2.1 Immunohistochemical (IHC) staining
To determine SAR1B expression levels, we used a human tissue microarray consisting of 64 lung cancer tissues and 89 normal skin tissues for IHC staining. The paraffin tissue sections were heated at 65°C for 30 minutes and then dewaxed using xylene and gradient concentration of alcohol. The sections were antigen-repaired by adding citrate buffer, followed by treatment with 3% hydrogen peroxide to quench endogenous peroxidase activity. Rabbit serum was added to block nonspecific binding before conjugating the sections with primary antibodies against SAR1B (1:100, Cat No. ab155278, Abcam). Negative controls were performed using Rabbit IgG (1:400, Cat. #ab97080, Abcam). The IHC staining was independently evaluated by three pathologists, who graded the staining intensity (SI) and percentage of positive cells (PP). SI was graded as negative, weak, moderate, or strong, while PP was defined as 0–24%, 25–49%, 50–74%, or 75–100%. To calculate the immunoreactive score (IRS) for statistical analysis, we multiplied the SI and PP values, resulting in a range of 0 to 12, with scores of 0 indicating negative expression, 1–4 indicating weak expression, 5–8 indicating moderate expression, and 9–12 indicating strong expression.
2.2 Cell lines and culture
The normal human embryonic lung fibroblast IMR-90 and human lung cancer cell lines A549, NCI-H1299, and HCC827 were obtained from the American Type Culture Collection (ATCC) (Manassas, USA) and cultured according to the provided protocols. Prior to use in this study, all cell lines underwent short tandem repeat (STR) analysis for authentication. All cells were cultured using 90% DMEM medium (Gibco, USA) supplemented with 10% fetal bovine serum (FBS) (Gibco, USA) and were incubated in a 5% CO2 incubator at 37°C.
2.3 RNA interference and cell transfection
We designed three shRNA interference sequences targeting the human SAR1B gene: shSAR1B-1 (GTGAAGAGAGGTTGCGAGAGA), shSAR1B-2 (GATGACAGACTTGGACAACAT), and shSAR1B-3 (CACGAAAGGCTGTTAGAGTCA). The shSAR1B-1/2/3 sequences were synthesized and ligated into the BR-V108 and LV-002 vectors labeled with green-fluorescent protein (GFP), respectively. After confirming the targeted plasmid vectors, we generated the infected lentivirus by co-transfecting the plasmids expressing the targeted interference sequence with the auxiliary pMD2.G (Qiagen, China) and pSPAX2 (Qiagen, China) packaged plasmids into 293T cells (ATCC, USA).
To establish stable SAR1B knockdown models in lung cancer cells, we prepared the cells and transfected them with 2×108 TU/mL of the shSAR1B lentivirus for 48 hours using Lipofectamine 2000 (Thermo Fisher, USA). After infection, we detected the knockdown efficacy at both the mRNA and protein expression levels, and used the cells with stably deficient SAR1B expression for subsequent experiments.
2.4 qPCR
We purified total RNA from cell specimens using TRIzol reagent (Sigma, USA) and generated cDNA using HiScript QRT Supermix (Vazyme, China) following the manufacturer’s instructions. For quantitative qPCR, we used a 10 µL reaction system of qPCR SYBR Green Master Mix Kit (Vazyme, China). The gene expression values were determined using the 2-ΔΔCt method and normalized to GAPDH. The qPCR primer sequences are provided below:
SAR1B-forward: CCATCGCGCTTTGCAGTTC;
SAR1B-reverse: TGATAGGGTCTGCGACTGGA;
GAPDH-forward: TGACTTCAACAGCGACACCCA;
GAPDH -reverse: CACCCTGTTGCTGTAGCCAAA.
2.5 Western blot assay
Initially, RIPA lysis buffer (Millipore, USA) was used to isolate total proteins, and the BCA Protein Assay Kit (HyClone, USA) determined the protein concentration. 20 µg of proteins from each sample were then electrophoresed on 10% SDS-PAGE (Invitrogen, USA). The PVDF membrane was employed for transfer, and TBST solution containing 5% slim milk was utilized to block non-specific proteins and antibody reactions. Anti-SAR1B (1:1000, Cat No. ab155278, Abcam) and anti-GAPDH antibody (1:3000, Cat No. A0208, Beyotime) were added for primary antibody reactions and remained in contact with the membranes at 4°C overnight. After washing of the membrane, secondary antibody incubation comprising of goat anti-rabbit (1:3000, Cat No. A0208, Beyotime) or goat anti-mouse (1:3000, Cat No. A02016, Beyotime) was done. An enhanced chemiluminescence reagent (Millipore, USA) was used to obtain the gel intensity, and the expression of the targeted protein relative to GAPDH was observed.
2.6 Cell proliferation assay
Ability of cell proliferation was assessed by Celigo cell counting assay. The A549 and NCI-H1299 cells were firstly transfected with indicated shRNAs for 48 h. Transfected cells were then seeded in 96-well plates at a density of 2 × 103 cells per well. Celigo reads the plate once a day for consecutive 5 days after 24 hours from cell inoculation. The experiments were independently repeated for 3 times in each group. Cell proliferation curve was generated based on average cell counts.
2.7 Colony formation assay
A549 and NCI-H1299 cells transfected with the shCtrl or shSAR1B lentivirus were seeded in 6-well plates at a density of 1 × 103 cells per well and cultured for 8 d to form colonies. Following this, cells were fixed by 4% paraformaldehyde for 15 min and stained with 0.5% crystal violet for 1 h. Finally, cells were washed three times with ddH2O and prepared for photography. The number of colonies was counted and these experiments were performed in triplicate.
2.8 Cell apoptosis assay
Flow cytometry was utilized to assess cell apoptosis in A549 and NCI-H1299 cells that were transfected with specified shRNAs. Specifically, the transfected cells were cultured in a 6-well plate until their confluence reached about 85%. After harvesting, the cells were resuspended in 1 mL buffer and then Annexin V-APC (BD Biosciences, USA) was added and incubated with the cells for 15 minutes in the absence of light. Subsequently, the cells were washed 3 times in PBS buffer and resuspended in 200 µL PBS. The flow cytometer (Millipore, USA) was used to obtain the percentage of apoptotic cells.
2.9 Transwell assay
Transwell assays were used to evaluate the ability of cells to migrate. A total of 100 µL of serum-free medium containing A549 or NCI-H1299 cells transfected with shCtrl or shSAR1B lentivirus was added to the upper chamber. In addition, 600 µL of medium supplemented with 30% FBS was added to the lower chamber. After 72 hours of incubation, the cells that migrated onto the lower surface of the membrane were fixed with 4% paraformaldehyde and stained with 0.1% crystal violet. Furthermore, 5 fields were randomly chosen from each well, and migratory cells were counted under the microscope. Based on the number of migratory cells, the migration rate was calculated.
2.10 Wound-healing assay
Cells from both A549 and NCI-H1299 control groups as well as their corresponding SAR1B knockdown groups were collected and placed in 12-well plates at a density of 5 × 104 cells per well. After the cells reached 90% confluence, scratches were created using a scratch meter. Following this, PBS was used to clean up the cell debris and a medium with lower serum concentration was added carefully. Once the initial wounds were photographed, the cells were left to culture until the specified time points and the figures of respective wound closures were obtained. The healing area was measured under a microscope and the migration rate was calculated based on the migration distance of cells in each group.
2.11 Animal experiments
A549 cells that were transfected with either shCtrl or shSAR1B, were collected and suspended in PBS. Subsequently, ten female BALB/c nude mice, aged 4 weeks, were procured from Cavens Biogle Model Animal Research Co. Ltd. (Suzhou, China). These mice were divided randomly into two groups: shCtrl group (n = 5) and shSAR1B group (n = 5). The corresponding A549 cells were subcutaneously injected into the mice. The tumors' longest diameter (L) and widest diameter (W) were measured every five days after their formation, and tumor volume was calculated according to the formula: π/6×L×W2. After sacrificing the tumor-bearing mice, the tumors were removed, photographed, and weighed. The Institutional Animal Care and Use Committee of XX, approved the animal study.
2.12 Statistical analysis
The statistical analysis and plotting were performed using SPSS 22.0 and GraphPad Prism 8.0 software. The means ± SD were presented for data obtained from each experiment. An unpaired two-tailed Student's t-test was conducted to compare two experimental groups, and a P value < 0.05 indicated statistical significance.