Detection and Characterization of Carbapenem resistant Gram-negative bacilli isolates recovered from hospitalized patients at Soba University Hospital, Sudan

doi:10.21203/rs.3.rs-31964/v1

Background:

Antimicrobial resistance (AMR) poses a threat to global health security. Whilst over the past decade, there has been an increase in reports of nosocomial infections globally caused by carbapenem resistant Gram-negative bacilli (GNB), data from Africa have been scanty. We performed a study of carbapenem resistance genes among GNB isolated from patients treated in hospitals in Khartoum state, Sudan.

Methods:

A cross-sectional study was conducted at Soba University Hospital (SUH) and Institute of Endemic Diseases, University of Khartoum for the period October 2016 to February 2017. A total of 206 GNB isolates from different clinical specimens were analyzed for carbapenem resistance genes using phenotypic tests and affirmed by genes detection. Multiplex PCR was performed for each strain to detect the carbapenemase genes, including the blaNDM, blaVIM, blaIMP, blaKPC, and blaOXA-48. In addition to blaCTXM, blaTEM and blaSHV. DNA sequencing and bioinformatics analysis were used to detect genes subtypes.

Findings:

Of 206 isolates, 171 (83%) were confirmed resistant phenotypically and 121 (58.7%) isolates were positive for the presence of one or more carbapenemase gene. New Delhi metallo-β-lactamase (NDM) types were the most predominant genes, blaNDM 107(88.4%). Others included blaIMP 7 (5.7%), blaOXA-48 5(4.1%), blaVIM 2 (1.6%) and blaKPC 0 (0%). Co- resistance genes with NDM producing GNB were detected in 87 (81.3%) of all blaNDM positive isolates. A significant association between phenotypic and genotypic resistance was observed (P- value < 0.001). NDM-1 was the most sub type was observed in 75 isolates (70 %), other subtypes were NDM- 5 and NDM-6. Infections due to Carbapenem resistant GNB are increasing at SUH, with the blaNDM being the prevalent genes among clinical isolates and belong to the Indian lineage.

Conclusions:

The frequency of carbapenemase producing bacilli was found to be improperly high in Khartoum hospitals. NDM was found to be the most prevalent carbapenemase gene among clinical isolates. Close surveillance across all hospitals in Sudan is required. The relative distribution of Carbapenemase genes among GNB in nosocomial infections in Africa needs to be defined.

General Microbiology

Infectious Diseases

Sudan

hospitalized patients

antibiotic resistance

Carbapenems

Carbapenemase resistant genes

The prevalence and distribution of antimicrobial resistant bacterial infections in the nosocomial setting in Africa is poorly defined (1, 2). Carbapenems are important broad-spectrum β-lactam antibiotics widely prescribed for the curing of multidrug-resistant Gram negative bacilli in systemic infections. Carbapenems have been considered as a robust antibiotic to treat the extended spectrum β-lactamases (ESBLs) in the past ten years (3). ESBLs are one of the most common β-lactamases encoding resistance genes distributed among Gram negative bacilli through plasmids and transposons (4) and the novel β-lactamases with direct carbapenem-hydrolyzing activity has contributed to an increased prevalence of carbapenem resistant Enterobacteriaceae (CRE), which is causing therapeutic failure worldwide (5). Carbapenemase enzymes include New Delhi Metallo-beta-lactamase (𝑏𝑙𝑎NDM), veron integron metallo-beta-lactamases (𝑏𝑙𝑎VIM), imipenemase (𝑏𝑙𝑎IMP), Klebsiella pneumoniae carbapenemases (𝑏𝑙𝑎KPC), and oxacillinase-48 (𝑏𝑙𝑎OXA-48 ) (6). These enzymes are encoded by what is termed carbapenem resistance determining genes (CRDG), which hydrolyze β-lactam drugs including carbapenems and other β-lactam agents (7). Moreover resistance to carbapenem can occur by other mechanisms including overproduction of ESBL or AmpC enzyme in combination with porin mutations by reduced outer membrane permeability and activation of multidrug efflux pumps in response to antibiotic exposure (8). Carbapenem resistance genes enhance the mechanism of antibiotic resistance among Enterobacteriaceae and non-lactose fermenting Gram-negative bacilli in consequence of the selective pressure assessed by inadequate use of carbapenem and third generation cephalosporins (9). Moreover plasmids coding for carbapenemases may carry co-resistance genes for other β-lactam and non β-lactam antibiotics (7).

Detection of carbapenemase producing isolates by clinical Microbiology laboratory is essential to provide appropriate therapy and update therapeutic guide-lines for the clinicians. Furthermore the use of molecular analysis to detect resistance genes provides evidence on clinically observed treatment failure. Whilst over the past decade, there has been an increase in reports of nosocomial infections globally caused by carbapenem resistant Gram-negative bacilli (GNB), data from Africa have been scanty and antimicrobial stewardship is not optimally practiced. We performed a study of carbapenem resistance genes among GNB isolated from patients treated in hospitals in Soba University Hospital Khartoum state.

Study design and clinical Isolates

A cross-sectional laboratory based study was conducted at the Microbiology department in Soba University Hospital and institute of Endemic Diseases, University of Khartoum; involving Gram negative clinical bacterial isolates, suspected as carbapenemase producing based on carbapenem sensitivity testing zone inhibition (zone size less than 20 mm). These were isolated from cultures of varios clinical specimens: blood, urine, wound swabs, sputum, tips of catheters, and other body fluids, between 1st October 2016 and 25th February 2017 from hospitalized patients in Soba University Hospital. Quality control strains [E. coli (ATCC #25922) and P. aeruginosa (ATCC #27853)] used in antimicrobial susceptibility testing and the biochemical test had been used for primary identification (10). Molecular identification (PCR) was used for all study isolates to confirm the biochemical identification using species specific primers for Klebsiella pneumoniae, Escherichia coli, Pseudomonas aeruginosa and Acinetobacter baumannii. A universal primer (16SrRNA) was used for identification of unknown species by biochemical tests. Table.1. All isolates were stored in 20% glycerol at -20 °C until use.

Subculturing and Disk Diffusion Susceptibility Testing

Isolates were subcultured on blood agar (BA) and then subjected to susceptibility testing to the following antimicrobials: amoxycillin clavulanate (AMC) (30 µg); cefuroxime (CXM)(30 µg); cephalexin (CL)(30 µg); ceftriaxone (CRO)(30 µg); ceftazidime (CAZ) (30 µg); cefotaxime (CTX)(30 µg); meropenem (MEM)(10 µg); imipenem (IPM) (10 µg); amikacin (AK)(30 µg); gentamicin (Gen)(10 µg); ciprofloxacin (CIP)(5 µg); trimethoprim-sulfamethoxazole (SXT)(25 µg); temocillin (TEM)(30 C); azteroname (AZT)(30 µg). The Kirby Bauer (disk diffusion) was performed; each isolate was swabbed on to Muller-Hinton agar and the antibiotic discs were placed on top, incubated at 37 ̊ C for 18–24 hours and interpreted according to Clinical and Laboratory Standards Institute (CLSI) guidelines (11).

Phenotypic screening and confirmatory test for carbapenemase

Bacterial isolates were screened for carbapenemase production according to CLSI guidelines (CLSI, 2017). In this method, carbapenem, meropenem (MEM) and imipenem (IPM) discs (10 g, each) (Mast Diagnostic, UK) were used. Isolates that showed a zone of inhibition ≤ 20 mm in diameter for meropenem were considered as suspected carbapenemase producers. Phenotypic confirmatory test for carbapenemases production were applied by boronic acid synergy test for class A β-lactamases, the EDTA synergy for Metallo-β-lactamase and the Modified Hodge Test (MHT) for detecting KPC and OXA-48 producers (12).

Detection of Carbapenemase encoding genes

PCR was carried out using a thermal cycler and the following primers (Macrogen, Korea), bla VIM, bla IMP, bla NDM, bla NDM-1, bla KPC, bla OXA-48, blaTEM, bla SHV and bla CTX-M genes Table 2. The reaction was carried out in a total reaction volume of 25 µl (5 µl Master mix of Maxime RT premix kit) (8). The purity and integrity of each PCR product was evaluated and the specific amplified product was detected by comparing with standard DNA ladder.

DNA Sequencing

The PCR product of bla NDM genes and 16srRNA were purified and Sanger sequencing was performed by Macrogen Company (Seoul, Korea).

Bioinformatics Analysis

First of all we ensure the ambiguous sites are correctly called and determined the overall quality of the sequences proofed the nucleotides chromatogram by using Finch TV software version 1.4.0 (http://www.geospiza.com/Products/finchtv.shtml). Then nucleotides sequences of the NDM genes achieved were searched for sequence similarity using nucleotide BLAST (13) (http: //blast.ncbi.nlm.nih.gov/Blast.cgi). Multiple sequence alignment for highly similar sequences, were retrieved from NCBI using the MEGA version 7 software (14). Phylogenetic tree of bla NDM genes and their evolutionary relationship with those obtained from database were conducted using MEGA version 7 (14).

Statistical analysis

Data were analyzed using SPSS software version 20.0. Cross tabulation was used to present the relationships between data of antimicrobial sensitivity, phenotypic tests and resistant genes detection among the study isolates, qualitative data were performed through χ2test, and significance was set at p ≤ 0.05.

Demographic distribution

The demographic characteristics of patients under study and the frequency of GNB isolates according to age groups are shown in (Figure.1). The most of the isolates were from neonates less than one year old in 42.5% followed by adult group between 13–80 years 38.3% and 19.5% for age group between 1–12 years. Males 53.4% (110/206) were predominant among admitted wards patients and females 46.6% (96/206).

Antimicrobial susceptibility

The antibiotic resistance pattern is shown in (Fig. 2). Out of 206 isolates tested, the highest percentage of resistance 98%, 93.5% were found in ampicillin and cephalexin respectively, followed by amoxicillin clavulanic acid 90%, cefotaxime 89.7%, ceftriaxone 88.4%, ceftazidime 84.2% and aztreonam 66%, temocillin 64%, Sulfamethoxasole-trimethoprim 78.4% and nitrofurantoin 75.2%. The resistance rate was also higher in ciprofloxacin 83.1%, gentamicin 85% and amikacin 70%. High resistant rate associated with meropenem 63.1% and imipenem 61.6%.

Prevalence of carbapenemase producing Gram-negative bacilli based on phenotypic tests

Carbapenemase activity was detected in 171 (83%) of the 206 clinical isolates, which were positive for the production of one or more carbapenemase enzymes by phenotypic methods as the following 24 (14%) by MHT method and Boronic acid screen, 105 (61.5%) by the EDTA test and 42 (24.5%) of the isolates were positive for both EDTA and Boronic acid methods. Details of the carbapenemase activity among different isolates by phenotypic tests are shown in Table 3. This suggests that the MBL type is the most prevalent type of carbapenemase hydrolysis enzyme among Gram-negative bacilli in Khartoum state, OXA and KPC types are present at a low level.

Prevalence and distribution of Carbapenemase genes among Gram negative bacilli

Carbapenemase genes were detected in 121 (58.7%) of the 206 study isolates using PCR, one or more carbapenemase genes were detected in the isolates. blaNDM was the most commonly detected among the isolates, mainly in K. pneumonia, which was the species with the highest number of these genes. blaNDM was also detected more often in A. baumannii, P. aeruginosa and E. coli. The most prevalent gene was blaNDM 107(88.4%), followed by blaIMP 7 (5.7%), blaOXA-48 5(4.1%), blaVIM 2 (1.6%) and blaKPC 0 (0%). ESBL were detected among these isolates, it showed a high prevalence in 183 isolates (88.8%) as the following blaCTXM 127(61.6%), blaSHV 84(40.7%) and blaTEM 80(38.8). The genes were unevenly distributed among the different study isolates. For more details, see Table 4.

Co resistance genes carried with NDM gene among Gram-negative bacilli

Many isolates carried more than one gene with blaNDM gene. Co-resistance carbapenemase genes were observed in a small number of isolates, blaNDM + blaOXA-48 were detected in three isolates, while blaNDM + blaVIM and blaNDM + blaIMP were detected in two different isolates. On the other hand, ESBL were often observed together with blaNDM in 87 (81.3%) of blaNDM positive isolates (107). Most of the isolates carried blaNDM with one ESBL gene in (43.5%) as the following; blaNDM + blaCTXM in (24 isolates, 27.6%), blaNDM + blaTEM (8 isolates, 9.1%), and blaNDM + blaSHV (6 isolates, 6.8%). Isolates carried blaNDM with two ESBL genes in (39.2%) as the following: blaNDM + blaCTXM + blaSHV (10 isolates, 11.5%), blaNDM + blaCTXM + blaTEM (10 isolates, 11.5%), blaNDM + blaSHV + blaTEM (14 isolates, 16.2%). Isolates carried blaNDM with three ESBL genes, blaNDM + blaCTXM + blaSHV + blaTEM (15 isolates, 17.3%). The distribution of co resistance genes among different Gram negative bacilli is shown in Table 5.

The frequency of carbapenemase producer Gram-negative bacilli by type of specimens, hospital units and bacteria species isolates.

Carbapenemase producing isolates were more frequently distributed among clinical specimens including blood (36%) and then followed by wounds (24%), urine (21%), body fluids (7%), catheter tips (6%) and sputum samples were (6%).

With regard to the distribution of Carbapenemase producer among hospital units, the most carbapenemase producing isolates associated with patients were found in the neonatal intensive care unit NICU 32(26%), followed by medicine wards 26(22%) and pediatric wards 22 (18%), Surgery 18(15%), ICU 15(12%) and Renal Unit 8(7%). Carbapenemase genes were predominant in Klebsiella pneumoniae isolates: 70(42.6%), followed by Pseudomonas aeruginosa: 33(20%); Acinetobacter baumannii: 30(18.2%) and Escherichia coli 18(10.9%)

Molecular characterization of NDM genes

Out of 107 blaNDM genes detected 75 (70%) were blaNDM-1. Other subtypes of blaNDM were identified by sequencing including blaNDM- 5, and blaNDM-6. (Fig. 3)

Bioinformatics analysis of blaNDM genes

Fourteen samples were sequenced by and all showed 97–100% similarity with blaNDM genes from the NCBI database with accession number MF379688 and MG764089.

Multiple sequence alignment:

The Nucleotide sequences of NDM Deoxyribonucleic acid (DNA) sequences were compared against the DNA databank using BLASTp. Fourteen NDM beta-lactamases genes were compared against the NDM in the database, (http://blast.ncbi.nlm.nih.gov/Blast.cgi), they have produced a significant alignment to NDM-1 beta-lactamase of Klebsiella pneumoniae (gb|MK425054|), and the isolates were shown to have 97–100% identity.

When multiple sequence alignment of NDM proteins was undertaken using MEGA7 software version 7.0.9.0 against similar proteins that obtained from BLASTp, NDM-1 from Sudan were similar to |KX100583.1| Escherichia coli NDM-1 (blaNDM) gene from India and | MH891562| Klebsiella pneumoniae NDM-1 from Bangladesh. NDM-5 from Sudan were similar to | MH991817 |, Escherichia coli NDM-5 from India and | MH168510| Klebsiella pneumoniae NDM-5 from Bangladesh while NDM-6 from Sudan were similar to | MH683607 | Escherichia coli from India, | JN967644 | Escherichia coli from the United States and | JQ235754 | Escherichia coli from New Zealand.

Nucleotide sequence accession number

The sequence of the 14 NDM genes have been deposited in the GenBank database under accession numbers MK033562, MK033563, MK033564, MK363705, MK363706, MK363707, MK363708, MK363709, MK363710, MK371542, MK371543, MK371544, MK37154 5, and MK371546.

Phylogenetic tree

The phylogenetic analysis of the NDM proteins sequences revealed that the NDM-1 and NDM-5 were related to the same NDM lineage as the Indian and Bangladeshi isolates. The NDM-6 gene was found to be close to NDM-6 from India, New Zealand, and the United States as shown in Fig. 3.

Carbapenems have become the drugs of choice for the treatment of severe nosocomial infections caused by Gram-negative bacilli; however, carbapenemase producing Gram-negative bacilli have been reported worldwide. Carbapenem resistant Enterobacteriaceae (CRE) are a considerable health problem worldwide and associated with increased mortality, therefore rapid detection of carbapenem resistance and adequate treatment of such cases is mandatory. This study was undertaken, to determine the prevalence of different types of carbapenemase producing bacteria among Gram-negative bacilli isolated from various hospitalized patients in Khartoum State. The accurate detection of carbapenemase producing microorganisms is challenging for laboratories, it not only requires phenotypic tests but also genotypic tests to detect of all genes associated with carbapenemase production. In the present study, among 206 isolates 171(83%) were positive by phenotypic analysis including isolates with resistance to carbapenem, whilst, genotypic analysis detected 121 (58.7%) positive isolates. This finding indicates that the studied carbapenem resistance is not only associated with enzyme encoding resistant genes but also due to other resistance mechanisms such as overproduction of ESBLs, porin loss or mutation (15, 16).

The current situation according to this study, show that the prevalence of carbapenemase production among different Gram negative isolates is increasing up to (83%). This finding is higher than the incidence in a previous study conducted in Khartoum state in 2017 which showed the prevalence was 56% by phenotypic tests (unpublished data) and other done in 2013 by Ali reported the MBL was 37.7% among Pseudomonas spp. isolates in Khartoum state (unpublished data). This high frequency of MBL in Khartoum state is a result of the excessive use of meropenem in the treatment of patients associated with ESBL infections. This finding agrees with a study in Egypt, which reported that carbapenem resistance rate was 62.7% among Enterobacteriaceae (17). High rates of carbapenem resistance haves also been observed in Uganda in a study conducted by Okoche in 2015. He found 28.6% of isolates were produced carbapenemases (18). In Tanzania the prevalence of carbapenemase producing isolates was 35% (19), in South Africa it was found to be 68% (20). and in Nigeria 11.9% (21). Carbapenem resistance in low and middle income countries in Africa are likely to be increase as long as the use of antibiotics in these countries remains unrestricted and most people consume the antibiotics without a clinical prescription (22).

Carbapenemase genes have been recognized during the past ten years, and these genes are associated with mobile genetic elements that allow their rapid circulation among bacterial isolates, for instance, blaNDM have a potential for rapid spread within the country and to other countries (23). In this study, carbapenemase genes were detected by using PCR in 121 (58.7%) of the study isolates. The most prevalent gene among the isolates was blaNDM (88.4%) mainly in K. pneumonia and other Gram negative bacilli including A. baumannii, P. aeruginosa and E. coli, this agrees with studies in India that reported the blaNDM gene was observed between 31% and 55% of Carbapenemase resistant Enterobacteriaceae (24, 25), and a study in South Africa published the most carbapenemase gene was blaNDM among K. pneumonia (20). BlaNDM-1 was reported as the most common carbapenemase gene in Saudi Arabia and other Middle Eastern countries (26).

Carbapenemase genes are reported to be more frequent in some regions. For example blaKPC genes are dominant in some countries such as Greece, Israel, and USA, while blaNDM genes are prevalent in isolates reported from the Far East, India, and Pakistan (16). Carbapenemase production in Turkey mostly occurs in blaOXA genes (23). OXA-48 was reported first from Turkey, then followed by reports from Middle Asia and Europe (27). In this current study the genes were unevenly distributed among the different study bacterial isolates. In this study, the blaNDM gene was found in high prevalence (88.4%) compared to other genes, such as blaIMP (5.7%), blaOXA-48 (4.1%), blaVIM (1.6%) and blaKPC (0%). Our finding disagrees with many studies, for instance in the Okoche study, the most common gene was blaVIM 1(0.7%), and blaNDM-1 (2.6%) was the lowest gene (18), while Mushi reported IMP types were the most predominant at (21.6%) in his study (19). Other studies reported blaOXA-48 was the most prevalent gene (28, 29). In this study blaKPC wasn’t detected among the isolates, which that disagrees with global reports of high prevalence of blaKPC genes among international isolates (16, 30).

The blaNDM-1 gene was first identified in a clinical isolate of K. pneumoniae in New Delhi, India, and has since been disseminated around the world (31). NDM variants have been described, differing by several amino acid changes. A first variant, blaNDM-2, has been described in an A. baumannii clinical isolate from an Egyptian patient in Germany, blaNDM-4, blaNDM-5 and blaNDM-6 have been detected from E. coli in India and blaNDM-7 from E.coli in France (31). In this study, 107 blaNDM producer isolates had been identified using PCR, the most common subtype 75 (70%) was blaNDM-1. Other subtypes of blaNDM were detected by sequencing including blaNDM- 5, and blaNDM- 6 among different Gram negative bacilli including K. pneumoniae, E. coli, A. baumannii, P. aeruginosa and Enterobacter spp.

Carbapenemase genes are becoming highly distributed among Enterobacteriaceae, A. baumannii, P. aeruginosa and other Gram-negative bacilli. The prevalence of carbapenemase production in each species in this study was highest in A. baumannii (37.3%) followed by K. pneumoniae (27.3%), P. aeruginosa (24.8%) and E. coli (21.1%). This agrees with many studies that reported A. baumannii and K. pneumonia were the most predominant carbapenemase producing isolates (32, 33). The prevalence of carbapenemase producing isolates varies from hospital to hospital. This variation could be attributed to differences in collection time of isolates and differences in study populations and designs. A study in Turkey showed the most carbapenemase isolates were K. pneumoniae (13.6%), Pseudomonas spp. (17.8%), A. baumannii (13.8%), S. maltophilia 7.5% and E. coli 2.8% (34). In Nigeria the highest prevalence of carbapenemase producers was in P. mirabilis (16.0%), then P. aeruginosa, K. pneumoniae (13.3% each) and E. coli (11.5%) (21), while in Tanzania, E. coli was the most prevalent species with carbapenemase production (14%), followed by K. pneumoniae (10.57%), P. aeruginosa (10.13%), K. oxytoca (1.76%) and A. baumannii (1.3%) (19).

Carbapenemase-encoding genes had been commonly associated with bacteria isolated from blood, urine, wounds, and sputum as reported in many studies in Uganda (19), Tanzania (35), Nigeria (21), and India (36). In this study Carbapenem producers were more frequently isolated from blood (39%) followed by wounds (25%) and urine (22%). This is in line with a study in South Africa which reported blood was the most common specimen type (25%), followed by urine (22%) (20).

Many studies considered young patient age as a risk factor for CRE infection which agrees with current finding, that carbapenemase-producing Gram negative bacilli were most frequent in neonate age group isolated from nursery and pediatric wards (26% and 18% respectively). High rates of carbapenem resistant infections were observed among elderly patients from medicine (22%) and ICU (12%), which agrees with another study that found that CRE to be more frequently isolated in the elderly (37).

Carbapenem resistant Gram negative bacilli are usually resistant to other routinely used antimicrobial agents (38–40). The plasmids carrying carbapenemase genes like blaNDM-1 are diverse and can harbor a high number of additional resistance genes (e.g., ESBL-alleles) as well as other carbapenemase genes like blaOxa-48, blaVIM. These plasmids were considered as the source of multidrug resistance in one single bacterium (25, 41). Moreover, mechanisms of resistance to β-lactam by producing ESBL, AmpC and carbapenemase were also noticed among the isolates that produce different combinations of the enzymes. In this study co-resistance of blaNDM with blaOXA-48, blaVIM and blaIMP were reported in few isolates. In connection to co-resistance with ESBL, blaCTXM, blaSHV and blaTEM was detected in high prevalence 87/107 (81.3%) of blaNDM positive isolates. Most of the isolates carried blaNDM with one ESBL gene (43.5%), blaNDM with two ESBL genes (39.2%) and blaNDM with three ESBL genes (17.3%). This agrees with various studies which have reported co-resistance among clinical isolates (42, 43). These co-production genes among some isolates as observed in this study are indicative of the existence of multi-drug resistant pathogens, which are responsible for treatment failure and outbreaks of infections. which impact on treatment outcomes and higher treatment costs (44).

Sudan is a large country which shares its borders with other seven countries. People move freely between these borders with the potential of passaging antibiotic resistance strains. The dynamic movements of the people will make it challenging to monitor AMRs in these countries especially at the boarders. These challenges may also represent an opportunity for a wider continental monitoring collaboration between the countries rather than country- specific. Such approach will aid in universal and intergovernmental initiative to control and limit spread of AMRS.

The increasing numbers of carbapenemase producing bacilli isolated, particularly with the blaNDM carbapenemase genes among clinical isolates and belong to Indian lineage. Improved antibiotic stewardship and infection control measures, and close surveillance across all hospitals in Sudan is required. The relative distribution of distribution of Carbapenemase genes among GNB in nosocomial infections in Africa requires to be defined.

Ethics approval and consent to participate:

Formal permission was obtained from the managers of Soba University Hospital and the Institutional Research Ethics Committee of the Institute of Endemic Diseases, University of Khartoum, approved this study under reference number IEND_REC 12/2017. Patient consent was waived by the Research Ethics Committee.

Consent for publication:

not applicable

Availability of data and materials

The data for the present study, including the genotypes, isolation location and resistance status of each bacterial isolate, will available under request.

Competing interests

All authors have an academic interest in AMR. All the authors declare no other conflicts of interests.

Funding

This research received partial research fund from the Ministry of Higher Education and Scientific Research, Sudan (grant number SUD/MOH/MMAH/08/2016).

Authors’ contributions

HE, KE and MA designed the study. HE carried out the microbiological analysis. HE and HA analysed the data. HE and MA wrote the first draft. MA, KE, EM, HA, FN, LE, TM, MO, JT, FV, GI and AZ were major contributors in revising the manuscript critically for important intellectual content. AZ revised the final draft. MA supervised the work. All authors read and approved the final manuscript.

Acknowledgments

We would like to thank the medical and technical staff of Medical Microbiology Department in Soba University Hospital, University of Khartoum for their help in strain and data collection.

All authors are members of the Pan African Network for Rapid Reserach, Response, and Preparedness for Infectious Diseases Epidemics consortium (PANDORA-ID-NET) -supported by the European and Developing Countries Clinical Trials Partnership (EDCTP2) programme (RIA2016E-1609 ). AZ is in receipt of a National Institutes of Health Research senior investigator award. GI and FV are in receipt grant research from Italian Ministry of Health, Ricerca Corrente Linea 1.received.

Tadesse BT, Ashley EA, Ongarello S, Havumaki J, Wijegoonewardena M. González IJ DS. Antimicrobial resistance in Africa: a systematic review. BMC Infect Dis. 17(1):616.
Kumwenda GP, Sugawara Y, Abe R, Akeda Y, Kasambara W, Chizani K, Takeuchi D, Sakamoto N, Tomono KHS. First Identification and genomic characterization of multidrug-resistant carbapenemase-producing Enterobacteriaceae clinical isolates in Malawi, Africa. J Med Microbiol. 10.1099/jm.
Hall BG, Barlow M. Evolution of the serine β-lactamases: past, present and future. Drug Resist Updat. 2007;7:111–23.
Zowawi H, Balkhy H, Walsh T, Paterson D. β-Lactamase production in key gram-negative pathogen isolates from the Arabian Peninsula. Clin Microbiol Rev. 2013;26(3):361–80.
Codjoe F, Donkor E. Carbapenem Resistance: A Review. Med Sci. 2017 Dec 21;6(1):1.
Nordmann P, Naas T, Poirel L. Global Spread of Carbapenemase- producing Enterobacteriaceae. Emerg Infect Dis. 2011;17(10):1791–8.
Queenan AM, Bush K. Carbapenemases: the Versatile B-Lactamases. Clin Microbiol Rev. 2007;20(3):440–58.
Nordmann P, Gniadkowski M, Giske CG, Poirel L, Woodford N, Miriagou V. Identification and screening of carbapenemase-producing Enterobacteriaceae. Clin Microbiol Infect. 2012;18:432–8.
Moolchandani K, Sastry AS, Deepashree R, Sistla S, Harish BN, Mandal J. Antimicrobial Resistance Surveillance among Intensive Care Units of a Tertiary Care Hospital in Southern India. J Clin diagnostic Res. 2017;11(2):1–7.
Wauters G, Vaneechoutte M. Approaches to the Identification of Aerobic Gram-Negative Bacteria. In: Manual of Clinical Microbiology. 11th ed. Washington, DC; 2015. p. 613–34.
CLSI. M100 Performance Standards for Antimicrobial. 27th ed. 2017. 106–143 p.
Tsakris A, Kristo I, Poulou A, Themeli-digalaki K, Ikonomidis A, Petropoulou D, et al. Evaluation of Boronic Acid Disk Tests for Differentiating KPC-Possessing Klebsiella pneumoniae Isolates in the Clinical Laboratory. J Appl Microbiol. 2009;47(2):362–7.
Atschul S, Madden T, Schaffer A, et al. Gapped BLAST and PSI-BLAST. A new generation of protein database search programmes”. NucleicAcid Res. 1997;25:3389–402.
Kumar S, Stecher G, Tamura K. Molecular Evolutionary Genetics Analysis. Molecular Biology and Evolution; 2016. p. 1870–4.
Huang TD, Bogaerts P, Berhin C, Hoebeke M, Bauraing C, Glupczynski Y. Increasing proportion of carbapenemase-producing Enterobacteriaceae and emergence of a MCR-1 producer through a multicentric study among hospital-based and private laboratories in Belgium from September to November 2015. Eurosurveillance. 2017;1–9.
Pitout JDD, Nordmann P. Carbapenemase-Producing Klebsiella pneumoniae, a Key Pathogen Set for Global Nosocomial Dominance. Anti- microb Agents Chemother. 2015;59(10):5873–84.
Amer WH, Khalil HS, Abd ELWahab MAA. characterization of carpabenem resistant Enterobacteriaceae in Risk factors, phenotypic and genotypic characterization of carbapenem resistant Enterobacteriaceae in Tanta University Hospitals, Egypt. Int J Infect Control. 2016;12:1–11.
Okoche D, Asiimwe BB, Katabazi FA, Kato L. Prevalence and Characterization of Carbapenem-Resistant Enterobacteriaceae Isolated from Mulago National Referral. PLOS. 2015;48:1–11.
Mushi MF, Mshana SE, Imirzalioglu C, Bwanga F. Carbapenemase Genes among Multidrug Resistant Gram Negative Clinical Isolates from a Tertiary Hospital in Mwanza, Tanzania. Biomed Res Int. 2014;3–8.
Perovic O, Micro FSA, Micro M, Britz E, Chb MB, Chetty V. IN PRACTICE Molecular detection of carbapenemase-producing genes in referral Enterobacteriaceae in South Africa: A short report. SAMJ. 2016;106(10):975–7.
Yusuf I, Arzai AH, Haruna M, Sharif AA, Getso MI. Detection of multi drug resistant bacteria in major hospitals in Kano. Brazilian J Microbiol. 2014;45(3):791–8.
Mukonzo J, Namuwenge P, Okure G, Mwesige B, Namusisi O, Mukanga D. Over the counter suboptimal dispensing of antibiotics in Uganda. J Multidiscip Heal. 2013;6:303–10.
Karabay O, Altindis M, Koroglu M, Karatuna O, Aydemir ÖA. The carbapenem – resistant Enterobacteriaceae threat is growing: NDM – 1 epidemic at a training hospital in Turkey. Ann Clin Microbiol Antimicrob. 2016;15:1–6.
Deshpande P, Rodrigues C, Shetty A, Kapadia F, Hedge A, Soman R. New Delhi Metallo-beta lactamase (NDM-1) in Enterobacteriaceae: Treatment options with carbapenems compromised. J Assoc Physicians India. 2010;58:147–9.
Kumarasamy K, Toleman M, Walsh T, Al E. Emergence of a new antibiotic resistance mechanism in India, Pakistan, and the UK: A molecular, biological, and epidemiological study. Lancet Infect Dis. 2010;10:597–602.
Sonnevend Á, Ghazawi A, Hashmey R, Jamal W, Rotimi V, Shibl A, et al. Characterization of carbapenem-resistant Enterobacteriaceae with high rate of autochtho- nous transmission in the arabian peninsula. PLoS One. 2015;10:e0131372.
Gülmez D, Woodford N, Palepou M-F, Mushtaq S, Metan G, Yakupogullari Y, et al. Carbapenem-resistant Escherichia coli and Klebsiella pneumoniae isolates from Turkey with OXA-48-like carbapenemases and outer membrane protein loss. Int J Antimicrob Agents. 2008;31:523–6.
Ibrahim AM, Altayb HN. Phenotypic and genotypic detection of carbapenemase enzymes producing gram-negative bacilli isolated from patients in Khartoum State [ version 1; referees : awaiting peer review ]. F1000Research. 2017;(0):1–8.
Memish Z, Assiri A, Almasri M, Al E. Molecular characterization of carbapenemase production among Gram-negative bacteria in Saudi Arabia. Microb Drug Resist. 2015;21(3):307–14.
Giske CG. Global dissemination of extensively drug-resistant carbapenemase-producing Enterobacteriaceae: clinical perspectives on detection, treatment and infection control. J Intern Med. 2014;501–12.
Bonnin A, Nordmann P. First Identification of Novel NDM Carbapenemase, NDM- 7. Escherichia coli in France. 2013;8(4):1–5.
Doi Y, Paterson DL. Carbapenemase-Producing Enterobacteriaceae. Semin Respir Crit Care Med. 2015;36:74–84.
Zowawi HM, Sartor AL, Sidjabat HE, Balkhy HH, Walsh TR, Johani M, Al. Molecular Epidemiology of Carbapenem-Resistant Acinetobacter baumannii Isolates in the Gulf Cooperation Council States: Dominance of OXA-23-Type Producers. JClinical Microbiol. 2015;53(3):896–903.
Karaaslan A, Soysal A, Gelmez GA, Kadayifci EK. Molecular characterization and risk factors for carbapenem-resistant Gram-negative bacilli colonization in children: emergence of NDM-producing Acinetobacter baumannii in a newborn intensive care unit in Turkey. J Hosp Infect. 2016;92:67–72.
Vanegas JM, Parra OL, Jiménez JN. Molecular epidemiology of carbapenem resistant gram-negative bacilli from infected pediatric population in tertiary - care hospitals in Medellín, Colombia : an increasing problem. BMC Infect Dis. 2016;1–10.
Bhaskar M, Anand R, Harish B. Prevalence of blaNDM-1 producing blood isolates of Escherichia coli, Klebsiella species and Enterobacter species in a tertiary care centre in South India. J Microbiol Res Rev. 2013;1(6):61–8.
Lin MY, Lyles-Banks RD, Lolans K, et al. The importance of long-term acute care hospitals in the regional epidemiology of Klebsiella pneumoniae carbapenemase-producing Enterobacteriaceae. Clin Infect Dis. 2013;57:1246–52.
Yusuf I, Magashi A, Firdausi F, Al E. Phenotypic detection of car- bapenemase in members of Enterobacteriaceae in Kano, Nigeria. Int J Sci Technol. 2012;2(11):802–80.
Levy HG, Gould I, Endimiani A, Al E. Detection, treatment, and prevention of carbapenemase-producing Enterobacteriaceae: recom- mendations from an International Working Group. J Chemother. 2013;25(3):129–40.
Legese M, hailu, Weldearegay gebru M, Asrat D. Extended-spectrum beta-lactamase- and among Ethiopian children. Infect Drug Resist. 2017;10:27–34.
Nordmann P, Poirel L, Toleman MA, Walsh T. Does broad-spectrum B-lactam resistance due to NDM-1 herald the end of the antibiotic era for treatment of infections caused by Gram-negative bacteria? J Antimicrob Chemother. 2011;66(4):689–92.
Zhang X, Chen D, Xu G, Huang W, Wang X. Molecular epidemiology and drug resistant mechanism in carbapenem-resistant Klebsiella pneumoniae isolated from pediatric patients in Shanghai, China. PLoS One. 2018;20:1–10.
43.
Cohen S, Leverstein-Van J, Hall M. Dutch Working Party on the Detection of Highly Resistant Microorganisms. Guideline for pheno- typic screening and confirmation of carbapenemases in Enterobacte- riaceae. Int J Antimicrob Agents. 2010;36(3):205–10.
Srinivasan R, Karaoz U, Volegova M, MacKichan J, Kato-Maeda M, Miller S, et al. Use of 16S rRNA gene for identification of a broad range of clinically relevant bacterial pathogens. PLoS One. 2015;10(2):e0117617.
Liu Y, Liu C, Zheng W, Zhang X, Yu J, Gao Q, et al. PCR detection of Klebsiella pneumoniae in infant formula based on 16S-23S internal transcribed spacer. Int J Food Microbiol. 2008;125(3):230–5.
Sabat G, Rose P, Hickey WJ, Harkin JM. Selective and sensitive method for PCR amplification of Escherichia coli 16S rRNA genes in soil. Appl Environ Microbiol. 2000;66(2):844–9.
Spilker T, Coenye T, Vandamme P, Lipuma JJ. PCR-Based Assay for Differentiation of Pseudomonas aeruginosa from Other Pseudomonas Species Recovered from Cystic Fibrosis Patients Theodore. ASM. 2004;42(5):2074–9.
Higgins PG, Wisplinghoff H, Krut O, Seifert H. A PCR-based method to differentiate between Acinetobacter baumannii and Acinetobacter genomic species 13TU. CMI. 2007;13:1199–201.
Hong D, Bae I, Jang I, Jeong S, Kang H, Lee K. Epidemiology and Characteristics of Metallo-β-Lactamase-Producing Pseudomonas aeruginosa. Infect Chemother. 2015;42(2):81–97.
Suwantarat N, Carroll KC. Epidemiology and molecular characterization of multidrug-resistant Gram-negative bacteria in Southeast Asia. Antimicrob Resist Infect Control. 2016;1–8.
Pasteran F, Mendez T, Guerriero L, Rapoport M, Corso A. Sensitive Screening Tests for Suspected Class A Carbapenemase Production in Species of Enterobacteriaceae. J Clin Microbiol. 2009;47(6):1631–9.
Lartigue M, Poirel L, Decousser J, Nordmann P. Multidrug-resistant Shigella sonnei and Salmonella enterica serotype Typhimurium isolates producing CTXMbeta- lactamases as causes of community-acquired infection in France. Clin Infect Dis. 2005;40:1069–70.
Isturiz RECC. Antibiotic use in developing countries. Infect Control Hosp Epidemiol. 2000;21(6):394–7.

Table 1. Primer used for PCR bacterial identification.

Species specific primers	Primer (5' to 3')	Tm (°C)	Band size (bp)	Ref
Universal 16S rRNA	F=AGAGTTTGATCCTGGCTCAG	58		(45)
Universal 16S rRNA	R= CTACGGCTACCTTGTTACGA	58
K. pneumoniae	Pf = ATTTGAAGAGGTTGCAAACGAT	56		(46)
	Pr1=TTCACTCTGAAGTTTTCTTGTGTTC	56	130
	Pr2 = CCG AAG ATG TTT CAC TTC TGA TT	56	260
E.coli	ECA75F=GGAAGAAGCTTGCTTCTTTGCTGAC	52	544	(47)
E.coli	ECR619R=AGCCCGGGGATTTCACATCTGACTTA	52
Pseudomonas spp.	PA-SS-F =GGGGGATCTTCGGACCTCA	58	956	(48)
Pseudomonas spp.	PA-SS-R =TCCTTAGAGTGCCCACCCG	58
Acinetobacter	sp4F =CACGCCGTAAGAGTGCATTA	58	294	(49)
Acinetobacter	sp4R=AACGGAGCTTGTCAGGGTTA	58
Acinetobacter baumannii	13TU,sp2F=GTTCCTGATCCGAAATTCTCG	58	490

Table 2. Primers used for amplification of resistance genes.

Resistance Genes	Primer (5' to 3')	Tm (°C)	Band size (bp)	Ref
BlaIMP	F=GGAATAGAGTGGCTTAATTCTC	54	189	(50)
	R=CCAAACCACTACGTTATC	54
BlaVIM	F=GGTCTCATTGTCCGTGATGGTGA TGAG	56	272	(50)
	R=CTCGATGAGAGTCCTTCTAGAG	56
BlaNDM	F=GGTTTGGCGATCTGGTTTTC	56	621	(50)
	R=CGGAATGGCTCATCACGATC	56
BlaNDM-1	F=TCTCGACATGCCGGGTTTCGG	56	580	(51)
	R=ACCGAGATTGCCGAGCGACTT	56
BlaKPC	F=ATGTCACTGTATCGCCGTCT	58	893	(52)
	R= TTTTCAGAGCCTTACTGCCC	58
BlaOXA-48	F=TTGGTGGCATCGATTATCGG	58	745	(52)
	R=GAGCACTTCTTTTGTGATGGC	58
BlaCTXM	F = SCSATGTGCAGYACCAGTAA	58	449	(53)
	R = CCGCRATATGRTTGGTGGTG	58
BlaTEM	F= TCG GGG AAA TGT GCG CG	57	971	(54)
	R = TGC TTA ATC AGT GAG GCA CC	57
BlaSHV	F =GGTTATGCGTTATATTCGCC-3	57	797	(54)
	R=TTAGCGTTGCCAGTGCTC	57

Table 3. Frequency of carbapenemase producing among Gram-negative bacilli by phenotypic tests.

		Positive isolates for a particular phenotypic test				Total
Bacterial Isolates	EDTA		MHT+BA	EDTA+BA	EDTA+AB+MHT	Total
Bacterial Isolates	N (%)		N (%)	N (%)	N (%)	N (%)
E.coli (n=28)	17 (16.4)		2 (8.3)	3 (11.1)	4 (26.6)	26 (15.2)
Klebsiella spp. (n=82)	41 (39)		10 (41.6)	12 (44.4)	8 (53.3)	71 (41.5)
Pseudomonas spp. (n=31)	19 (18)		9 (37.5)	4 (14.9)	1 (6.6)	33(19.2)
Acin. baumannii (n=36)	19 (18)		3 (12.6)	6 (22.2)	2 (13.3)	30 (17.7)
Burkholderia cepacia (n=3)	2 (1.9)		0 (0)	0 (0)	0 (0)	2 (1.2)
Enterobacter spp. (4)	2 (1.9)		0 (0)	0 (0)	0 (0)	2 (1.2)
Other GNB (n=16)	5 (4.8)		0 (0)	2 (7.4)	0(0)	7 (4)
Total (n=206)	105(50.9)		24 (11.6)	27 (13.1)	15 (7.2)	171

(Other Gram-negative bacilli include Citrobacter species, Serratia species, Proteus spp., Stenotrophomonas maltophilia, Vibrio vurneficus and Morganella morganii)

EDTA positive = Metallo-β-lactamase.

-MHT positive = KPC +OXA48 - Boronic acid positive = KPC

-MHT + Boronic acid positive = KPC -MHT positive + boronic acid negative = OXA 48

Bacterial isolate	Carbapenemase genes					ESBL genes
	NDM	OXA-48	IMP	VIM	KPC	CTXM	SHV	TEM
	N (%)	N (%)	N (%)	N (%)	N (%)	N (%)	N (%)	N (%)
K. pneumoniae (n=82)	59 (55)	1 (20)	3 (42.8)	1 (50)	0 (0)	53 (41.7)	28(33.4)	32 (40)
E.coli (n=29)	9(8.4)	1 (20)	2 (28.5)	0 (0)	0 (0)	14 (11.6)	6 (7.2)	4 (5)
Pseudomonas Spp.(n= 46)	14(13)	2 (40)	2 (28.5)	1 (50)	0 (0)	28 (22.3)	18(21.5)	16 (20)
A. baumannii (n=36)	17 (15.3)	1 (20)	0 (0)	0 (0)	0 (0)	20 (15.7)	24(28.6)	18 (22.5)
Burkholderia (n=2)	0	0 (0)	0 (0)	0 (0)	0 (0)	2 (1.6)	2 (2.4)	4 (5)
Enterobacter Spp.(n=2)	2 (1.8)	0 (0)	0 (0)	0 (0)	0 (0)	2 (1.6)	1(1.2)	1 (1.25)
Other GNB (n= 11)	7 (6.5)	0 (0)	0 (0)	0 (0)	0 (0)	7 (5.5)	4 (4.7)	5(6.25)
Total (n=206)	107 (51.9)	5(2.4)	7 (3.4)	2 (0.9)	0 (0)	12 7(61.6)	84 (40.7)	80 (38.8)

Table 4. Distributions of carbapenemase and ESBL genes among GNB isolates.

(Other Gram-negative bacilli include Citrobacter species, Serratia species, Proteus spp., Stenotrophomonas maltophilia, Vibrio vurneficus and Morganella morganii)

Table 5. Co resistance genes with blaNDM among gram-negative bacilli.

*Bla genes*	*K. pn*	*E.coli*	*P. aer*	*A. bau*	*Enter*	Total N (%)
NDM+CTXM	15	2	5	2	0	24 (27.6%)
NDM+SHV	2	0	2	2	0	6 (6.8%)
NDM+TEM	4	1	1	1	1	8 (9.1%)
NDM+CTXM+ SHV	7	0	1	1	1	10 (11.5%)
NDM+CTXM+ TEM	6	2	0	2	0	10 (11.5%)
NDM+SHV+ TEM	7	0	1	6	0	14 (16.2%)
NDM+ All	9	1	3	2	2	15 (17.3%)
Total	50	6	13	16	2	87 (100%)

(K. pn = Klebsiella pneumoniae, P. aer = Pseudomonasa aeruginosa,

A. bau = Acinetobacter baumannii, Enter= Enterobacter spp.)

Detection and Characterization of Carbapenem resistant Gram-negative bacilli isolates recovered from hospitalized patients at Soba University Hospital, Sudan

Status:

Version 1

Abstract

Figures

Introduction

Methods

Results

Discussion

Conclusion

Declarations