinonc.2012.171 (2012).
Kennedy, L. B. & Salama, A. K. S. A review of cancer immunotherapy toxicity. CA Cancer J Clin 70, 86–104, doi:10.3322/caac.21596 (2020).
Early Breast Cancer Trialists' Collaborative, G. Effects of chemotherapy and hormonal therapy for early breast cancer on recurrence and 15-year survival: an overview of the randomised trials. Lancet 365, 1687–1717, doi:10.1016/S0140-6736(05)66544-0 (2005).
Weigelt, B., Peterse, J. L. & van 't Veer, L. J. Breast cancer metastasis: markers and models. Nat Rev Cancer 5, 591–602, doi:10.1038/nrc1670 (2005).
Ma, L. et al. 27-Hydroxycholesterol acts on myeloid immune cells to induce T cell dysfunction, promoting breast cancer progression. Cancer Lett 493, 266–283, doi:10.1016/j.canlet.2020.08.020 (2020).
Llaverias, G. et al. Role of cholesterol in the development and progression of breast cancer. Am J Pathol 178, 402–412, doi:10.1016/j.ajpath.2010.11.005 (2011).
Garcia-Bermudez, J. et al. Squalene accumulation in cholesterol auxotrophic lymphomas prevents oxidative cell death. Nature 567, 118–122, doi:10.1038/s41586-019-0945-5 (2019).
Mullen, P. J., Yu, R., Longo, J., Archer, M. C. & Penn, L. Z. The interplay between cell signalling and the mevalonate pathway in cancer. Nat Rev Cancer 16, 718–731, doi:10.1038/nrc.2016.76 (2016).
Freed-Pastor, W. A. et al. Mutant p53 disrupts mammary tissue architecture via the mevalonate pathway. Cell 148, 244–258, doi:10.1016/j.cell.2011.12.017 (2012).
Zhang, T. et al. AIBP and APOA-I synergistically inhibit intestinal tumor growth and metastasis by promoting cholesterol efflux. J Transl Med 17, 161, doi:10.1186/s12967-019-1910-7 (2019).
Liu, W. et al. Dysregulated cholesterol homeostasis results in resistance to ferroptosis increasing tumorigenicity and metastasis in cancer. Nat Commun 12, 5103, doi:10.1038/s41467-021-25354-4 (2021).
Nelson, E. R. et al. 27-Hydroxycholesterol links hypercholesterolemia and breast cancer pathophysiology. Science 342, 1094–1098, doi:10.1126/science.1241908 (2013).
Qin, Y. et al. A Novel Long Non-Coding RNA lnc030 Maintains Breast Cancer Stem Cell Stemness by Stabilizing SQLE mRNA and Increasing Cholesterol Synthesis. Adv Sci (Weinh) 8, 2002232, doi:10.1002/advs.202002232 (2021).
Tatsuguchi, T. et al. Pharmacological intervention of cholesterol sulfate-mediated T cell exclusion promotes antitumor immunity. Biochem Biophys Res Commun 609, 183–188, doi:10.1016/j.bbrc.2022.04.035 (2022).
Sim, Y. et al. The Impact of Statin Use and Breast Cancer Recurrence - A Retrospective Study in Singapore. Front Oncol 12, 835320, doi:10.3389/fonc.2022.835320 (2022).
Meng, Y., Wang, Q. & Lyu, Z. Cholesterol metabolism and tumor. Zhejiang Da Xue Xue Bao Yi Xue Ban 50, 23–31, doi:10.3724/zdxbyxb-2021-0033 (2021).
Menter, D. G. et al. Differential effects of pravastatin and simvastatin on the growth of tumor cells from different organ sites. PLoS One 6, e28813, doi:10.1371/journal.pone.0028813 (2011).
Madeleine Dorsch et al. Statins affect cancer cell plasticity with distinct consequences for tumor progression and metastasis. Cell Reports 37, 110056, doi:10 (2021).
Ahern, T. P. et al. Statin prescriptions and breast cancer recurrence risk: a Danish nationwide prospective cohort study. J Natl Cancer Inst 103, 1461–1468, doi:10.1093/jnci/djr291 (2011).
Liu, B., Yi, Z., Guan, X., Zeng, Y. X. & Ma, F. The relationship between statins and breast cancer prognosis varies by statin type and exposure time: a meta-analysis. Breast Cancer Res Treat 164, 1–11, doi:10.1007/s10549-017-4246-0 (2017).
Patricia A. Detmers et al. A target for cholesterol absorption inhibitors. Biochimica et Biophysica Acta 1486, 243–252 (2000).
Solomon, K. R. et al. Ezetimibe is an inhibitor of tumor angiogenesis. Am J Pathol 174, 1017–1026, doi:10.2353/ajpath.2009.080551 (2009).
Pelton, K. et al. Hypercholesterolemia induces angiogenesis and accelerates growth of breast tumors in vivo. Am J Pathol 184, 2099–2110, doi:10.1016/j.ajpath.2014.03.006 (2014).
Yasunaga, M. Antibody therapeutics and immunoregulation in cancer and autoimmune disease. Semin Cancer Biol 64, 1–12, doi:10.1016/j.semcancer.2019.06.001 (2020).
Trelford, C. B., Dagnino, L. & Di Guglielmo, G. M. Transforming growth factor-beta in tumour development. Front Mol Biosci 9, 991612, doi:10.3389/fmolb.2022.991612 (2022).
Ikushima, H. & Miyazono, K. TGFbeta signalling: a complex web in cancer progression. Nat Rev Cancer 10, 415–424, doi:10.1038/nrc2853 (2010).
Hao, Y., Baker, D. & Ten Dijke, P. TGF-beta-Mediated Epithelial-Mesenchymal Transition and Cancer Metastasis. Int J Mol Sci 20, doi:10.3390/ijms20112767 (2019).
Beisner, J. et al. A novel functional polymorphism in the transforming growth factor-beta2 gene promoter and tumor progression in breast cancer. Cancer Res 66, 7554–7561, doi:10.1158/0008-5472.CAN-06-0634 (2006).
Zhou, C. et al. TGFB2-AS1 inhibits triple-negative breast cancer progression via interaction with SMARCA4 and regulating its targets TGFB2 and SOX2. Proc Natl Acad Sci U S A 119, e2117988119, doi:10.1073/pnas.2117988119 (2022).
Pruis, M. G. et al. Maternal western diet primes non-alcoholic fatty liver disease in adult mouse offspring. Acta Physiol (Oxf) 210, 215–227, doi:10.1111/apha.12197 (2014).
Pan, X., Zhang, Y., Kim, H. G., Liangpunsakul, S. & Dong, X. C. FOXO transcription factors protect against the diet-induced fatty liver disease. Sci Rep 7, 44597, doi:10.1038/srep44597 (2017).
Bahl, M. et al. Serum lipids and outcome of early-stage breast cancer: results of a prospective cohort study. Breast Cancer Res Treat 94, 135–144, doi:10.1007/s10549-005-6654-9 (2005).
Baek, A. E. & Nelson, E. R. The Contribution of Cholesterol and Its Metabolites to the Pathophysiology of Breast Cancer. Horm Cancer 7, 219–228, doi:10.1007/s12672-016-0262-5 (2016).
Miura, K. et al. Ezetimibe suppresses development of liver tumors by inhibiting angiogenesis in mice fed a high-fat diet. Cancer Sci 110, 771–783, doi:10.1111/cas.13902 (2019).
Beckwitt, C. H. et al. Statins attenuate outgrowth of breast cancer metastases. Br J Cancer 119, 1094–1105, doi:10.1038/s41416-018-0267-7 (2018).
Joseph, L. & Robinson, J. G. Proprotein Convertase Subtilisin/Kexin Type 9 (PCSK9) Inhibition and the Future of Lipid Lowering Therapy. Prog Cardiovasc Dis 58, 19–31, doi:10.1016/j.pcad.2015.04.004 (2015).
Wang, L., Li, S., Luo, H., Lu, Q. & Yu, S. PCSK9 promotes the progression and metastasis of colon cancer cells through regulation of EMT and PI3K/AKT signaling in tumor cells and phenotypic polarization of macrophages. J Exp Clin Cancer Res 41, 303, doi:10.1186/s13046-022-02477-0 (2022).
Corbet, C. et al. TGFbeta2-induced formation of lipid droplets supports acidosis-driven EMT and the metastatic spreading of cancer cells. Nat Commun 11, 454, doi:10.1038/s41467-019-14262-3 (2020).
Yan, T. et al. TGF-beta induces GBM mesenchymal transition through upregulation of CLDN4 and nuclear translocation to activate TNF-alpha/NF-kappaB signal pathway. Cell Death Dis 13, 339, doi:10.1038/s41419-022-04788-8 (2022).
Song, C. & Zhou, C. HOXA10 mediates epithelial-mesenchymal transition to promote gastric cancer metastasis partly via modulation of TGFB2/Smad/METTL3 signaling axis. J Exp Clin Cancer Res 40, 62, doi:10.1186/s13046-021-01859-0 (2021).
Takai K, Le A, Weaver VM & Z., W. Targeting the cancer-associated fibroblasts as a treatment in triple-negative breast cancer. Oncotarget 7, 82889–82901 (2016).
Schlingensiepen, K. H. et al. Transforming growth factor-beta 2 gene silencing with trabedersen (AP 12009) in pancreatic cancer. Cancer Sci 102, 1193–1200, doi:10.1111/j.1349-7006.2011.01917.x (2011).

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Ezetimibe suppresses the migration and invasion of triple-negative breast cancer cells by targeting TGFβ2 and EMT

Status:

Version 1

Abstract

Figures

Introduction

Materials and Methods

Results

Discussion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1