2.1.Chemicals
Antibodies used were rabbit TFAM polyclonal antibody (USA, Abcam), rabbit NF-κB p65 polyclonal antibody (CST, USA), rabbit Phospho-NF-κB p65 monoclonal antibody (CST, USA), rabbit COXII. Polyclonal antibody (USA, Abcam), rabbit β-Actin monoclonal antibody (China, Hangzhou Xianzhi Biotechnology Co., Ltd.), HRP-labeled sheep anti-rabbit IgG antibody (China, Biyuntian Biotechnology Co., Ltd.).
The following reagents were used: Paraformaldehyde (China, Sinopharm Chemical Reagent Co., Ltd.), 50% glutaraldehyde (China, Beijing Chemical Reagent Company), Hematoxylin (China, Beijing Chemical Reagent Company), RNAstore Sample Preservation Solution (China, Tiangen Biochemical Technology Co., Ltd.), DMEM High Sugar Medium (Wisent, Canada),Fetal bovine serum (FBS) (Gibco, USA), Penicillin-streptomycin solution (China, Biyuntian Biotechnology Co., Ltd.),0.25% trypsin (China, Biyuntian Biotechnology Co., Ltd.), Dimethyl sulfoxide (DMSO) (China, Sinopharm Chemical Reagent Co., Ltd.), Isopropyl alcohol (China, Sinopharm Chemical Reagent Co., Ltd.),Sodium chloride (NaCl) (China, Sinopharm Chemical Reagent Co., Ltd.), Potassium chloride (KCl) (China, Sinopharm Chemical Reagent Co., Ltd.),Disodium hydrogen phosphate (Na2HPO4·12H2O) (China, Sinopharm Chemical Reagent Co., Ltd.), Potassium dihydrogen phosphate (KH2PO4) (China, Sinopharm Chemical Reagent Co., Ltd.), Agarose (Spain, Biowest).
2.2. Animal treatment and pulmonary toxicity assessments
Twenty 8-week-old female Balb/c mice weighing 18–22 g were purchased from Shanghai Slack Laboratory Animal Co., Ltd. (license number SCXK (Shanghai) 2012-0002).
Mice were randomly divided into control group and 3 radon-exposed groups with 5 mice in each group. Mice were exposed to HD-3 multifunctional ecological radon chamber as a whole, and the concentration in radon chamber was 100000Bq/m3 controlled by computer. The cumulative exposure dose was 30, 60 and 120WLM, respectively. Control mice are housed at environmental background levels.
Within 1 h after the end of the infection, the mice were sacrificed by cervical dislocation, the left lobe lung tissue, 4% paraformaldehyde fixation, HE and immunohistochemical staining, and the pathological changes of lung tissue and TFAM and NF-κB p65 were observed under light microscopy. The rest of the lung tissue was divided into two parts, one of which was put into a cryopreservation tube and immediately put into liquid nitrogen, and then moved to -80°C for protein extraction; The other part is placed in a 1.5 mL EP tube and added to the Trizol for total RNA extraction.
2.3. ATP content detection
20 mg of lung tissue has been weighed and ground, 100 µL of lysate has been added to each sample to lyse the tissue, centrifuge at 4ºC 12,000 g for 5 min, and supernatant has been taken and detected with ATP detection kit (China, Biyuntian Biotechnology Co., Ltd.).
2.4. Histological and immunohistochemical staining
Paraffin sections were dewaxed and hydrated with fractional alcohol. Hematoxylin staining was performed for 10 min and eosin staining for 2 min. After the gradient alcohol was dehydrated, transparent and sealed, the pathological condition of the specimen was observed by pathological microscopy (Germany, Leika). For immunohistochemical staining, sections were deparaffinized, antigen retrieved, blocked, and incubated with rabbit TFAM polyclonal antibody, rabbit Phospho-NF-κB p65 and rabbit β-Actin primary antibodies and related biotinylated secondary antibodies. Finally, the sections were stained with DAB and counterstained with hematoxylin.
2.5. Cell culture and treatment
Human immortalized human bronchial epithelial cells were provided by ATCC. HBE was in DMEM high-sugar medium containing 10% fetal bovine serum (FBS), penicillin-streptomycin 100 U/mL, and 4.5 g/L glucose. Cells were cultured in a 5% CO2, 37°C incubator at constant temperature. Changed the fluid every other day and pass through every 3 days.
HBE cells were inoculated in Transwell membrane dishes at an amount of 1×105/mL per well, add 1.5mL of medium per dish. After the cells were attached, Transwell dish was placed in the cell gas contamination device. Radon gas above the membrane was continuously pumped in, directly contaminating the cells, and the cells are kept moist by the medium below the membrane. The oxygen concentration was 21%, the flow rate was 10mL/min, the infection time was 30min, and the exposure radon concentration was 30000Bq/m3. Infected 1 time as the first generation of infection (recorded as HR-1). Routinely culture cells were collected for next-generation infection. Until the 5th and 10th passages, namely HR-5 and HR-10, cells are collected for testing(Wu et al. 2019).
2.6. Cell cycle analysis
After treated as designed, HBE cells were fixed in ice-cold 70% ethanol overnight. Then cells are then stained with PI (USA, Invitrogen) for 30 min. Analyses were performed on the FC500 flow cytometer (Beckman Coulter, USA). Data analysis was conducted using Modifit 2.0 software.
2.7. Clone formation experiment
The effect of radon infection on HBE cells was detected by clonal formation experiments. Seeded HBE cells in six-well plates (400 per well, 3 parallels) and gently rotated to disperse the cells evenly; Terminated the culture when a visually visible clone appears in the dish. Discarded the supernatant and carefully soak 2 times with PBS. Add methanol or 1:3 acetic acid/methanol 5mL, fixed for 30 minutes, and then added an appropriate amount of Giemsa staining solution for 30 minutes.
Turned the dish upside down and superimposed a gridded transparencies to count clones greater than 50 cells under a microscope (low magnification).
2.8. Flow cytometry to detect intracellular ROS and MMP
After digestion and treatment of the cells, added ROS fluorescent probe or JC-1 fluorescent probe with a final concentration of 10 µM or 0.3 mL of JC-1 fluorescent probe, set up a staining negative tube (cells suspended in 0.3 mL PBS), mixed into a single-cell suspension, and incubated at 37°C for 30 min.
The cells were resuspended with 0.2mL PBS and transferred to the flow cytometer, and the fluorescence intensity in the cells was measured by flow cytometry: the instrument parameters were adjusted by staining negative tubes, the DCFH-DA probe detected ROS, the excitation wavelength was set to 488nm, and the DCF fluorescence intensity was detected by the fluorescence channel; The JC-1 detected MMP with an excitation wavelength of 488nm, and applied forward-scattered light (FSC) and side-scattered light (SSC), and compared FL2/FL3 mitochondrial membrane potential levels in FL1, FL2 and FL3 channels. Count 10,000 cells per tube and set up 3 parallel samples per group.
The results were analyzed using CXP software.2.11.
2.9. Real-time PCR measures gene expression
TRIzol method extracted total RNA from lung tissue, and cDNA was prepared with reverse transcription kit (Thermo, USA).
The RT-PCR primer sequences are as follows:
GAPDH F: CGTTCGCATCAATCGCAACC
R: GATGTGGAGTAGGTGAGGTC
COXⅡ F: GGGAAGCCTT CTCCAACC
R: GAACCCAGGTCCTCGCTT
NF-κB p65(Rela) F: ACTGCCGGGATGGCTACTAT
R: TCTGGATTCGCTGGCTAATGG
TFAM F: GGAATGTGGAGCGTGCTAAAA
R: TGCTGGAAAAACACTTCGGAATA
Real-time PCR (RT-PCR) uses a 20 µL system:
2×Real-time PCR Master Mix(SYBR) 10µl
Upstream primers(5µM) 1.5µl
Downstream primers(5µM) 1.5µl
cDNA(500ng/µl) 2 µl
Sterilized H2O To 20µl
The reaction solution was added to the 96-well PCR plate, each sample was equipped with replicate wells, and sealed with optical thin film;
Put the 96-well PCR plate into the Sorvall Legend RT centrifuge, 1200 rpm, centrifuge for 1 min and put into the 7500 PCR instrument;
PCR amplification and fluorescence quantification were performed under the following reaction conditions. Take the fluorescence value every 0.5°C from 60°C to 95°C to make a melting curve; 95°C for 3 min 1 cycle; 95°C for 12 sec; 62°C for 40 sec 40 cycles.
The experimental method for detecting gene expression in HBE cells is the same, and RT-PCR primer sequences are as follows:
GAPDH F: CGACCACTTTGTCAAGCACA
R: AGAGTTGTCAGGGCCCTTTT
NF-κB p65(RELA) F: ACTGCCGGGATGGCTACTAT
R: TCTGGATTCGCTGGCTAATGG
TFAM F: AAAGATTCCAAGAAGCTAAGGGTG
R: CCTAACTGGTTTCCTGTGCCTA
2.10 Western blot
30 mg of lung tissue was ground in benzyl sulfonyl fluoride (PMSF) (China, Biyuntian Biotechnology Co., Ltd.) in 30:1 mixed lysate and lysed liquid nitrogen. Equal amounts of total protein were separated by the 10% SDS-PAGE Gel Preparation Kit (China, Biyuntian Biotechnology Co., Ltd.). Protein concentration was measured by BCA Protein Detection Kit (China, Biyuntian Biotechnology Co., Ltd.). Approximately 25 µg of protein is separated by SDS-PAGE and transferred to a polyvinylidene fluoride (PVDF) membrane. and incubate overnight with specific primary antibodies at 4°C. After several washes with TBST, the membrane is incubated with the secondary antibody followed by chemiluminescence detection using the G:BOX Chemi XRQ Gel Imager.
2.11 NF-κB p65 siRNA interference experiment
siRNA was designed and synthesized by Suzhou Jima Gene Co., Ltd., a total of 3 pieces, and the best use was selected.
Physiologically sound HR10 cells were selected and transfected with Lipo3000 transfection reagent (Invitrogen, USA).
2.12 NF-κB, TFAM overexpression plasmid construction and transfection
NF-κB and TFAM overexpression plasmids were designed, synthesized and sequenced by Suzhou Jima Gene Co., Ltd. to provide bacterial liquid and no-load plasmids.
Injected the bacteria with pEX-2-TFAM or NF-κB plasmid in 3 mL LB/kanamycin culture (China, Biyuntian Biotechnology Co., Ltd.) with Lipo3000 transfection reagent (Invitrogen, USA) to transfect HR10 cells according to the manufacturer's instructions. Cells were further treated as designed after the transfection.
2.13 Diluciferase reporter gene assay
TFAM reporter gene activity in HR10 cells (as previously described) was detected using a double luciferase analyzer (USA, Promega). Briefly, the GV354 plasmid (designed by GK Genetics) was transfected, then measured by the Diluciferase Assay Kit (Promega, USA), and compared to an empty vector control group.
2.14 Extraction of genomic DNA
According to the manufacturer's instructions, genomic DNA was extracted by the Blood/Cell/Tissue Genomic DNA Extraction Kit (China, Tiangen Biochemical Technology (Beijing) Co., Ltd.).
2.15.q-PCR detects mitochondrial DNA copy number
ND1 amplification of mitochondrial DNA (mtDNA) encoded by mitochondrial DNA, β-Actin amplification of internal control genes.
Primer sequence: ND1 F: CCCTAAAACCCGCCACATCT
ND1 R: GAGCGATGGTGAGAGCTAAGGT
β-Actin F: ACCTTCAACAACCCAGCCATGTACG
β-Actin R: CTGATCCACATCTGCTGGAGGGTGG
Real-time PCR reaction system:
SYBR Green Mix 12.5 µL, upstream primers(5µM)1 µL, downstream primers༈5µM༉1 µL, template DNA༈100ng/µL༉1 µL, DEPC water 9.5 µ lL, total volume 25 µL.
Real-time PCRReaction procedure: 95℃ for 10 min; repeat 30 times 95℃for 15 s, 60°C for 0.5 min, 72°C for 0.5 min; 72℃ for 10 min; 4℃ for 10 min.
After the end of Real-time PCR, the software analysis defined the mtDNA/β-Actin DNA ratio of HR10 cells in the blank control group as 1, calculated the ratio of mtDNA to β-Actin DNA in each treatment group, and analyzed the change of mtDNA relative copy number in the treatment group compared with the control group.
2.16. Statistics
Experimental data are represented in x ± s. SPSS 17.0 software was used for statistical analysis. The homogeneity test for variance and one-way ANOVA were used for multi-group comparisons. The independent sample t-test was used when compared with the control group.