Reagents and antibodies
Cisplatin (HY-17394), Ferrostatin-1 (HY-100579) and Rosiglitazone (HY-17386) was purchased from MedChem-Express (Monmouth Junction, NJ, USA). The 1st Strand cDNA Synthesis Kit (11141ES60) and Hieff qPCR SYBR Green Master Mix (11201ES08) were purchased from YEASEN Biotechnology (Shanghai, China). The primary antibodies used in this study were as follows: anti-GPX4 (381958), anti-SP1 (R25778), anti-beta actin (250136) were purchased from Zen BioScience (Chengdu, China), anti-4-HNE (bs-6313R), anti-NTY (bs-8551R), anti-8-OHdG (bs-1278R) were purchased from Bioss (Beijing, China). An Acsl4 antibody (22401-1-AP) was purchased from Proteintech (Rosemont, IL, USA).
Mice
All studies were performed using 3 weeks (n = 10) and 8 weeks (n = 196) ICR female mice free of specific pathogens, purchased from the Laboratory Animal Center of Anhui Medical University, which underwent a 3-day acclimation period under temperature (24°C ± 2°C), humidity (55% ± 5%), light/darkness for 12 h, and sterile water conditions with free access to water and food before conducting the studies. The Animal Use and Care Committee of Anhui Medical University has given its approval for all animal research, which are carried out in accordance with its rules and regulations.
Animal models
For ovarian damage model caused by cisplatin, Cis was given (i.p. injection) into mice for 7 days, and vehicle (saline) only for next 3 days. For prevention experiments, ferrostatin-1 (Fer-1, 2mg/kg) or rosiglitazone (Rosi, 5mg/kg) was given daily into mice 3 hours prior to cisplatin (2 mg/kg) for 7 days, and Fer-1 or Rosi injection alone for next 3 days. Fer-1 or Rosi was dissolved in DMSO and diluted in sterile saline. Cisplatin was dissolved in DMF and diluted in sterile saline. In the iron overload model, the control group, cisplatin group, Iron dextran group mice were injected intraperitoneally with vehicle (saline), cisplatin (5 mg/kg) weekly, iron dextran (1 g/kg) weekly, respectively, all for 4 weeks. At the end of the experiment, mice were anesthetized with sodium pentobarbital (30 mg/kg; intraperitoneal injection) and then sacrificed, and every effort was made to minimize the animals' suffering during and after surgery.
Ovarian hematoxylin eosin staining and follicle counting
All ovarian specimens used for histological evaluation were fixed in 4% paraformaldehyde, dehydrated in graded ethanol and xylene, embedded in paraffin, sectioned again at 5um, stained with hematoxylin and eosin (H&E), and histologically analyzed using light microscopy. The follicular stage was classified according to the accepted criteria developed by Pedersen and Peters (Ekambaram et al., 2017). Briefly, the primary follicle was defined as an oocyte surrounded by a single layer of flattened squamous pregranular cells. Primary follicles are defined as oocytes surrounded by a single layer of cuboidal granulosa cells. If a follicle exhibits an intermediate stage between primordial and primary, it is classified as a primary follicle because of the predominance of cuboidal cells. Secondary follicles were defined as having two or more layers of cuboidal granulosa cells with no visible lumen. The luminal follicles were counted when follicular fluid was present within the follicles. Follicle counts were performed on the ovaries of four mice per group, and only the total number of follicles with visible oocyte nuclei was counted every 5th slices.
Estrous cycle examination
Vaginal smears were performed with saline at 9:00 am each day for 10 days. The vaginal fluid was applied to a slide, dried and stained with hematoxylin-eosin stain (H&E) to determine the stage of the estrous cycle based on cell morphology under a light microscope. It was divided into four stages, namely, the proestrus (P), estrus (E), metestrus (M), and diestrus (D) phases. Proestrus was characterized by low numbers of neutrophils or large and nucleated epithelial cells. Estrus was mainly characterized by nucleated keratinized epithelial cells, Metestrus by a combination of anucleated keratinized epithelial cells and neutrophils and diestrus by a high number of neutrophils.
Western blot analysis
Ovarian tissue or cell samples were lysed in RIPA buffer containing protease and phosphatase inhibitors. Western blot analysis was done on each sample by separating equal amounts of protein using gradient so-dium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), followed by transferation onto a poly-vinylidene fluoride (PVDF) membrane. Following protein transfer, the membrane was blocked with 5% skim milk and treated with antibodies for an overnight period. Incubation with secondary antibody took place for 1 h after washing the membranes with TBS-T at room temperature. Blotted bands were quantified with Image J software. Antibodies used were as follows: anti-Acsl4 (1:1000), anti-SP1 (1:1000), anti-GPX4 (1:1000), anti- beta actin (1:1000).
RNA isolation and relative quantitative real-time PCR(qRT–PCR)
Ovarian tissue was used to extract total RNA using an RNA extraction kit (YEASEN, 19221ES50). Reverse transcription was carried out using a total of 2.5ug of RNA as a template. The following primers are from GENERAL BIOL (Anhui, China) in the Table 1. Subsequently, using SYBR Green I Masser (Roche, Switzerland, Germany), real-time fluorescence quantitative PCR was carried out. Gene expression was detected using 2−ΔΔCt technique.
Table 1
Gene | Forward primer (5’-3’) | Reverse primer(5’-3’) |
Mouse Acsl4 | GGGGATACACCTCTCCACCA | TCTCTTTGCCATAGCGTTTTTCT |
Mouse Ptgs2 | CTGCGCCTTTTCAAGGATGG | GGGGATACACCTCTCCACCA |
Mouse Sp1 | GCCGCCTTTTCTCAGACTC | TTGGGTGACTCAATTCTGCTG |
Mouse Actin | GGAGATTACTGCCCTGGCTCCTA | GACTCATCGTACTCCTGCTTGCTG |
Human Acsl4 | ACTGGCCGACCTAAGGGAG | GCCAAAGGCAAGTAGCCAATA |
Human Ptgs2 | TAAGTGCGATTGTACCCGGAC | TTTGTAGCCATAGTCAGCATTGT |
Human Sp1 | GTGGAGGCAACATCATTGCTG | GCCACTGGTACATTGGTCACAT |
Human Actin | CATGTACGTTGCTATCCAGGC | CTCCTTAATGTCACGCACGAT |
Immunohistochemical staining (IHC)
For immunohistochemistry, the paraffin sections were de-paraffinized with xylene followed by rehydration. Antigen retrieval was performed with 1 × Sodium citrate solution, pH 6 in a pressure cooker for 20 min. After cooling to room temperature, dropwise closure with an endogenous peroxidase inhibitor was performed for 10 minutes. After that, tissue sections were then incubated overnight at 4°C with anti-Acsl4 (1:200), anti-GPX4 (1:200), anti-8-hydroxydeoxyguanosine (8-OHdG) (1:200), anti-4hydroxynonenal (4-HNE) (1:200), and anti-nitrotyrosine (NTY) (1:200). Then, ovarian sections were incubated the next day with secondary antibodies (biotinylated goat anti-rabbit/mouse IgG, PV-9001, ZSGB Bio) for 40 min at room temperature and horseradish peroxidase (HRP)-coupled streptavidin for 40 min.
Prussian blue staining and Iron Quantification
Distribution of iron ions in the tissue was detected by Perl’s Prussian blue staining kit (G1422 Solarbio science & Technology, Beijing, China). Ovarian tissue sections were baked at 60°C for 1 hour, deparaffinized with xylenes, and rehydrated in graded ethanol to distilled water. And the sections were incubated with 10% potassium ferricyanide for 25–30 min, rinsed twice with PBS, and counterstained with Nuclear Fast Red for 10 min. Cells containing intracytoplasmic blue granules were defined as positive for Prussian blue staining (PB-positive).
In addition, Fresh ovaries were immediately homogenized with phosphate-buffered saline (PBS). After centrifugation, the supernatant was collected. Iron content was determined using the Iron Content Assay Kit (BC5415, Solarbio science & Technology, Beijing, China) according to the manufacturer's instructions.
Culture and treatment of Mouse primary granulosa cells and KGN cells
Three-week-old female mice were euthanized after intraperitoneal injection of cisplatin. Bilateral ovaries were collected, and granulocytes were collected by puncturing ovarian tissue with 26-gauge needles under a stereomicroscope, passing through a 40 µm sieve, and centrifuging (1000 rpm, 5 min). After washing three times with PBS, cells were resuspended in DMEM/F12 medium supplemented with 10% fetal bovine serum and 1% streptomycin-penicillin and incubated at 37°C with 5% CO2. The medium was changed every two days.
The human ovarian granulosa-like tumor cell line KGN, which retains the main physiological characteristics of ovarian granulosa cells, was obtained from Procell Life Science&Technology Co.,Ltd. Cells were cultured in DMEM/F12 supplemented with 10% FBS and 1% PS at 37°C in a humidified environment with 5% CO2. The culture medium was renewed every 1–2 days. For assaying the in vitro effects of Fer-1 and Rosi, KGN cells were treated with Fer-1 and Rosi for 6 h in advance and then treated with 1 µg/ml cisplatin for 48h simultaneously to construct an in vitro cisplatin injury model.
Cell viability and lactate dehydrogenase assay
The Cell Counting Kit-8 (CCK-8, SparkJade, China) was used to gauge cell viability. Briefly, KGN cells were cultivated in a 96-well plate. After 24 h, the cells were treated with indicated concentrations of Fer-1 or Rosi in advance for 6 h and then co-treated with cisplatin for 48 h. 10µl of CCK8 solution was added to each well to avoid bubble formation, incubated at 37°C for 2 h, and the absorbance was measured at 450 nm.
According to the manufacturer’s instructions, the LDH assays of cultured supernatants were performed (C0017, Beyotime, Shanghai, China). OD values were measured at 490 nm. The percentage of LDH release was determined as follows: (A-B)/(C-B) 100%, where A represents the LDH activity in conditioned medium, B represents the LDH activity in medium (without cells), and C represents the LDH activity in cell lysates.
Plasmid Transfection and Small interfering RNA (siRNA) transfection
All plasmids and small interfering RNAs (siRNA) were created and synthesized by Generalbiol (Anhui, China). siRNA-Acsl4 or siRNA-SP1 were used to knocked down Acsl4 and SP1. The sequences of the siRNAs: si-Acsl4 (sense: 5′-GAGGCUUCCUAUCUGAUUA-3′; antisense:5′-UAAUCAGAUAGGAAGCCUCTT-3′), si-SP1 (sense:5′-CAGCUUGGUAUCAUCACAATT-3′; antisense:5′-UUGUGAUGAUACCAAGCUGTT-3′). Cells were cultured in 12 wells plates, and fusion was observed at 30 ~ 50% confluence after 24 h. The supernatant was then discarded, and 1ml of DMEM/F12 was added. We then dissolved 2µl (40µM) of siRNA or si-NControl in 200 µL of serum-free DMEM/F12 medium, followed by the addition of Hieff Trans (4 µL) in vitro siRNA/miRNA transfection reagent (YEASEN) was added and incubated for 10 min. The siRNA mixture was then added dropwise to each well and incubated for 24h for subsequent experiments. For SP1 overexpression, the full-length sequence of SP1 was cloned into pcDNA3.1-EGFP plasmid to produce pcDNA3.1-SP1-EGFP. The cationic lipid reagent (40802ES02) used for plasmid transfection was supplied by YEASEN Biotechnology (Shanghai, China).
Lipid peroxidation with BODIPY 581/591-C11 and flow cytometry.
For cellular lipid peroxidation detection, BODIPY 581/591 C11 (HY-D1301, MedChemExpress, Shanghai, China) and flow cytometry were used. Briefly, KGN were treated with Fer-1, Rosi and cisplatin for 48 h. Cells were incubated with medium containing 2µM BODIPY 581/591 C11 dye for 30 min. then digested by trypsinogen for 10 min and washed three times, finally the lipid ROS signal images were acquired by flow cytometry. The results were analyzed with FlowJo V10 software.
MDA assay
Following sacrifice of the mice, bilateral ovaries were collected quickly. Tissue samples were homogenized and sonicated in RIPA buffer on ice. Tissue lysates were then centrifuged at 12,000 rpm, 10 min, 4°C, and supernatants were collected. Ovarian tissue proteins were normalized according to their concentration and subjected to MDA assay described in the Lipid Peroxidation Malondialdehyde Assay Kit (S0131M, Beyotime). MDA levels were measured at 532 nm with a microplate spectrophotometer.
TUNEL Staining
Fix ovarian tissue in 10% PBS-buffered formalin and embed it in paraffin. Embedded in paraffin. Apoptotic cells were determined by TUNEL staining. Apoptotic cells were determined using a one-step TUNEL apoptosis assay kit (Beyotime, Jiangsu, China). Cell nuclei were stained with DAPI. Images were captured using a fluorescence microscope.
Dual-Luciferase Reporter Activity Assay
The wild-type (WT) and mutant human Acsl4 promoters were synthesized by Generalbiol (Anhui, China) and subcloned into the pGL3-Basic vector. For the luciferase assay, cells were placed in 96-well plates and co-transfected with dual-luciferase reporter (WT or Mut) and SP1 overexpression plasmid. The luciferase activity was measured by a dual luciferase assay (YEASEN, Shanghai, China) according to the manufacturer's instructions, and Renilla luciferase activity was normalized to Firefly luciferase activity.
Statistical analysis
Statistical analysis was conducted using the GraphPad Prism 9.0 and data were presented as the mean ± SEM. At least three independent samples from each experiment were used, and the experiment was duplicated at least three times. Samples from two groups were compared using unpaired t-tests, while samples from more than two groups were compared using one-way ANOVA. Statistical significance was defined as P values less than 0.05.