The Effect of Olanzapine through Antioxidant and Anti-Inflammation on the Hippocampus in the Asphyxial Cardiac Arrest Rat Model

doi:10.21203/rs.3.rs-3145323/v1

Download PDF

Research Article

The Effect of Olanzapine through Antioxidant and Anti-Inflammation on the Hippocampus in the Asphyxial Cardiac Arrest Rat Model

https://doi.org/10.21203/rs.3.rs-3145323/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Introduction:

Cardiac arrest (CA) often leads to severe brain damage, resulting in neurological disorders and high mortality rates. Hypothermia treatment (HT) is commonly used in clinical practice after CA/cardio-pulmonary resuscitation (CA/CPR) because it has been shown to improve neurological outcomes and increase survival rates. Olanzapine, a medication known to induce hypothermia, has not been extensively studied in the context of CA/CPR. This study aimed to investigate the neuroprotective effects and mechanisms of olanzapine-induced hypothermia (OIH) following ROSC. Male Sprague-Dawley rats were subjected to the following conditions: (i) Sham: no asphyxial CA + saline, (ii) CA: asphyxial CA + saline, and (iii) OCA: asphyxial CA + olanzapine treatment after the return of spontaneous circulation (ROSC).

Result

CA/CPR resulted in high mortality, severe neurological impairments, and hippocampal neuron damage observed after 5 days in the asphyxia CA group. These pathological complications were ameliorated by olanzapine treatment. OIH also protected the pyramidal neurons in the CA1 region of the hippocampus. The expression of antioxidant factors SOD-1, SOD-2, and CAT were upregulated in the olanzapine-treated group compared to the CA group. Moreover, olanzapine treatment following asphyxial CA reduced the expression of the pro-inflammatory factor COX-2 and the nuclear transcription factor NF-κB, which was sustained for up to 5 days compared to the CA group. OIH provides protection against cerebral injury following ROSC by enhancing the expression of antioxidant and anti-inflammatory factors.

Conclusion

The results of our study demonstrate that Olanzapine, an atypical antipsychotic medication, induces a noteworthy reduction in body temperature in the asphyxial CA rat model. The effectiveness of hypothermia treatment was evident by its antioxidant and anti-inflammatory mechanisms. Therefore, we suggest olanzapine as a promising therapeutic agent for alleviating cerebral injury via hypothermia in patients with CA.

Cardiac arrest

Cerebral injury

Olanzapine

Olanzapine-induced hypothermia

Hypothermia treatment

Antioxidant

Anti-inflammatory factors

Cardiac arrest (CA) results in a sudden decrease in blood flow, leading to ischemia/reperfusion (I/R) injury, neurological dysfunction, and a high mortality rate. In the body, the brain circumscribes 2% of the total body weight but uses more than 20% of the total energy expenditure to maintain the body's essential functions [1, 2]. A regular blood flow ensures the desirable energy supply to the brain. But the sudden reduction of blood supply to the brain tissue causes a serious neurological injury, with a poor prognosis [3, 4]. Due to a decrease in blood supply, patients face permanent I/R injury in the cerebrum even after return of spontaneous circulation (ROSC).

Reperfusion after CA initiates acute oxidative stress in the cerebrum and excess generation of reactive oxygen species (ROS). Overproduction ROS is considered one of the causes of ischemic cerebral neuronal death [5]. These ROS are regulated to a non-toxic state by the involvement of antioxidant enzymes, including the cellular antioxidants superoxide dismutase (SOD) and catalase (CAT) [6]. Hypothermia treatment (HT) has been used to decrease mortality and neurological disorders in patients who recovered ROSC after CA [7]. HT can also increase the antioxidant activity and protects spinal nerves after CA [8, 9]. When I/R begins, large amounts of circulating cytokines are released, leading to irreversible systemic inflammation, especially in the cerebrum. HT may involve in a major protective mechanism by reducing the levels of many inflammatory mediators such as NF-κB and COX-2 in I/R conditions after CA [10, 11]. Therefore, HT is known as a protective method against cerebral I/R injury by increasing antioxidants and inhibiting inflammation [12, 13].

Despite these advantages, After ROSC, the time to reach HT using an external cooling device was at least 4 h, increasing the rate of complications by a slow cooling rate [14]. Therefore, there is a limit to the application of HT following slow cooling rate and spatial constraints. [14–16]. Meanwhile, HT is the only method applied to improve survival and neurological impairment outcomes in patients [17]. HT for improvement of I/R injury after asphyxia CA should be performed immediately [13, 18]. Therefore, we aimed to find a way to apply HT quickly, and effectively.

Olanzapine is an atypical antipsychotic drug with potent antagonistic properties against the D1-4 dopaminergic, 5-HT2A/2C serotonergic, α1-adrenergic, muscarinic, and H1 histamine receptors [19, 20]. In 2017 [21] and 2019 [22], olanzapine has been reported that can induce hypothermia. Kapur et al. and Kreuzer et al. described that olanzapine-induced hypothermia (OIH) can be mediated by dopaminergic D2 receptor antagonism in experimental animal models and mainly mediated by the antagonism of 5-hydroxytryptamine (5-HT) receptors on the serotonin system, a known site of olanzapine activity [23, 24]. However, the mechanism is still unclear.

Therefore, in the present study, we assumed that olanzapine can rapidly induce hypothermia after ROSC and that hypothermia will have a therapeutic effect against brain ischemia-reperfusion injury by regulating antioxidant and anti-inflammation-related mechanisms.

We attempted to determine whether olanzapine was administered immediately after ROSC and induced hypothermia in the asphyxial CA rat model also investigated whether OIH improved survival and neurological prognosis. Furthermore, we attempted to verify the antioxidant and inflammation-related mechanism of HT for OIH after ROSC.

2.1. Experimental animals

Male Sprague-Dawley (SD) rats (total n = 84; 270–300 g, 10 weeks) were supplied by the Experimental Animal Center of Jeonbuk National University (South Korea). They were housed in a conventional state under adequate control of temperature (23 ± 2°C) and humidity (60 ± 10%) with each half-day light/dark cycle and provided with food and water ad libitum. All experimental protocols were approved for ethical procedures and scientific care by the Jeonbuk National University-Institutional Animal Care and Use Committee (approval no. CBNU 2020-084). The experimental animals were divided as follows: (a) Sham: no asphyxial CA + saline; (b) CA: asphyxial CA + saline: 6 h, 12 h, 1 d, 2 d, 5 d; (c) OCA: asphyxial CA + olanzapine: 6 h, 12 h, 1 d, 2 d, 5 d.

2.2. Induction of asphyxia cardiac arrest

We used a rat model of asphyxial CA and CPR as previously protocol described [25, 26]. Anesthesia was induced that 3% isoflurane and mechanically ventilated using a rodent ventilator (Harvard Apparatus, Holliston, MA, USA) to maintain their breathing. The right femoral artery and left vein were cannulated for mean arterial pressure (MAP) and drug administration. Electrocardiogram (ECG) monitoring was performed using a three probe. All data on the monitor went through a stabilizer period of 5 min; vecuronium bromide (2 mg/kg, Gensia, Sicor Pharmaceuticals, Irvine, CA, USA) was administered intravenously, anesthesia was stopped, and mechanical ventilation was withdrawn. MAP of < 20 mmHg and subsequent pulseless electric activity was used to CA confirm 3–4 min after injection of vecuronium bromide. After 5 min, sodium bicarbonate (1 mEq/kg, Sigma, St. Louis, MO, USA) and epinephrine (0.005 mg/kg, Sigma, St. Louis, MO, USA) were injected. Mechanical ventilation with 100% oxygen and manual chest compression were performed at a rate of 300/min (Jeung Do Bio & Plant Co., Ltd.) until the MAP reached 60 mmHg and ECG activity was observed. Once the rat was hemodynamically stable and breathed spontaneously (± 1 h after ROSC), the catheter was removed and extubated.

2.3. Olanzapine treatment and temperature management

In the OCA groups, for the induction of hypothermia, olanzapine (10 mg/kg) was immediately injected intraperitoneally after the recovery of ROSC to reduce the body temperature to 33°C. The body temperature was increased to a normal temperature (37 ± 0.5°C) by a heating pad after 6 hours. In the Sham and CA groups, normal saline was immediately injected intraperitoneally one time after ROSC at the same time point with OCA. The rectal temperature was recorded using a rectal thermometer (Homeothermic Monitoring System; Harvard Apparatus, Holliston, MA, USA). Olanzapine was dissolved in 1% acetic acid and buffered with 1 N NaOH until a pH of 5.5 [27]. The rats were returned to cages until they were sacrificed.

2.4. Evaluation of the neurological deficits score (NDS)

The general neurologic status was verified using the validated NDS every day until day 5 after ROSC. Briefly, brain function assessment involves scoring 19 categories, including consciousness, respiration, motor function, and sensory function. NDSs were scored by two observers blinded to group identity (brain death = 0, normal brain function = 80) [28].

2.5. Tissue processing

All animals were deeply anesthetized with urethane (1.5 g/kg) (Dae Jung Chemicals & Metals Co., Ltd., Siheung, South Korea) and then perfused transcardiacally with 0.1 M phosphate-buffered saline (PBS) (pH 7.4), followed by fixation with 4% paraformaldehyde (PFA). The brains were removed, post-fixed overnight in PFA, and cryoprotected for 24 h in 30% sucrose. Serial 30-µm thick coronal sections were cut using a cryostat and stored at 4°C.

2.6. Cresyl violet (CV) staining

The frozen sections were mounted on coated slides and stained with 0.1% CV solution for 15 min. The stained slides were quickly rinsed in distilled water and immersed in 70% ethanol for 2 min. The slides were then dipped in 95% ethanol for 1–2 min), dehydrated in 100% ethanol, and cleared twice in 100% xylene (5 min each time). Finally, the sections were mounted using a mounting solution. CV⁺ cell number counting was conducted in the hippocampus CA1 regions. Three researchers evaluated at least three sections of randomly selected areas.

2.7. Fluro-jade B (F-JB) staining

For F-JB (Fluoro-Jade B) histo-fluorescence, the brain cryosections were placed in a 1% sodium hydroxide solution. Then the tissue sections were shifted to 0.06% potassium permanganate-containing solution and subsequently to 0.0004% F-JB (Histochem, Jefferson, AR, USA) solution. Finally, the slides containing tissue section were washed with 0.01M PBS and transferred on a slide warmer, and then distinguished the changes using an epifluorescent microscope (Carl Zeiss, Germany) with blue (450–490 nm) excitation light and a barrier filter. F-JB⁺ cell number counting was conducted in the hippocampus CA1 regions. Three researchers evaluated at least three sections of randomly selected areas.

2.8. Immunohistochemistry (IHC) staining

IHCs were performed according to a published method [29]. The sections were incubated with mouse anti-neuronal nuclei (NeuN, 1:800, Sigma-Aldrich, USA) for neurons, anti-glial fibrillary acidic protein (GFAP, 1:1000, Chemicon) for astrocytes, and rabbit anti-ionized calcium-binding adapter molecule-1 (Iba-1, 1:1000, Chemicon, Temecula, CA, USA) for microglia. The incubated sections were reacted with corresponding biotinylated goat anti-mouse and anti-rabbit IgG (1:250, Vector Laboratories Inc., Burlingame, CA, USA), and developed using Vectastain ABC (Vector Laboratories Inc.), visualized the redacted sections in a solution of 3, 3’-diaminobenzidine. Immunoreactivity, GFAP⁺ cell counting, and ROD were conducted in the hippocampus CA1 regions. Three researchers evaluated at least three sections of randomly selected areas.

2.9. Lipid peroxidation analysis for oxidative stress

Lipid peroxidation was measured, using malondialdehyde (MDA). The hippocampal tissue was homogenized and centrifuged at 13,000 rpm at 4°C for 15 min. The supernatant was collected and stored at -80°C for experimental analysis. MDA levels were determined by estimating the levels of thiobarbituric acid-reactive substances.

2.10. RNA extraction, cDNA synthesis, and quantitative real-time PCR (qRT-PCR)

Total RNA was prepped from hippocampal tissue following the manufacturer’s instructions (GeneAll, Seoul, Korea). Total RNA concentration was measured using a BioSpec-nano spectrophotometer (Shimadzu Biotech, Tokyo, Japan) at a 260/280 nm ratio. The RevertAid First Strand cDNA Synthesis Kit was used for complementary DNA (cDNA) synthesis using total RNA (3 µg). Quantitative real-time PCR (qRT-PCR) was performed on a Thermal Cycler Dice® Real-Time PCR Detection System with TB Green (Takara Bio, Shiga, Japan) as a double-stranded DNA-specific binding dye. The specific primers are as follows: BDNF (forword 5′- AGGCACTGGAACTCGCAATG, reverse 5′-AAGGGCCCGAACATACGATT); GDNF (forword 5′-GGTCACCAGATAAACAAGCGG, reverse 5′-GCCGGTTCCTCTCTCTTCG); GADPH (forword 5′-GCAAGTTCAACGGCACAG, reverse 5′-CGCCAGTAGACTCCACGAC).

2.11. Western blot analysis

Total protein concentration in the hippocampal tissue lysed was measured using a bicinchoninic acid assay kit. Equal amounts of protein were separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to a polyvinylidene fluoride membrane. In this phase, use a size marker to trim the membrane to the appropriate molecular weight range for the target protein. After trimming, the membrane was incubated with 5% bovine serum albumin, Tris-buffered saline with Tween 20 (TBST), and incubated for 3 h at room temperature and then overnight at 4°C with primary antibody. and then, The primary antibodies follows; superoxide dismutase (SOD-1, 1:1000, ab13498, abcam, Cambridge), manganeses superoxide dismutase 2(Mnsod, SOD-2, 1:1000, ab13533, abcam, Cambridge), catalase (CAT, 1:1000, ab16731, abcam, Cambridge), nuclear factor erythroid 2-related factor 2 (Nrf-2, 1:1000, NBP1-32822, novusbiologicals, USA), nuclear factor kappa B (NF- κb: 1:1000, cyclooxygenase-2 (COX-2, 1:1000, #12282, cell signaling, Massachusetts), beta actin(B-actin, 1:1000, #4970, cell signaling, Massachusetts). The membranes were washed three times with TBST and then incubated with secondary antibodies (goat anti-rabbit IgG-HRP, Sigma-Aldrich, USA) for 2 h. Band images were taken using a VITEC Mini HD9 system equipped with HD imaging software (Cleaver Scientific Ltd., Warwickshire, UK).

2.12. Statistical analysis

To analyze the data, GraphPad Prism version 8.0 (Graphpad, San Diego, CA, USA) was used and was expressed as mean ± standard error of the mean (SEM) values. To analyze the survival rate, Kaplan-Meier statistics and log-rank test were used. MAP and peripheral oxygen were compared using one-way and two-way repeated-measures analysis of variance to evaluate the effect of time. To determine the significance of differences, posthoc analyses were performed using Tukey’s-test for all pairwise multiple comparisons. Histopathological analyses were compared using one-way and two-way ANOVA to evaluate the effect of each time course. To determine the significance of differences, posthoc analyses were performed using Tukey’s-test for all pairwise multiple comparisons. The differences were considered significant when the P-value < 0.05.

3.1. OIH increased the survival rate and attenuated the NDS after ROSC

Asphyxial ROSC confirming variables ECG, SpO2, and MAP were altered as similar to previous results [26]. Olanzapine rapidly induced hypothermia to 33 ± 0.5°C within 30 min after ROSC recovery and was maintained for 6 h (Fig. 1A). The survival rate (P < 0.05) was determined by Kaplan–Meier analysis (Fig. 1B). In the sham group, the survival rate was 100%. However, the survival rate in the CA and OCA groups was 20.0% and 50.0% after 5 days. To confirm the neuroprotective effect of OIH, NDSs were recorded daily for 5 days after ROSC (Fig. 1C). Compared with the sham group, NDS decreased at all time points in the CA and OCA groups. Meanwhile, the NDS of rats in the OCA group recovered over time compared with that of the CA group.

3.2. OIH reduced neuronal loss in the hippocampus after ROSC

CV positive(CV⁺) cells were observed in the layer of pyramidal cells in the CA1 region of the hippocampus. In the sham group, the pyramidal cells were evenly distributed without injury. In the CA group, CV⁺ cells began to aggregate in the CA1 region from 2 days after ROSC, and after 5 days, many pyramidal cells were eliminated and damaged. Meanwhile, the number of CV⁺ cells in the OCA 5 d group was increased significantly compared to that of the CA 5 d group after 5 days of ROSC (Fig. 2A, D).

F-JB⁺ pyramidal neurons were not observed in any layer of the hippocampal CA1 region of the sham group. Two days after ROSC, F-JB⁺ neuron levels increased rapidly in both groups. After 5 days, in the OCA group, F-JB⁺ neurons were observed in the pyramid layer but were significantly fewer than those in the CA group (Fig. 2B, D).

Nuclear pyramidal neurons located in the pyramidal layer of the CA1 region of the sham group exhibited strong immunoreactivity to NeuN. No changes in the immunoreactivity of neurons were observed in the CA and OCA groups 2-day after ROSC. Meanwhile, 5 days after ROSC, most neurons in the OCA group survived compared with those in the CA group (Fig. 2C, D).

3.3. OIH reduced the expression of GFAP, Iba-1 immunoreactivity after ROSC

In the sham group, inactivated GFAP (Fig. 3A, C) and Iba-1 (Fig. 3B, C) were observed in all layers of the CA 1 region. In the CA and OCA groups, the immunoreactivity of GFAP and Iba-1 increased from day 2 and peaked on day 5. In particular, 5 days after ROSC, the ROD of Iba-1 was significantly higher in the CA group than in the OCA group.

3.4. OIH aids in the rapid increase in neurotrophic factors expression

The mRNA levels of brain-derived neurotrophic factor (BDNF) and glial cell-derived neurotrophic factor (GDNF) in the hippocampus of the OCA group after ROSC were expressed late and rapidly decreased in the CA group but increased rapidly and then decreased slowly in the OCA group. The mRNA levels of BDNF and GDNF were significantly higher in the OCA group after 5 days of ROSC (Fig. 4A, B).

3.5. OIH attenuated the levels of oxidative stress in the hippocampus after ROSC

The expression level of MDA in the hippocampus was significantly decreased in the OCA group on 1 and 2 days compared with that in the CA group (*P < 0.05, **P < 0.01) (Fig. 5A). The protein expression of SOD-1, SOD-2, and CAT was used to investigate the antioxidant effect of OIH (Fig. 5B, C). The expression level of SOD-2 in the OCA group was observed high after 1 day of ROSC and ensured to be significantly high after 5 days of ROSC than in the CA group. Additionally, the expression of CAT significantly increased at 1 day (**P < 0.01) and was maintained significantly longer to 5 days (*P < 0.05) after ROSC in the OCA group than in the CA group.

3.6. OIH reduced the expression of inflammation-associated factors after ROSC

The expression of inflammation-related factors was measured by western blotting (Fig. 6A, B). Nrf-2, which plays a protective role against oxidative stress and injury, In the OCA group Nrf-2 increased significantly after 2 days (*P < 0.05) of ROSC and showed maintained expression after 5 days of ROSC. In the OCA group, the activation of NF-κB, which mediates the inflammatory response, decreased compared with that in the CA group at 12 h and 5 days after ROSC. Additionally, all groups had a rapid increase in COX-2 protein expression at 12 h, but in the OCA group observed a significant decrease in COX-2 expression 1 day after ROSC, in contrast to the CA group (*P < 0.05, **P < 0.01).

In this study, olanzapine treatment (10 mg/kg) immediately after ROSC, effectively induced hypothermia 30 min faster and was maintained for 6 h. We propose that olanzapine treatment instantly after ROSC can trigger hypothermia more efficiently than conventional methods. Kim et al. reported a survival rate of 42.9% after 2 days in a group that maintained hypothermia for 6 h [26]. In our study, it was confirmed that the survival rate of the OIH group increased to 50.0% 2 days after ROSC. The survival rate was higher than the 6 h HT. In addition, NDS showed a tendency to recover significantly compared to the CA group. OCA group was significantly protected neuronal cell injury compared CA group. Taken together, OIH improved survival rate and neurological prognosis after ROSC by protecting against cerebral injury in this study. Astrocytes and microglia are types of neuroglia that increase in patients with CA with a poor neurological prognosis and HT attenuate microglial activation after cerebral transient ischemia [29–33]. In our study, significantly activated astrocytes and microglia were detected in the CA group and less activated astrocytes and microglia were observed in the OCA groups compared to the CA group 2 days after ROSC. Therefore, OIH could reduce the activation of astrocytes and microglia after ROSC by diminishing subsequent pathological events.

The expression of several neurotrophic factors, such as BDNF and GDNF for nerve recovery is increased in CA patients with cerebral injury for several days [34–36]. Vosler et al. reported that HT increases the expression of specific BDNF in the hippocampus after asphyxial CA [37]. In our study, as with HT, the levels of BDNF and GDNF in the cerebral hippocampus of the OCA group after ROSC increased and then slowly decreased. Thus, we assumed that OIH maintains the expression of BDNF and GDNF involved in neuronal recovery in the cerebral hippocampus after ROSC.

Nrf-2 is activated in response to pro-inflammatory and inflammatory signals, oxidative stress and it is also a transcription factor that induces the activation of pro-inflammatory cytokines [38, 39]. Diao et al. reported that HT depresses cerebral injury by increasing the activity of the Nrf-2/HO-1 signaling pathways and SOD after 72 h in a CA rat model [40]. In our study, the relative protein expression level of Nrf-2, SOD-1, SOD-2, and CAT in the OCA group reached a peak on 2 days and 5 days, faster in the CA group, and was maintained until day 5. Thus, it can be inferred that OIH protected cerebrum tissue from I/R injury such as oxidative stress by increasing and maintaining antioxidant enzyme activity.

After ROSC, enhanced ROS also induces activation of NF-κB involved in the release and inflammatory response of ischemia-induced inflammatory cytokines [41]. Several clinical and animal experimental studies have reported that mild HT reduces NF-κB [42]. In this study, NF-κB activation in the OCA group was significantly reduced compared with that of the CA group 12 h and 5 days after ROSC. Besides, the expression pattern of COX-2 during an ischemic injury in the brain reported by Zhao Y et al. was similar in the CA groups of this experiment, but in the OIH group, a different pattern was observed [43]. Thus, we assumed that OIH after ROSC activated Nrf-2, furthermore inhibition of the activity of NF-κB, and decreased expression of COX-2 in this study.

Taken together, this study reported that olanzapine improved neurological outcomes by inducing early hypothermia after ROSC. Additionally, OIH protected neurons from I/R injury after ROSC. Antioxidant enzymes and anti-inflammatory cytokines were increased and maintained by OIH. The immediate olanzapine treatment after ROSC could be potential as a new therapeutic approach for cerebrum I/R injury.

5-HT 5-hydroxytryptamine

CA Cardiac arrest

CAT catalase

COX-2 cyclooxygenase-2

CV Cresyl violet

ECG Electrocardiogram

F-JB Fluro-jade B

HT Hypothermia treatment

I/R ischemia/reperfusion

MAP mean arterial pressure

MDA malondialdehyde

NDS neurological deficits score

NF- κb nuclear factor kappa B

Nrf-2 nuclear factor erythroid 2-related factor 2

OIH olanzapine-induced hypothermia

qRT-PCR quantitative real-time PCR

ROS Reactive Oxygen Species

ROSC Return of Spontaneous Circulation

SOD Superoxide dismutase

Acknowledgments: We would like to thank Editage (www.editage.co.kr) for English language editing

Author Contributions: HYS, SEK, JCY, and HPH were responsible for the experimental design, data acquisition, data analysis, and manuscript writing. YJY, RHK, YJJ, and THK performed the experiments and data analysis. BYP, JCY, JHL, ISK, JHH, YKL, and HJT performed the data analysis and made critical comments on the entire process of the study. All authors have read and approved the final manuscript. HYS, SEK, JCY, and HPH confirm the authenticity of all the raw data.

Funding: This research was supported by Basic Science Research Program through the National Research Foundation of Korea funded by the Ministry of Education (NRF-2020R1I1A3070874 and NRF-2022R1A2C4002264) and the Rural Development Administration (Project No. PJ01690702) and research funds for newly appointed professors of Jeonbuk National University in 2022

Availability of data and materials

The datasets utilized and/or examined in this study can be obtained from the corresponding author upon a reasonable request.

Ethics approval and consent to participate: The animal use protocol listed below has been reviewed and approved by the Jeonbuk National University-Institutional Animal Care and Use Committee (approval no. CBNU 2020-084). Animal care and use described in the protocol were done according to “The Guide for the Care and Use of Laboratory Animals (The National Academies Press, 8th Ed., 2011). The study was carried out in compliance with the ARRIVE guidelines.

Consent for publication: No applicable.

Competing Interests: The authors declare no competing of interest.

Attwell D, Laughlin SB: An energy budget for signaling in the grey matter of the brain. J Cereb Blood Flow Metab 2001, 21(10):1133-1145.
Belanger M, Allaman I, Magistretti PJ: Brain energy metabolism: focus on astrocyte-neuron metabolic cooperation. Cell Metab 2011, 14(6):724-738.
Vaahersalo J, Hiltunen P, Tiainen M, Oksanen T, Kaukonen KM, Kurola J, Ruokonen E, Tenhunen J, Ala-Kokko T, Lund V et al: Therapeutic hypothermia after out-of-hospital cardiac arrest in Finnish intensive care units: the FINNRESUSCI study. Intensive Care Med 2013, 39(5):826-837.
Perkins GD, Callaway CW, Haywood K, Neumar RW, Lilja G, Rowland MJ, Sawyer KN, Skrifvars MB, Nolan JP: Brain injury after cardiac arrest. Lancet 2021, 398(10307):1269-1278.
Chan PH: Role of oxidants in ischemic brain damage. Stroke 1996, 27(6):1124-1129.
Nita M, Grzybowski A: The Role of the Reactive Oxygen Species and Oxidative Stress in the Pathomechanism of the Age-Related Ocular Diseases and Other Pathologies of the Anterior and Posterior Eye Segments in Adults. Oxid Med Cell Longev 2016, 2016:3164734.
Fay T: Observation on generalized refrigeration in cases of severe cerebral trauma. Assoc Res Nerv Dis Proc 1943, 24:611-619.
Ahn JH, Lee TK, Kim B, Lee JC, Tae HJ, Cho JH, Park Y, Shin MC, Ohk TG, Park CW et al: Therapeutic Hypothermia Improves Hind Limb Motor Outcome and Attenuates Oxidative Stress and Neuronal Damage in the Lumbar Spinal Cord Following Cardiac Arrest. Antioxidants (Basel) 2020, 9(1).
Hackenhaar FS, Medeiros TM, Heemann FM, Behling CS, Putti JS, Mahl CD, Verona C, da Silva ACA, Guerra MC, Goncalves CAS et al: Therapeutic Hypothermia Reduces Oxidative Damage and Alters Antioxidant Defenses after Cardiac Arrest. Oxid Med Cell Longev 2017, 2017:8704352.
Adrie C, Adib-Conquy M, Laurent I, Monchi M, Vinsonneau C, Fitting C, Fraisse F, Dinh-Xuan AT, Carli P, Spaulding C et al: Successful cardiopulmonary resuscitation after cardiac arrest as a "sepsis-like" syndrome. Circulation 2002, 106(5):562-568.
Kim JY, Kim N, Yenari MA, Chang W: Mild Hypothermia Suppresses Calcium-Sensing Receptor (CaSR) Induction Following Forebrain Ischemia While Increasing GABA-B Receptor 1 (GABA-B-R1) Expression. Transl Stroke Res 2011, 2(2):195-201.
Meybohm P, Gruenewald M, Zacharowski KD, Albrecht M, Lucius R, Fosel N, Hensler J, Zitta K, Bein B: Mild hypothermia alone or in combination with anesthetic post-conditioning reduces expression of inflammatory cytokines in the cerebral cortex of pigs after cardiopulmonary resuscitation. Crit Care 2010, 14(1):R21.
Zhou M, Wang P, Yang Z, Wu H, Huan Z: Spontaneous hypothermia ameliorated inflammation and neurologic deficit in rat cardiac arrest models following resuscitation. Mol Med Rep 2018, 17(2):2127-2136.
Hypothermia after Cardiac Arrest Study G: Mild therapeutic hypothermia to improve the neurologic outcome after cardiac arrest. N Engl J Med 2002, 346(8):549-556.
Granfeldt A, Holmberg MJ, Nolan JP, Soar J, Andersen LW, International Liaison Committee on Resuscitation Advanced Life Support Task F: Targeted temperature management in adult cardiac arrest: Systematic review and meta-analysis. Resuscitation 2021, 167:160-172.
Choudhary RC, Shoaib M, Sohnen S, Rolston DM, Jafari D, Miyara SJ, Hayashida K, Molmenti EP, Kim J, Becker LB: Pharmacological Approach for Neuroprotection After Cardiac Arrest-A Narrative Review of Current Therapies and Future Neuroprotective Cocktail. Front Med (Lausanne) 2021, 8:636651.
Cheung KW, Green RS, Magee KD: Systematic review of randomized controlled trials of therapeutic hypothermia as a neuroprotectant in post cardiac arrest patients. CJEM 2006, 8(5):329-337.
Lu J, Qian HY, Liu LJ, Zhou BC, Xiao Y, Mao JN, An GY, Rui MZ, Wang T, Zhu CL: Mild hypothermia alleviates excessive autophagy and mitophagy in a rat model of asphyxial cardiac arrest. Neurol Sci 2014, 35(11):1691-1699.
Bishara D, Olofinjana O, Sparshatt A, Kapur S, Taylor D, Patel MX: Olanzapine: a systematic review and meta-regression of the relationships between dose, plasma concentration, receptor occupancy, and response. J Clin Psychopharmacol 2013, 33(3):329-335.
Mauri MC, Paletta S, Maffini M, Colasanti A, Dragogna F, Di Pace C, Altamura AC: Clinical pharmacology of atypical antipsychotics: an update. EXCLI J 2014, 13:1163-1191.
Zonnenberg C, Bueno-de-Mesquita JM, Ramlal D, Blom JD: Hypothermia due to Antipsychotic Medication: A Systematic Review. Front Psychiatry 2017, 8:165.
Zonnenberg C, Bueno-de-Mesquita JM, Ramlal D, Blom JD: Antipsychotic-Related Hypothermia: Five New Cases. Front Psychiatry 2019, 10:543.
Kapur S, Zipursky RB, Remington G, Jones C, DaSilva J, Wilson AA, Houle S: 5-HT2 and D2 receptor occupancy of olanzapine in schizophrenia: a PET investigation. Am J Psychiatry 1998, 155(7):921-928.
Kreuzer P, Landgrebe M, Wittmann M, Hajak G, Schecklmann M, Poeppl TB, Langguth B: [Hypothermia under olanzapine treatment: clinical case series and review of current literature]. Nervenarzt 2012, 83(5):630-637.
Jawad A, Yoo YJ, Cho JH, Yoon JC, Tian W, Islam MS, Lee EY, Shin HY, Kim SE, Kim K et al: Therapeutic hypothermia effect on asphyxial cardiac arrest-induced renal ischemia/reperfusion injury via change of Nrf2/HO-1 levels. Exp Ther Med 2021, 22(3):1031.
Kim SE, Shin HY, Lee EY, Yoo YJ, Kim RH, Cho JH, Lee TK, Ahn D, Park BY, Yoon JC et al: Effect of therapeutic hypothermia against renal injury in a rat model of asphyxial cardiac arrest: Alpha focus on the survival rate, pathophysiology and antioxidant enzymes. Mol Med Rep 2022, 25(1).
Galal A, El-Bakly WM, El-Kilany SS, Ali AA, El-Demerdash E: Fenofibrate ameliorates olanzapine's side effects without altering its central effect: emphasis on FGF-21-adiponectin axis. Behav Pharmacol 2021, 32(8):615-629.
Goyagi T, Kimura T, Nishikawa T, Tobe Y, Masaki Y: Beta-adrenoreceptor antagonists attenuate brain injury after transient focal ischemia in rats. Anesth Analg 2006, 103(3):658-663.
Yang GE, Tae HJ, Lee TK, Park YE, Cho JH, Kim DW, Park JH, Ahn JH, Ryoo S, Kim YM et al: Risperidone Treatment after Transient Ischemia Induces Hypothermia and Provides Neuroprotection in the Gerbil Hippocampus by Decreasing Oxidative Stress. Int J Mol Sci 2019, 20(18).
Ohsawa K, Imai Y, Sasaki Y, Kohsaka S: Microglia/macrophage-specific protein Iba1 binds to fimbrin and enhances its actin-bundling activity. J Neurochem 2004, 88(4):844-856.
Hu X, Leak RK, Shi Y, Suenaga J, Gao Y, Zheng P, Chen J: Microglial and macrophage polarization-new prospects for brain repair. Nat Rev Neurol 2015, 11(1):56-64.
Rivest S: Regulation of innate immune responses in the brain. Nat Rev Immunol 2009, 9(6):429-439.
Hong DK, Park YS, Woo JS, Kim JH, Beom JH, Chung SP, You JS, Suh SW: Transient Global Ischemia-Induced Brain Inflammatory Cascades Attenuated by Targeted Temperature Management. Int J Mol Sci 2021, 22(10).
D'Cruz BJ, Fertig KC, Filiano AJ, Hicks SD, DeFranco DB, Callaway CW: Hypothermic reperfusion after cardiac arrest augments brain-derived neurotrophic factor activation. J Cereb Blood Flow Metab 2002, 22(7):843-851.
Tahsili-Fahadan P, Farrokh S, Geocadin RG: Hypothermia and brain inflammation after cardiac arrest. Brain Circ 2018, 4(1):1-13.
Conner JM, Lauterborn JC, Yan Q, Gall CM, Varon S: Distribution of brain-derived neurotrophic factor (BDNF) protein and mRNA in the normal adult rat CNS: evidence for anterograde axonal transport. J Neurosci 1997, 17(7):2295-2313.
Vosler PS, Logue ES, Repine MJ, Callaway CW: Delayed hypothermia preferentially increases expression of brain-derived neurotrophic factor exon III in rat hippocampus after asphyxial cardiac arrest. Brain Res Mol Brain Res 2005, 135(1-2):21-29.
Al-Salam S, Hashmi S: Myocardial Ischemia Reperfusion Injury: Apoptotic, Inflammatory and Oxidative Stress Role of Galectin-3. Cell Physiol Biochem 2018, 50(3):1123-1139.
Chen XL, Dodd G, Thomas S, Zhang X, Wasserman MA, Rovin BH, Kunsch C: Activation of Nrf2/ARE pathway protects endothelial cells from oxidant injury and inhibits inflammatory gene expression. Am J Physiol Heart Circ Physiol 2006, 290(5):H1862-1870.
Diao MY, Zheng J, Shan Y, Xi S, Zhu Y, Hu W, Lin Z: Hypothermia prevents hippocampal oxidative stress and apoptosis via the GSK-3beta/Nrf2/HO-1 signaling pathway in a rat model of cardiac arrest-induced brain damage. Neurol Res 2020, 42(9):773-782.
Yenari MA, Han HS: Influence of hypothermia on post-ischemic inflammation: role of nuclear factor kappa B (NFkappaB). Neurochem Int 2006, 49(2):164-169.
Kimura A, Sakurada S, Ohkuni H, Todome Y, Kurata K: Moderate hypothermia delays proinflammatory cytokine production of human peripheral blood mononuclear cells. Crit Care Med 2002, 30(7):1499-1502.
Zhao Y, Patzer A, Herdegen T, Gohlke P, Culman J: Activation of cerebral peroxisome proliferator-activated receptors gamma promotes neuroprotection by attenuation of neuronal cyclooxygenase-2 overexpression after focal cerebral ischemia in rats. FASEB J 2006, 20(8):1162-1175.

No competing interests reported.

Additionalfile1.pdf

Download PDF

Version 1

posted

You are reading this latest preprint version

The Effect of Olanzapine through Antioxidant and Anti-Inflammation on the Hippocampus in the Asphyxial Cardiac Arrest Rat Model

Status:

Version 1

Abstract

Introduction:

Result

Conclusion

Figures

1. Introduction

2. Materials and Methods

2.1. Experimental animals

2.2. Induction of asphyxia cardiac arrest

2.3. Olanzapine treatment and temperature management

2.4. Evaluation of the neurological deficits score (NDS)

2.5. Tissue processing

2.6. Cresyl violet (CV) staining

2.7. Fluro-jade B (F-JB) staining

2.8. Immunohistochemistry (IHC) staining

2.9. Lipid peroxidation analysis for oxidative stress

2.10. RNA extraction, cDNA synthesis, and quantitative real-time PCR (qRT-PCR)

2.11. Western blot analysis

2.12. Statistical analysis

3. Results

3.1. OIH increased the survival rate and attenuated the NDS after ROSC

3.2. OIH reduced neuronal loss in the hippocampus after ROSC

3.3. OIH reduced the expression of GFAP, Iba-1 immunoreactivity after ROSC

3.4. OIH aids in the rapid increase in neurotrophic factors expression

3.5. OIH attenuated the levels of oxidative stress in the hippocampus after ROSC

3.6. OIH reduced the expression of inflammation-associated factors after ROSC

4. Discussion

Abbreviations

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1