Animals
For this study, adult female SD (Sprague Dawley) rats free of specific pathogens (SPF), weighing 200 ± 20 g, were purchased from the Lanzhou Institute of Veterinary Medicine, Chinese Academy of Agricultural Sciences, and housed in an SPF-class laboratory animal room at Lanzhou University in a clean environment. All rats were housed in different cages with a 12-h light-dark cycle at 23 ± 1°C and 50% relative humidity, and food and water were available ad libitum. This study was approved by the Medical Ethics Committee of the Lanzhou University Second Hospital.
Lentivirus Vector
Lentiviral vector for knockdown of Ski (Lv-Ski) and lentiviral vector for expression of eGFP only (LV-eGFP) were purchased from Shanghai GeneMed Technology Co.
Surgical Procedures and Transfection
Rats were randomly divided into four groups: knockdown group (SCI + KD), negative control group (SCI + NC), control group (SCI) and sham-operated group (Sham) (Fig. 1). The rats were fasted for 12 h before surgery. 1% pentobarbital sodium 0.4 ml/100 g was injected intraperitoneally for anesthesia, and the disappearance of corneal reflex indicated successful anesthesia. The rat was fixed in prone position on the operating table, the dorsal skin was shaved, and the skin of the operating area was disinfected with iodophor and alcohol. T10 was positioned, and a median dorsal incision, approximately 3 cm in length, was made with a blunt separation of the spinous process and paravertebral muscles, and the T9-11 lamina was occluded to expose the spinal cord (without damaging the dura). The T10 spinal cord was struck with Allen's percussion device with a percussion intensity of 10 g × 50 mm, and the percussion rod was removed immediately after the strike. Signs of successful blow: after the blow, the hind limbs of the rats were paralyzed after different degrees of convulsions and the tails were spasmodically wagging. The sham-operated group only bit open the vertebral plate without striking. Subsequently, 5 µL of lentivirus (LV-Ski or LV-eGFP) solution was injected with a Hamilton syringe at two different locations, 2.5 µL at each location (3 mm from the cephalad side and 3 mm from the caudal side of the damaged spinal cord), the syringe was tilted 45。, the injection depth was 1 mm, and the injection rate was 1 µL/min. After injection, the syringe was left for 5 min and then removed at a rate of 1 mm/ min to avoid leakage of the injected fluid. Equal volumes of saline were injected in the control and sham-operated groups. The muscle and skin were sutured layer by layer, and these animals were placed on heated pads (35°C) until complete recovery from anesthesia, and then placed back in the cage in an animal room at 25–28°C. Postoperatively, penicillin 160,000 U was administered intraperitoneally for 3d. The bladder was squeezed three times a day to assist urination until recovery of spontaneous urination.
Motor Function Evaluation
Recovery of hindlimb function was assessed using the Basso-Beattie-Bresnahan (BBB) motor function score and the inclined plane test. The scoring was performed in an open environment, each time at 8 p.m. according to the diurnal habit of the rats, and by a non-group experimenter familiar with the scoring rules. Motor function evaluations were performed 1 d before spinal cord injury, 1d, 3d, 5d, 1w, 2w, 3w, 4w, 5w, 6w, 7w, and 8w after spinal cord injury, respectively.
The BBB motor function score was used to evaluate hind limb motor function. The rats were placed in a box open environment and the rater observed for 5 min and recorded the hind limb mobility score. Phase I (0 ~ 7 points): Rat hind limb joint mobility was scored. Stage 2 (8 ~ 14 points): Hind limb gait and coordination were scored. Stage 3 (15 ~ 18 points): Scoring of fine movements of the hind limbs and coordination of the front and hind limbs. Stage 4 (19 ~ 21 points): scoring of trunk stability as well as tail mobility. The total score was 21 points.
The inclined plate test is to place the rat on the inclined plate, and the axis of the rat's body should be perpendicular to the longitudinal axis of the inclined plate, from the horizontal position every 5 degrees to adjust the angle, from small to large gradually increase the angle, and the rat can stay on the inclined plate for 5 seconds without falling for the maximum angle as a valid value, each time the interval of 5 min, need to repeat 3 times after taking the average value.
Tissue Preparation
At predetermined time points, the rats were anesthetized and a portion of the anesthetized rats were perfused with 200 ml of saline via the ascending aorta, and after the effluent became clear, 1 cm of spinal cord tissue at T10 (0.5 cm cephalad to 0.5 cm caudal to the injury site) was removed and rapidly frozen in liquid nitrogen for preservation until further use (for Western blotting and Quantitative Real-time Polymerase Chain Reaction). Another part of the rats was anesthetized and perfused via the ascending aorta after the effluent became clear, and then perfused with 300 ml of 4% paraformaldehyde (Biosharp, China) until the rat tissue became hard. Then 1 cm of spinal cord tissue at the injury site was removed and placed in 4% paraformaldehyde overnight at 4°C for sectioning. The fixed spinal cord tissue was dehydrated in graded alcohol solutions (70%, 80%, 90%, 95% to anhydrous alcohol), paraffin-embedded, and sectioned into 5-µm serial sections by a microtome for immunofluorescence staining treatment.
eGFP‑Fluorescence Detection
The fixed spinal cord tissue was dehydrated in gradient sucrose solution (10%, 20%, 30%), and the dehydrated spinal cord was later buried in an optical cutting temperature (OCT) compound (Sakura Finetek, USA), and the tissue was cut longitudinally into continuous 20 µm sections using a frozen section machine (Leica, Germany). Frozen sections were subjected to eGFP fluorescence detection.
Immunofluorescent Staining
Each group of paraffin sections was heated at 60°C for 1 h, placed in xylene I and xylene II for 10 min, and then placed in a gradient of 100%, 95%, 85%, 75% alcohol solution and deionized water for 5 min. The sections were washed three times with PBS for 5 min each, followed by antigen repair with 1× citric acid antigen repair solution. After natural cooling to room temperature, the sections were washed three times with PBS for 5 min each time, and the sections were slightly shaken and dried, and a water-blocking ring was placed around the tissue with a histochemical pen to prevent fluid loss. The sections were then permeabilized with 0.3% Triton X (Beyotime, China) for 15 min at room temperature, washed three times with PBS for 5 min each time, and then closed at 37°C for 30 min with a drop of 5% goat blocking serum, shaken out of the blocking solution, and the corresponding primary antibody (Nf-200 (rabbit, 1:200; Proteintech, USA) and Synaptophysin (rabbit, 1:200; Proteintech, USA)) were added dropwise to the sections. and the sections were incubated flat in a wet box at 4°C overnight. The next day, the sections were washed three times with PBS for 5 min each time. after dropwise addition of the corresponding fluorescent secondary antibody, the sections were incubated at room temperature and protected from light for 1 h. The area of gray matter at the same position 2–3 mm from the cephalad or caudal side of the lesion in each group of sections was selected as the positive area for measurement. In this area, a fluorescent microscope was used and photographed at ×200 magnification to quantify the positive area. The relative area of positive expression of each molecule was quantified using ImageJ 6.0 (National Institutes of Health, USA) software.
Western Blotting
Spinal cord tissue was lysed using radioimmunoprecipitation assay with radioimmunoprecipitation lysate containing 1% protease inhibitor, RIPA lysis buffer (Beyotime, China). After centrifugation, the supernatant was collected and the protein concentration was determined using a BCA protein assay kit (Solarbio, China). The protein extracts were boiled with 1/3 volume of carrier buffer (Solarbio, China) for 10 min. Subsequently, they were separated on 10% sodium dodecyl sulfate-polyacrylamide gels for electrophoresis (SDS-PAGE) and later transferred to polyvinylidene fluoride (PVDF) membranes (0.45 lm; Millipore, USA). The PVDF membranes were closed with blocking solution (Beyotime, China) at room temperature (22–25°C) for 1 h. Subsequently, the PVDF membranes were incubated overnight at 4°C with the following primary antibodies (Ski (rabbit, 1:1000; Affinity, USA), Gfap (rabbit, 1:1000; Proteintech, USA) Vimentin (rabbit, 1:1000; Proteintech, USA), Nf-200 (rabbit, 1:1000; Proteintech, USA), Synaptophysin (rabbit, 1:5000; Proteintech, USA), β-actin (rabbit, 1:1000; Proteintech, USA)). The cells were washed three times with TBS containing 0.05% Tween-20, and then horseradish peroxidase (HRP)-coupled immunoglobulin G (lgG) secondary antibody (rabbit, 1:5000; Zsbio, China) was incubated for 1 h at room temperature. Wash again three times with TBS containing 0.05% Tween-20. Finally, the protein bands on the cell membrane were observed using the Enhanced Chemiluminescence System ECL kit (Biosharp, China) to obtain digital images, which were then analyzed using ImageJ 6.0 (National Institutes of Health, USA). All experiments were repeated.
Quantitative Real-time Polymerase Chain Reaction (qRT-PCR)
Total RNA was extracted from spinal cord tissue using AG RNAex Pro Reagent (Accurate Biotechnology (Human) Co., Ltd, China), and then the absorbance ratios at 260/280 nm and 260/230 nm were measured using a UV-Vis spectrophotometer (Thermo, USA) to assess the purity and concentration of total RNA in each sample. Next, mRNA was reverse transcribed to cDNA using the Evo M-MLV RT Kit with gDNA Clean for qPCR (Accurate Biotechnology (Human) Co. Kit (Accurate Biotechnology (Human) Co., Ltd, China) for qRT-PCR with thermal cycling parameters of Denature (95°C, 30s), Amplify PCR (95°C, 5s, then 60°C, 30s, 40 cycles), Melt Melting (95°C, 5s The expression level of glyceraldehydes-3-phosphate dehydrogenase (GAPDH) was used as an internal control, and three replicate wells were set up for each reaction to quantify the expression of the target gene using the 2-ΔΔCt method. The target gene expression was quantified by the 2-ΔΔCt method. The primers used in this experiment were provided by Tsingke Biotechnology Co., Ltd (all primer sequences are shown in Table 1).
Table 1
Forward and reverse primer sequences for qRT-PCR
Target gene | Forward primer (5′-3′) | Reverse primer (5′-3′) |
Ski | TACCTCGTCCAGCTCTGCCAAG | CTTGCCGAAGGTGCTCCAACTC |
Gfap | CAGACCTCACAGACGTTGCTTCC | ACTTGGCGGCGATAGTCATTAGC |
Vimentin | TGAATGACCGCTTCGCCAACTAC | CAACTCCCTCATCTCCTCCTCGTAG |
Nf-200 | GGGCGTGAAGGAAGAGGCTAAAC | TCCGTAGTCTTCTCCTCCTTGGTG |
Synaptophysin | GCCACGGACCCAGAGAACATTATC | CAGAGCACCAGGTTCAGGAAGC |
GAPDH | GGCACAGTCAAGGCTGAGAATG | ATGGTGGTGAAGACGCCAGTA |
Statistical Analysis
All experiments were repeated at least three times independently and statistical analysis was performed using GraphPad Prism 9.0. One and two-way analysis of variance (ANOVA) and Tukey's multiple comparison test were used to analyze the differences between groups. All data are expressed as mean ± standard error (SEM). P < 0.05 is considered a statistically significant difference. * * * indicates P < 0.01, * * * * indicates P < 0.001, * * * * indicates P < 0.0001.