2.1 Animals and Experimental Design
All procedures were performed in accordance with the guidelines developed by the Institutional Animal Care and Use Committee of Xuzhou Medical University (Xuzhou, China). All the animals were housed in a barrier environment (24 ± 1°C; 12:12-h dark/light cycle) and provided food and water ad libitum before and during the experiment.
Based on previous hypoxic animal studies, male Sprague‒Dawley (SD) rats (180–200 g) were purchased from Beijing Vitonglihua (Beijing, China) [19]. Thirty-six male SD rats were randomly divided into 6 groups (n = 6): normoxia + saline (N), hypoxia + saline (H), hypoxia + estradiol (H + E2), hypoxia + low-dose 16α-OHE1 (H + 16α-OHE1 37.5 µg/kg), hypoxia + medium-dose 16α-OHE1 (H + 16α-OHE1 75 µg/kg), and hypoxia + high-dose 16α-OHE1 (H + 16α-OHE1 150 µg/kg). The equal amount of normal saline was administered as a placebo to Groups N and H. The dose of estrogen administered was based on previous studies[7]. After one week of adaptive rearing, rats in Group N were intraperitoneally injected with an equal volume of normal saline for 14 days. After seven days of intraperitoneal injection of an equal volume of normal saline under normal oxygen, rats in Group H were placed in a low-pressure chamber to simulate hypoxia at 6000 meters for 24 hours/day for 7 days, and normal saline was injected every day. After seven days of intraperitoneal injection of 75 µg/kg E2 under normal oxygen condition, rats in H + E2 group were placed in a low-pressure chamber to simulate hypoxia at 6000 meters for 24 hours/day for 7 days, and E2 was injected intraperitoneally every day. For group H + 16αOHE1-L, H + 16αOHE1-M, and H + 16αOHE1-H, the rats were placed in a low-pressure chamber to stimulate hypoxia at 6000m for 24 hours/day for 7 days after peritoneal injection of 37.5, 75, and 150 ug/kg 16α-OHE1 respectively. And the 16α-OHE1 was injected intraperitoneally every day.
2.2 Cell Culture and Transfection
H9C2 cells, the rat cardiomyocyte line, was cultured in DMEM containing 5.56 mmol/l d-glucose (normal glucose, NG) supplemented with 10% fetal bovine serum (Invitrogen, Grand Island, NY), 100 U/ml penicillin, and 100 µg/ml streptomycin in a humidified incubator at 37°C with 5% CO2. Cells were passaged at 80 − 90% confluence. Prior to the experiment, confluent cells were grown in serum-free DMEM for 24 h.
To observe the effect of 16α-OHE1 on hypoxic damage in cardiomyocytes, H9C2 cells were divided into 6 groups. In the N group, H9C2 cells were cultured in a 5% CO2 incubator. In Group H, H9C2 cells were cultured under hypoxic conditions in a three-gas incubator containing 1% O2, 5% CO2, and 94% N2 for 24 h. In the H + E2 group, H9C2 cells were cultured under hypoxic conditions in a three-gas incubator containing 1% O2, 5% CO2, and 94% N2 for 24 h, and E2 (1 nM) was added to the medium. For group H + low-dose 16α-OHE1, H + medium-dose, and H + high-dose 16α-OHE1, the H9C2 cells were cultured under hypoxic conditions in a three-gas incubator containing 1% O2, 5% CO2, and 94% N2 for 24 h, and 16α-OHE1 (0.5 nM, 1 nM, 2 nM) were added to the medium respectively. The dose selection was based on previous research [8].
For mechanistic studies, H9C2 cells were divided into 4 groups. In Group N, H9C2 cells were cultured in a 5% CO2 incubator. In Group H, H9C2 cells were cultured under hypoxic conditions in a three-gas incubator containing 1% O2, 5% CO2, and 94% N2 for 24 h. In the H + 16α-OHE1 group, H9C2 cells were cultured under hypoxic conditions in a three-gas incubator containing 1% O2, 5% CO2, and 94% N2 for 24 h, and 16α-OHE1 (2 nM) was added to the medium. In the H + 16α-OHE1 + β2AR blocker group, H9C2 cells were cultured under hypoxic conditions for 24 h in a tri-gas incubator containing 1% O2, 5% CO2, and 94% N2, and 16α-OHE1 (2 nM) and ICI 118,551 (55 nM) were added to the medium. The dose selection was based on previous research [8].
2.3 Body Weight and Cardiac Function Parameters
At the end of the experiment, body weight was recorded. Electrocardiograms (ECGs) were recorded using the PowerLab data acquisition system (ADInstruments, USA). Before the heart was collected, the rats were intraperitoneally injected with heparin to inhibit coagulation and with a sodium pentobarbital (40 mg/kg) for anesthesia. After fixation of rats, the chest cavity was opened, the vena cava, aorta and pericardial tissues were cut, and the hearts were quickly removed and placed in ice-cold Krebs-Henseleit solution (K-H fluid) for cleaning and pruning. A cotton thread was inserted at the root of the aorta for backup, and an aortic cannula inserted into the aorta at the end of the perfusion duct was fixed with the prepared cotton thread. After perfusion with oxygenated K-H fluid, the heart could resume beating within 1 minute. After the heart resumed beating, a small amount of apical tissue was clamped with the frog clamp of the tether, which was connected to the muscle tone sensor. The cardiac contraction force output was recorded by the tension sensor of the biological function experimental system ( Chengdu Taimeng Technology Co.Ltd, BL-420S, China). Before recording the cardiac contraction force, the tightness of the tether connected to the tension sensor was adjusted so that the cardiac preload was approximately 3 g. After the experiment, the force at each time point was measured in the area, and the maximum systolic velocity (+ dp/dtmax), maximum diastolic velocity (-dp/dtmax), maximum tension (Tensionmax) and minimum tension (Tensionmin) were measured.
2.4 Histological Assessment
Excised hearts (n = 6 hearts per group) were washed with prechilled PBS, blotted with filter paper, and fixed in 4% paraformaldehyde for more than 48 h. Next, the heart specimens were embedded in paraffin, sectioned at a thickness of 4 µm, and preserved for histological assessment.
The myocardial sections were deparaffinized before Masson’s trichrome (Maxim Biotechnologies, Fuzhou, China), hematoxylin and eosin (H&E), and immunohistochemical (IHC) staining. Trichome staining was performed to determine the collagen volume fraction (CVF), while H&E staining was performed to assess diameters of cardiomyocytes and the extent of myocardial hypertrophy. Additionally, IHC staining of β2AR (Affinity Biosciences, DF3512, USA), CD68 (Bioss, bs-1432R, China), CD86 (Bioss, bs-1035R, China), and CD206 (Affinity Biosciences, DF4149, USA) was performed to assess the extent of myocardial infiltration caused by inflammatory cells. Imaging of the stained sections was performed at 400× magnification (BX43F, Olympus, Tokyo, Japan), and linear measurements were obtained using image analysis system (Image-Pro-Plus 4.0, Media Cybernetics, Silver Spring, MD).
2.5 Real-time PCR
Total RNA was extracted from mouse heart tissue and GMCs with TRIzol reagent (15596-026; Invitrogen, Carlsbad, CA, USA). Then, mRNA was reverse transcribed, and the RT-Rever TraAce kit (FSQ-101; Toyobo Co, Osaka, Japan) was used to transcribe mRNA to cDNA. Real-time PCR was performed in the LC480 system (Roche Applied Science, Mannheim, Germany). The following gene primers (Sangon Biotech, Shanghai, China) were used to evaluate mRNA expression: (1) tumor necrosis factor alpha (TNF-α), forward GAAAGCATGATCCGAGATGTG, reverse CACGAGCAGGAATGAGAAGAG; (2) transforming growth factor-beta (TGF-β1), forward ATGGTGGACCGCA ACAACGC, reverse CTGGCACTGCTTCCCGAATGTC; (3) inducible nitric oxide synthase (iNOS), forward TCTTGGAGCGAGTTGTGGATTGT, reverse TAGGTGAGG GCTTGCCTGAGTG; and (4) arginase 1 (Arg-1), forward CGTTG. GAPDH was used as the internal reference.
2.6 Western Blotting
The relative protein expression in H9C2 cells and rat heart tissue was examined. Briefly, cells and heart tissue were homogenized and lysed with RIPA buffer (P0013B; Beyotime Institute of Biotechnology, Nantong, China) containing 1 mmol/L PMSF (ST506; Beyotime Institute of Biotechnology, Nantong, China). Then, cells were incubated at 4°C for 30 min followed by centrifugation at 12,000 ×g and 4°C for 15 min to obtain the supernatant. The bicinchoninic acid (BCA) protein assay (23228; 1859078; Pierce Thermo-Scientific, Rockford, IL, USA) was performed to determine the protein concentration according to the manufacturer’s instructions. The following antibodies were used: ANP (1:1,000, Affinity Biosciences, DF6497, USA), BNP (1:1,000, Affinity Biosciences, DF6902, USA), β2AR (1:1,000, Affinity Biosciences, DF3512, USA), and GAPDH (1:4,000, Proteintech, 10494-1-AP, UK). Band density was quantified by densitometric analysis using ImageJ software, and the expression of β-actin was used as the internal reference.
2.7 ELISA
Enzyme-linked immunosorbent assay (ELISA) was used to measure IL-6(Cusabio, EK306, China), IL-1β(Cusabio, EK301B, China), TNF-α(Cusabio, EK382, China), CK-MB(Wuhan Xinqidi Biotech Co.Ltd, EIA05488r, China) and cTnT(Wuhan Xinqidi Biotech Co.Ltd, EIA05536r, China) levels in rat myocardial tissue and H9C2 cells according to the manufacturer's instructions.
2.8 Cardiomyocyte Apoptosis Assay
Apoptosis was measured by staining the with a combination of fluoresceinated (FITC) annexin V and propidium iodide (PI). Briefly, for annexin V-PI analysis, the cells were resuspended in 500 µl of binding buffer (containing 140 mM NaCl, 2.5 mM CaCl2, 10 mM HEPES; pH 7.4). After that, 5 µl of annexin V-FITC and 10 µl of PI-PBS solution (Keygen Biotech, KGA108, China) were added to 1×105 cells and incubated for 15 minutes at room temperature in the dark. Data acquisition was performed within 1 hour by flow cytometry to avoid cell damage and the diffusion of PI through the cell membrane. The results were analyzed using CellQuest software.
2.9 Cell Counting Kit-8 (CCK-8) assay
H9C2 cells (2 × 103 cells per well) were seeded in a 96-well plate and incubated under normal or hypoxic conditions in complete medium. After the indicated time, 10 µL of CCK-8 solution (TargetMoI, C0005, USA) was added to each well and incubated at 37°C for another 4 h. The spectrophotometric absorbance was measured at 450 nm by microplate reader (Thermo Scientific, USA). The reagents and samples were prepared according to the manufacturer’s instructions as previously described.
2.10 Statistical Analysis
All experimental data were analyzed using GraphPad Prism 7 software (GraphPad Software Inc., San Diego, CA, USA). The results were shown as the mean ± SEM. An unpaired t test was used to analyze the data between two groups. One-way ANOVA followed by Tukey’s multiple comparisons test was performed to analyze data from more than two groups. It was considered to be significant when p < 0.05.