Ethics statement
This study was performed with the approval of the Ethics Committee of Tianjin Medical University General Hospital. All animal experiments were performed under strict adherence with the Guide for the Care and Use of Laboratory Animal by International Committees.
Microarray Data Analysis
Gene expression data sets GSE34095, GSE63492 and GSE45856 were downloaded from Gene Expression Omnibus. For human NP cells in GSE34095, three degenerative samples were collected from IVDD patients and 3 non-degenerative samples were considered to be control group. MicroRNA expression profiling of GSE63492 was obtained from 5 IVDD patients, compared with 5 cadaveric discs. In relation to the miRNAs in GSE45856, three IVDD specimens and 3 traumatic intervertebral disc specimens were individually analyzed using microarray techniques. After data conversation and normalization[14], we performed differential analysis between degeneration samples and control [15]. We set |Log (fold change)| > 1 and adjust P value < 0.05 as the thresholds to screen out DEGs and differentially expressed miRNAs. Then, the target genes of the differentially expressed miRNAs were predicted by combining two online miRNA databases, miTarBase [16] and targetscan (http://www.targetscan.org).
Functional enrichment analysis of DEGs and target genes
In order to identify the underlying biological functions in IVDD, Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis was performed on the DEGs using Database for Annotation, Visualization, and Integration Discovery (DAVID) database (https://david.ncifcrf.gov/) [17].
Protein-protein interaction (PPI) network construction
The Search Tool for Retrieval of Interacting Genes (STRING) online tool was utilized to construct the PPI of DEGs. A confidence score > 0.4 was representative of statistical significance. Then, the visualization of PPI network was performed by Cytoscape software.
Animal grouping and modeling
A total of 25 male Sprague-Dawley (SD) rats (3 months old, 180 ± 20 g) were from the medical science experimentation center, SUN YAT-SEN UNIVERSITY (Guangzhou, China). The rats were raised individually and freely to eat and drink under 25°C conditions with humidity of 50~70% for one month. Next, 15 rats were randomly included in the IVDD group, while the remaining 10 rats were included in the normal group. The rats were anaesthetized by intraperitoneal injection with 3% pentobarbital sodium (40 mg/kg, P3761, Sigma-Aldrich Chemical Company, St Louis MO, USA). A longitudinal incision was made along the mid line of the rats back. After incision of subcutaneous tissues, the fascia surrounding the intervertebral disc was isolated and the sacrospinalis was then stripped. The spinous process (L1-6) was excised with the interlaminar ligaments cut in order to establish the IVDD rat model. Rats of the normal group were only subject to an incision of the subcutaneous tissue and suture after their operation followed by a return to normal feeding. The rats were injected with 80, 000 U/d penicillin over a period of three days. After 3 months, the rats were euthanized through an intraperitoneal injection of excessive anesthesia for follow-up experiments.
Assessment of IVDD models
Three months after the operation, microcomputed tomography (micro-CT) and magnetic resonance imaging (MRI) were used to assess the alterations to disc height and vertebral endplate with degeneration. Three rats chosen randomly from both IVDD group and normal group were euthanized through an intraperitoneal injection of excessive anesthesia. Subsequently, micro CT and sagittal T2-weighted images were obtained using SkyScan 1172 (SkyScan, Belgium) and 3.0-T MRI scanner (GE, Chicago, USA), respectively. Then, their respective intervertebral discs (L1-6) and adjacent vertebrae were collected. Histological staining including hematoxylin-eosin (HE) and safranin-O/Fast-greening staining was performed for assessment of cell morphology, extent of endplate ossification, and cartilage matrix of the endplate.
Immunohistochemistry
Three rats were randomly selected from both the IVDD and normal groups. After euthanasia, rat intervertebral disc samples were fixed with 10% formaldehyde and later cut in a successive manner into 4 μm slice sections. The sections were permitted to react with diluted RAD21 (1: 500, ab154769, Abcam, Inc, MA, USA), RAD21 (1: 100, ab109496, Abcam, Inc, MA, USA), and BUB1B (1: 200, ab54894, Abcam, Inc, MA, USA). As for Collagen II, the climbing flake of NP cells treated for 7 d were taken, added with diluted Collagen II (1: 500, ab34712, Abcam, Inc, MA, USA). And then uniformly, the sections were added with biotin-labeled goat anti-mice secondary antibody (A21020, Abcam, USA), horseradish peroxidase-labeled streptavidin working solution (DF7852, BIOSAMITE, Shanghai, China) and diaminobenzidine (DAB) to be observed under a light microscope.
Real-Time quantitative Polymerase Chain Reaction
Three rats were randomly selected from both the IVDD and normal groups. Then, total RNA was extracted using the trizol method. RNA was reversely transcribed into cDNA using the Takara reverse transcription kit (RR047, Takara Biotechnology Ltd., Dalian, China). RT-qPCR was performed with instructions of SYBR®Premix Ex TaqTM II kit (Takara Biotechnology Ltd., Dalian, China). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the internal reference.
The primer sequences were listed as follows: RAD21: CAGAGTAGAAGAGATAACCATGAG, ATTCCAAAGTCACCGAAGTC; NDC80: TGCTATGAGAAGTTCATGACTG, ATACAAGTCCTTCAGCTTCG; BUB1B: CCATGATAAAGGCATCTTCTCAG, AGTCCTCATTCAGACGCTC; Aggrecan: GCTACGGAGACAAGGATGAGTTC, CGTAAAAGACCTCACCCTCCAT. GAPDH: AACTCCCATTCTTCCACC, TTGTCATACCAGGAAATGAGC; The 2-ΔCt methods was used to calculate RNA relative quantitative results.
Isolation and cultivation of NP cells
The NP cells were collected from the remaining IVDD rats intervertebral discs (L1-6) that was digested with 0.25% trypsin (25200-056, Gibco Company, Grand Island, NY, USA) for 15 min at 37°C. The collected cells were then seeded into a 25 mm2 culture flask with a density of 2 × 104 cells/mL and cultured in a 5% CO2 incubator added with dulbecco's minimum essential medium (DMEM) medium (C11330500BT, Invitrogen, Car, Cal, USA) containing 3% fetal bovine serum (FBS) at 37°C. The third generation of NP cells were used for the following experiments.
Cell grouping and transfection of Small Interfering RNA (siRNA)
Based on the total mRNA sequences of NDC80, BUB1B and RAD21 genes (NM_006101, NM_001211 and NM_006265) in Genbank, the RNAi oligonucleotide sequences of NDC80, BUB1B and RAD21 genes (three pairs of sequences per siRNA) and the negative control (NC) sequences were designed and synthesized by Guangzhou RiboBio Co., Ltd. (Guangdong, China). The NP cells were subsequently assigned into the blank group (no transfection), NC group (transfected with empty vector), siRNA-NDC80 group (transfected with siRNA-NDC80-1/2/3), siRNA-BUB1B group (transfected with siRNA-BUB1B-1/2/3) and siRNA-RAD21 group (transfected with siRNA-RAD21-1/2/3). The siRNA with the highest transfection efficiency was selected from the 3 pairs of siRNA-NDC80, siRNA-BUB1B and siRNA-RAD21. The primer sequences for siRNA-NDC80, siRNA-BUB1B, siRNA-RAD21 are listed as follows:siRNA-NDC80-1:GCATATGAACTAGCTACTT; siRNA-NDC80-2: GCTCTCTCCTTCTGCCTTA;
siRNA-NDC80-3: GCATCTACTCAGCCTCTAA; siRNA-BUB1B-1 GCAATGAGCCTTTGGATAT; siRNA-BUB1B-2: GCTGAAGAGTACGAAGCTA; siRNA-BUB1B-3: CCAGTGTGCTTCCCAACTT; siRNA-RAD21-1: GCCCATGTGTTTGAGTGTA; siRNA-RAD21-2: CCGCATCTATCACAGGAAA; siRNA-RAD21-3: CGGCTTATAATGCCATTA; siRNA-NC: UUCUCCGAACGUGUCACGA.
The NP cells were then implanted into a 6-well plate at a density of 2 × 105 cells/well with each well added with 1.3 mL serum-free Opti-MEM (31985-070, Gibco Company, Grand Island, NY, USA). Next, 5 µL lipofectamine 2000 (Invitrogen Inc., Carlsbad, CA, USA) with 3 μg of siRNA expressing plasmid were dissolved with 100 µL serum free Opti-MEM culture medium respectively, mixed and permitted to stand at 37°C for 5 min. After that, products were added into the corresponding wells with each well containing 200μL corresponding products. Then, the products were placed in incubator for 5 h, and exchanged with a fresh complete medium. Finally, the cells were collected after 48-h of transfection.
3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay
Cells at the logarithmic growth phase and in a well-grown state were seeded into a 96-well culture plate at a volume of 100 μL per well with 1 × 10 4 cells per well. After cell adherence for 24 h, they were placed into a 5% CO2 incubator at 37°C for further 24 h, 48 h and 72 h incubation. Later, 20 μL MTT solution (5 mg/mL) was added into each well for incubation purposes at 37°C for 4 h. After removal of the supernatant, each well was added with 100 μL dimethylsulfoxide (DMSO) and oscillated for 10 min. The OD value of each well at 490 nm was used to drawn the growth curve.
Flow cytometry
After 48h of transfection, the culture medium was discarded and the cells concentration was adjusted to 1 × 106 cells/mL. The cells stained with propidium iodide (PI) containing RNase (GR1-25, SBS Genetech, Beijing, China) were detected at 488 nm using a flow cytometer (FACS Calibur, Becton, Dickinson and Company, New Jersey, USA) to cell cycle. The transfected cells at the logarithmic growth phase were used to detect cell apoptosis. According to the instructions of Annexin-V-FITC/PI apoptosis kit (KA3805, Abnova, Walnut, CA, USA), flow cytometry at 488 nm using the 515 nm and 560 nm band pass filter to examine the FITC fluorescence and PI fluorescence, respectively.
Statistical analysis
One-way analysis of variance (ANOVA) was used for comparisons among multiple groups with SPSS 21.0 software. Data were expressed as mean ± standard deviation, and p < 0.05 was regarded as statistically significant.