Expression Analysis In Geo Database
Gene Expression Omnibus (GEO) datasets (http://www.ncbi.nlm.nih.gov/geo/) were explored to obtain data from BC patients [12]. Besides microarray, data of tumor grade, stage and progression were needed. The GSE13507 series was select, offering data of 165 BC patients [13]. GEO2R, an R-based web tool used to analyze GEO data, was used to obtain values of relative expression of AHR, CYP1A1, CYP1A2, and CYP1B1. To separate the patients among the two groups (low and high expression of the target genes), a cutoff point was determined for each gene based on the median or ROC curve predicting tumor progression. Correlation analysis was performed confronting the relative expression of the target genes with clinicopathological features (gender, age, tumor grade, stage, and progression).
Cell Culture
Human bladder cancer T24 cells and RT4 cells (HTB-4 and HTB-2, respectively; American Type Culture Collection-ATCC, Manassas, VA, USA) were acquired from the Cell Bank of the Federal University of Rio de Janeiro. T24 cells were cultured in RPMI 1640 Medium (Vitrocell, Campinas, Brazil) supplemented with 10% fetal bovine serum (FBS) and penicillin-streptomycin (Sigma-Aldrich, St. Louis, MO) and maintained at 37 °C with 5% CO2.
To analyze the effect of IDO inhibitors on the expression of AHR and CYP1A1, RT4 and T24 cells were incubated with 1 µM INCB024360 (INCB, Tocris Bioscience, Bristol, UK) or 1 mM 1-methyl-D-tryptophan (MT, Sigma-Aldrich, St. Louis, MO) for 48 hours. INCB was dissolved in DMSO (Sigma-Aldrich, St. Louis, MO) for a 1 mM stock solution. MT was dissolved in 0.1 N NaOH for a 20 mM stock solution and then neutralized to ph 7.4 with 0.1 N HCl.
Cells were incubated in 6-well plates at 80% confluence. At this time, the medium was refreshed by containing IDO inhibitors was added. After 48 hours, the cells were pelleted and frozen at nitrogen and then at -80° C for RNA extraction. Supernatant was collected and maintained at -80° C for kynurenine measurement. The experiments were carried out in triplicate and repeated three times at different times.
Kynurenine Measurement
HPLC was performed to measure kynurenine in the cell culture supernatants. Deproteinization of the samples was performed by centrifugation at 5,000 g (15 min at 4⁰C) with 10% trichloroacetic acid (1:1, v/v). After centrifugation, the supernatants and the standards were filtered through a 0.22 µm syringe-loaded filter and resolved with a mobile phase of acetonitrile plus sodium acetate buffer (4:96, v/v), pH 4.7. A precolumn of 12.5 × 4.6 mm and a C18 column (695970-902, Poroshell 120, EC-C18, 4.6 × 100 mm, 4um, Agilent Technologies, Santa Clara, CA, USA) were used. The peak representing kynurenine was detected with the 1220 Infinity II LC Gradient System (G4288B, Agilent Technologies, Santa Clara, USA). A standard curve was constructed to determine the concentration of the samples (0.5 µM, 1.0 µM, 2.0 µM, 4.0 µM, 8.0 µM, and 16.0 µM).
Real-time PCR
Total RNA was extracted from cultured cells using the PureLink® RNA mini kit (12183018A, Invitrogen, California, USA) and PureLink® RNA micro kit (12183016, Invitrogen, California, USA). For cDNA synthesis, SuperScript III Platinum SYBR Green One-Step qRT-PCR Kit (Invitrogen, California, USA) was used. SYBR Green kit (Invitrogen, California, USA Biosystems, California USA) was used in combination with specific primers for IDO1 (sense 5’GGTCATGGAGATGTCCGTAA3’ and antisense 5’ACCAATAGAGAGACCAGGAAGAA3’; NM_002164.5), AHR (sense 5’ ACATCACCTACGCCAGTCGC3’ and antisense 5’ TCTATGCCGCTTGGAAGGAT 3’; NM_001621.4), CYP1A1 (sense 5’ CTATCTGGGCTGTGGGCAA 3’ antisense 5’ CTGGCTCAAGCACAACTTGG 3’; NM_000499.4), and Tata box protein (TBP) as housekeeping (sense 5’ TTCGGAGAGTTCTGGGATTGTA3’ and antisense 5’TTCGGAGAGTTCTGGGATTGTA 3’; NM_003194.4). Triplicate of each sample was heated at 95 °C for 5 min for denaturation, followed by 40 cycles of denaturation at 95 °C for 15 sec, annealing at 60 °C for 60 sec and extension at 60 °C for 60 sec. Reactions were performed in the Applied Biosystems 7500 Real-Time PCR System (Applied Biosystems, Ca, USA). Cycle threshold (Ct) was determined for the housekeeping gene (TBP) as well as target genes using the auto baseline and auto threshold conditions. Normalized gene expression data were made using ΔΔCt (ΔCt reference- ΔCt target) and the formula 2-ΔΔCt.
Statistical analysis
The data of the GEO datasets were presented as median with the maximum and minimum or mean and standard deviation. Kolmogorov-Smirnov test was used to verify sample distribution. The analysis of nominal or categorized variables was performed using the chi-square test. To categorize a continuous or ordinal variable, we used the best cut-off point established using an ROC curve and the Youden’s index [14]. For the in vitro data, test-T or ANOVA with post hoc Tukey method was used for analysis between groups. A p < 0,05 was considered significant. IBM SPSS Statistics for Windows (Version 22.0 from IBM Corp. Armonk, NY, USA) was used for statistical analysis and GraphPad Prism (version 6; GraphPad Software, Inc.) for graphing.