Chemicals
The 7, 12-dimethylbenz(a)anthracene (DMBA), was purchased from Sigma chemical company (St. Louis, MO, USA). Sodium alginate [Manutex FAV, ISP Alginates, (UK)], calcium chloride (Merck, Germany), and Tween 20, (Merck KGaA, Darmstadt, Germany). The seeds of Chia and were purchased from Harraz - Agricultural Seeds, Spices & Medical Plants Co. Egypt and were characterized in the Egyptian agricultural museum.
Oil Extraction
Oil was extracted from 500 g of seeds powdered by soaking them in petroleum ether 40–60. The rotary evaporator was used to evaporate the solvent under a vacuum at 35°C. The extraction was carried out until it was exhausted. To create saponifiable fractions for GC/MS analysis, the dried solvent-free extract was employed (El Makawy et al. 2022).
2.2 Unsaponifiable compounds isolation
Oil was saponified by heating 5 g of oil at 95°C for 1 hour while being mixed with 50 ml of 1 N ethanolic KOH. 100 cc of distilled water was added when the mixture had cooled, and it was thoroughly mixed. The resultant solution was extracted twice using 100 ml of diethyl ether in a decanter funnel. Every extraction stage involved collecting the top organic layer, washing it two times with 75 ml of distilled water, once with 100 ml of 0.5 N ethanolic KOH, and then neutralizing it with 100 ml of distilled water. After that, the organic layers was dried with Na2SO4 and the solution was filter and evaporated using a vacuum oven at 45°C (Tavakoli et al. 2019).
Nanocapsules Preparation and characterization
Sodium alginate solution was used as the aqueous phase in the manufacturing process of nanocapsules according to El makawy et al. (2022). Transmission Electron Microscopy (TEM) was applied to assess the nanocapsule's dimensions and morphology.
Animals
The experiment of the study was done on 96 healthy female Wistar rats from the National Research Centre animal house, weighing between 130 and 150 g. They were exposed to a 12-h day/night cycle at an ambient temperature of 22 3°C, and humidity of 50 ± 10% with free access to food and water. Animals was kept for acclimatization for about 14 days. In all animal operations, the handling and use of experimental animals was done in accordance with the standards set by the National Institutes of Health (NIH) and the Committee for the Purpose of Control and Supervision of Experiments on Animals (CPCSEA). All experiments were performed in line with the ethical guidelines approved by the Medical Research Ethics Committee of the National Research Centre, Egypt of Experimental Animals (No.19164).
Experimental design
Firstly, thirty-six rats were distributed to 6 groups, 6 rats each, and treated as the following: distilled water and considered as negative control; 100 mg/kg b.w. corn oil as vehicle; 100 & 200 mg/kg b.w. Quinoa oil nanocapsules; 100 &200 mg/kg b.w. Chia oil nanocapsules. Secondly, sixteen female rats were injected subcutaneously into the mammary region with a single dose of 80 mg/kg b.w. DMBA dissolved in 0.5 ml corn oil. Then after four months of treatment, rat breast cancer models were divided into six groups of 10 animals each: DMBA group animals remained without treatment; 5-FLU group in which animals were managed with a dose of (20mg/Kg b.w./day) 5-fluorouracil; Chia oil nanocapsules two groups were treated with Chia oil nanocapsules (100 & 200mg/kg b.w./day); the other two groups were administered with Quinoa oil nanocapsules at a dose of (100 & 200mg/kg b.w./day). For all treatments the animals were administrated orally for one month.
Anesthesia and tissue collection
Once the course of treatment has ended, the rats have anesthetized through IP injections of xylazine (40 mg/kg b.w.) and ketamine (4 mg/kg b.w.) according to Bhatia et al. (2022). According to Jekl et al. (2005) blood was withdrawn from the inferior vena cava in heparinized tubes and centrifuged for 10 minutes at 5000 rpm. Then plasma was collected and retained in aliquots at -80°C. Besides, rats were killed by cervical dislocation, and afterward, PBS was pumped into them to collect the required tissues.
Determination of the serum biochemical parameters
Activities of enzyme markers of liver and kidney, including alanine aminotransferase (ALT) and aspartate aminotransferase (AST), alkaline phosphatase (ALP), creatinine, uric acid, urea and albumin in serum were determined. All the analyses were performed in triplicate for every sample using available commercial kits from Bio diagnostic company (Egypt).
Quantification of TNF-α in mammary gland tissues as measured by ELISA
The level of TNF-α was determined by enzyme-Linked Immunosorbent Assay (ELISA) test using rat tumor necrosis factor α (TNF-α) kit (SL 0722Ra, Sunlong Biotech Co., Ltd) as described by the kit manufacturer.
Assessment of PIK3CA and MYC gene expression by quantitative real-time PCR
Samples of inguinal mammary glands were homogenized in Easy red total RNA extraction kit (Intronbio, Korea) then RNA was extracted according to the manufacturer’s instructions. The yield and quality of RNA was analyzed using NanoDrop™ 1000 Spectrophotometer (Thermo Fisher Scientific, USA) and gel electrophoresis. RNA (1000ng) was treated with RNase-free DNase kit (Promega) to remove any genomic DNA contamination then cDNA was synthesized using First Strand cDNA Synthesis Kit (Thermo Scientific). Two oncogenes (PIK3CA, MYC) were used in the study and glyceraldehyde-3-phosphate dehydrogenase (GADPH) was used as internal control (Table 1). qRT- PCR was performed in 15 µL reaction containing cDNA, TOPreal™qPCR 2X PreMIX (SYBR Green with low ROX) (Enzynomics), forward and reverse primers (10 pmol/µl) (Macrogen), and nuclease-free water. Resulted data were normalized to GAPDH and analyzed using the 2 − ΔΔCTmethod (Livak and Schmittgen 2001).
Table 1
Sequence of primers used in the study
Gene | Primer | Accession no. | Product size |
PIK3CA | CCT TGT TCT AAT CCC AGG TG GGA CAG TGT TCC TCT TTA GC | NM_133399.3 | 134 |
MYC | GCT CTC CGT CCT ATG TTG CG TCG GAG ACC AGT TTG GCA G | NM_012603.2 | 235 |
GAPDH | AACTTTGGCATTGTGGAAGG ACACATTGGGGGTAGGAACA | NM_017008.4 | 223 |
Histopathological Tissue preparation and Cell cycle analysis:
Inguinal mammary gland samples were fixed for 72 hours in 10% neutral-buffered formalin, then dehydrated using alcohols, cleaned with xylene, and embedded in paraffin wax. Using a microtome, 5-m thick sections were sliced and stained with Feulgen. The image analysis of stained DNA using the computerized Leica Qwin 500 Image analyzer (LEICA Imaging Systems Ltd, Cambridge, UK). Cell cycle analysis was performed on a real-time image from the microscope that we visualized on the video monitor. The normal control samples were analyzed first to establish the reference values. The optical density of the selected nuclei in each microscopic field is measured and automatically converted by the system into a cell phase in the life cycle. Up until the appropriate number of nuclei (100–150) was measured, numerous fields were chosen. Percentages of cells in the first growth phase (G1), proliferating cells (S) and second growth phase (G2) were calculated and determined automatically by the system.
Statistical analysis
The statistical analysis was carried out using SPSS software (SPSS, IBM, Chicago, IL, USA). The results were displayed using means and standard error of means (SEM). Analysis of variance (ANOVA) and Duncan post hoc descriptive test was used in the statistical analysis, with p ≤ 0.05 being recorded as statistically significant.