Evaluation and genetic dissection of the powdery mildew resistance in 558 wheat accessions

doi:10.21203/rs.3.rs-3217870/v1

Download PDF

Research Article

Evaluation and genetic dissection of the powdery mildew resistance in 558 wheat accessions

https://doi.org/10.21203/rs.3.rs-3217870/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 01 Mar, 2024

Read the published version in New Crops →

Version 1

posted

You are reading this latest preprint version

Wheat powdery mildew, caused by the fungal pathogen Blumeria graminis f. sp. tritici (Bgt), is a devasting disease of wheat all over the world, leading to significant yield losses. Host resistance is the most cost-effective and eco-soundly strategy to control this disease. It is certainly significant to assess the resistance level of various wheat germplasms as well as identify their genetic basis for the resistance. In the present study, a total of 558 wheat accessions were evaluated their seedling resistance to powdery mildew and the presence of resistance genes Pm1, Pm2, Pm4, Pm5, Pm6, Pm8, Pm21, Pm24, Pm41, Pm60 and Pm69 using different Bgt isolates and gene specific molecular markers. The results indicated that only 25 out of 558 wheat accessions were resistant to the Bgt isolate E09, suggesting the overall level of powdery mildew resistance of these accessions is inadequate. Further, these 25 accessions showed remarkable different resistance spectrum to extra 25 Bgt isolates and ranged from single to 25 ones. Among them, seven accessions remained resistant to all the tested isolates, indicating these accessions possess genes with broad spectrum resistance. Subsequently, the molecular detection using closely linked/diagnostic marker results showed that 249 accessions could carry only one of the tested Pm genes, 75 carry combined Pm genes and 234 not carry any of tested genes. Pm8 was detected at the highest frequency of 61.45%, whereas Pm5, Pm24, Pm41 and Pm69 were not detected. Notably, for seven accessions resistant to all the 26 tested isolates, Pm21 was detected in four of these wheat accessions, including HengS29, Chang 4640, Xinong 556 and ML728; Pm2 and Pm60 were identified in Emai 18 and Xinmai 296, respectively; no any of tested genes were detected in Emai 16, indicating novel broad spectrum resistant gene(s) might be present in this accession. The information on the evaluation and genetic dissection of the powdery mildew resistance in these 558 wheat accessions can be valuable for the popularization of these accessions and also for the powdery mildew resistance breeding using these accessions.

Triticum aestivum L.

Powdery mildew

Resistance

Markers

Common wheat (Triticum aestivum L.) is one of the most important cereal crops all over the world. It provides calorie, starch, fiber, mineral and vitamins required for almost 35% of the world’s population [1, 2]. However, wheat often suffered many biotic and abiotic stresses throughout its whole growth stage. Powdery mildew, caused by fungal pathogen Blumeria graminis f. sp. tritici (Bgt), is one of the major devasting foliar diseases and causes yield losses of up to 62% in many wheat planting areas under favorable conditions [3, 4, 5, 6]. Compared to fungicide application and agricultural managements, breeding and growing resistant cultivars is the preferred strategy for controlling powdery mildew epidemics, protecting environment, and minimizing the economic losses.

To date, 69 officially designated Pm genes at 64 loci (Pm1-Pm69, Pm8 = Pm17, Pm18 = Pm1c, Pm22 = Pm1e, Pm23 = Pm4c, Pm31 = Pm21) and dozens of provisionally named genes have been reported in common wheat and its relatives [7, 8, 9]. Expect for several genes only showing resistance at the adult stage, most of the Pm genes/alleles are effective throughout all wheat growth stages against powdery mildew and confer race-specific resistance. This type of resistance can be easily identified at the seedling stage and usually conferred by single gene. With the co-evolution of host and pathogens, many Pm genes have been weaken or even broken down in parts or most wheat growing regions, such as Pm3b and Pm4a derived from common wheat, and Pm8 and Pm17 from rye (Secale cereale L.) [10, 11, 12]. Therefore, it is certainly significant to assess the resistance level of various wheat germplasms as well as identify the resistance genes in the accessions. In addition, mining more novel effective Pm genes and introducing them into wheat cultivars can also enhance the durability and stability of disease resistance in wheat breeding programs.

However, few study progresses have been reported in determining and deploying resistant cultivars. The reasons can be attributed to several aspects, such as the difficulties encountered in screening, the poor understanding of the genetic basis of disease resistance, and the polygenic nature of the resistance that is highly influenced by environmental conditions [13]. Up to now, powdery mildew resistance in wheat could be studied by gene postulation, genetic analysis, pedigree analysis and molecular marker detection. Compared to other methods, marker detection is more stable, repeatable, timesaving and convenient. The specific markers of resistance gene have been extensively used in detecting resistance genes in wheat accessions and in marker-assisted selection (MAS) for tracking resistance genes in breeding programs. In general, molecular markers included functional (FM) and linked markers. Functional markers are usually developed based on functional genes corresponding to phenotypic traits [14]. So far, 16 formally designated Pm genes have been cloned and could be detected by FMs, including Pm1 [15], Pm2 [16], Pm3 [12], Pm4 [17], Pm5 [18], Pm8 [19], Pm12 [20], Pm17 [21], Pm21 [22, 23], Pm24 [24], Pm38/Lr34/Yr18/Sr5 [25], Pm40 [26], Pm41 [27], Pm46/Lr67/Yr46/Sr55 [28], Pm60 [29], and Pm69 [8]. However, most of the Pm genes have not been cloned yet and the linked or co-segregated markers are the effective selection to detect their presence or absence. Jin et al. (2021) determined the deployment of Pm genes and Lr genes in 659 and 63 wheat germplasms using the markers detection, respectively [30]. Wu et al. (2021) evaluated the presence of genes Pm3, Pm8, Pm13, Pm16 and Pm21 using gene specific DNA markers in 69 cultivars from Yunnan province, China [31]. Cao et al. (2015) identified Pm2, Pm4a, Pm8, and Pm21 with the linked markers Xcfd81, Xgwm356, AF1/AF4, and Xcau127 in 1,320 wheat cultivars/lines from Henan province, China [32].

In the present study, a total of 558 wheat cultivars/lines were collected from the main producing regions of wheat in China. The objective of this study was to determine the level of seedling resistance to powdery mildew, identify Pm genes in wheat cultivars using molecular markers and mine wheat accessions that may carry novel gene(s). This information could provide a theoretical basis for diseases management by rationally deploying cultivars with various resistance genes in different areas and also provided valuable resistant parents for wheat improvement.

Screening of resistant wheat accessions

To preliminarily screen resistant wheat accessions, the Bgt isolate E09 was firstly used to infect the 558 wheat accessions at the seedling stage. The result showed that a wide array of infection types was observed across these wheat accessions and ranged from highly resistant to highly susceptible (Fig. 1, Table S1). Only 25 out of 558 wheat accessions showed resistance with ITs 0–2, accounting for only 4.48% (Table 2). Among them, 13 accessions including Luomai 21, Zhengyumai 9989, Heng S29, Jintai 102, Linhan 917, Xinong 556, Xinong 938, Chang 4640, Andros, Baiqimai, Emai 16, Emai 18 and ML728 were immune with IT 0. And the rest of 12 wheat accessions (Xingyi 4, Xuzhou 21, 759C1-2212, Napo 63, Paidengmai, Xinmai 296, Aria, Chuanmai 42, Haomai 1, Xiaoyan 4, Mrl“S”-Buc“S” and Yekaola) were resistant with ITs 1–2. Unfortunately, the remaining 533 wheat accessions (95.52%) were moderately or highly susceptible to E09 (Table S1). The results suggested that the resistance level of 558 tested wheat accessions to Bgt isolate E09 was generally inadequate.

Table 1

Molecular markers used in this study
Gene	Positive control	Marker	Primer sequence (5’-3’)	Anneal temperature (℃)	Specific bands (bp)	References
Pm1	Axminster/8*Cc	STS1-F	CAATATAAACTTCAGATGTTCTATTCTCAAAC	55	333	[15]
Pm1	Axminster/8*Cc	STS1-R	CTACATTGGCTATGCGTGTAGTC	55	333	[15]
Pm2	KM2939	Pm2b-map-3-F	TGGTAACGAAGGTTGTCGCC	58	150	[30]
Pm2	KM2939	Pm2b-map-3-F	GCTCAATCTGAGAACCTT	58	150	[30]
Pm4	VPM1	JS717	AGGTGGACATCCTAGGCGCT	55	-	[17]
Pm4	VPM1	JS718	GATCTGGGTACCACAGCACCG	55	-	[17]
Pm5	Fuzhuang 30	KASP-F	GAAGGTGACCAAGTTCATGCTGCTAGCATTTACAGCTTTGCTT	-	-	[18]
		KASP-H	GAAGGTCGGAGTCAACGGATTGCTAGCATTTACAGCTTT
		KASP-R	GCAGTGGGAGCGTCATCAAA
Pm6	Timgalen	BCD135-2-F	GCTCCGAAGCAAGAGAAGAA	60	662	[53]
Pm6	Timgalen	BCD135-2-R	TCTGCTGGTCCTCTGATGTG	60	662	[53]
Pm8	Disponent	sfr43-F	TGGCTTCCAACAGCCCTAGC	60	330	[19]
Pm8	Disponent	sfr43-R	AGGCTTTTGCACCTTCTCTC	60	330	[19]
Pm21	Yangmai 5/Sub.6V	MBH1-F	GCCATTATAGTCAAGAGTGCACTAGCTGT	60	171	[46]
Pm21	Yangmai 5/Sub.6V	MBH1-R	AGCTCCTCTCGTTCTCCAATGCT	60	171	[46]
Pm24	Chiyacao	STS-Pm24-F	TATGGTGTCATTTAAGGCTGAG	58	214/189	[24]
Pm24	Chiyacao	STS-Pm24-R	TTTCTCACATCCTCATCAAACC	58	214/189	[24]
Pm41	IW2	WGGB427-F	CAGATCTGAACCTACTCTGCTCT	55	-	[27]
Pm41	IW2	WGGB427-R	GAGGGAGTTCATCACCCCAGTGGCAAAGCT	55	-	[27]
Pm60	PI 428309	M-Pm60-S1-F	CTCACAGTTCCACACTGATAT	55	549	[29]
Pm60	PI 428309	M-Pm60-S1-R	CTCCATCAATCTCAAGTTCTTCG	55	549	[29]
Pm69	G305-3M	uhw403-F	GCTATCGCCATCTACCTATC	56	350	[8]
Pm69	G305-3M	uhw403-R	ATAAACTCCCGAGATGCG	56	350	[8]

Table 2

Seedling infection types to 26 *Blumeria graminis* f. sp. *tritici* isolates
No.	Accessions	Blumeria graminis f. sp. tritici (Bgt) isolates
No.	Accessions	E09	E05	E07	E15	E17	E18	E20	E21	E23-1	E31	E32	F02	F03	F05	F06	F07	F09	F10	F11	F17	F18	F19	F21	F23	F24	F25
1	Mingxian 169	4	4	4	4	4	3	4	3	4	4	4	4	4	3	3	4	4	3	4	4	3	3	4	4	4	3
2	Luomai 21	0	0	0	-	0	0	0	0	-	0	1	0	0	0	0	0	0	0	4	0	0	0	0	-	0	0
3	Xinmai 296	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
4	Zhengyumai 9989	0	0	0	0	0	3	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	-	4	0
5	Chuanmai 42	2	3	4	0	0	3	3	0	2	4	0	0	0	0	1	4	0	4	1	4	0	0	0	2	4	0
6	Haomai 1	2	1	-	0	-	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0;	0	0	0	3	0	0
7	HengS29	0	0	-	0	-	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
8	Jintai 102	0	0	0	0	-	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	4
9	Linhan 917	0	0	4	4	1	0	0	0	3	0;	0	0	0	3	0	0	0	4	4	-	4	4	4	0	4	0
10	Xinnong 556	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	-	0	0
11	Xinnong 938	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	1	0	0	4	0	0	0	0	4
12	Xiaoyan 4	2	4	3	4	3	4	4	4	4	4	4	4	4	4	4	4	4	4	4	4	4	4	4	4	4	4
13	Xingyi 4	1	0	0	0	0	0	0	0	0	1	1	0	0	0	0	0;	0	0	0;	0;	4	0	0	4	0	0
14	Xuzhou 21	1	4	4	4	4	4	4	3	4	4	4	4	4	4	-	4	4	4	4	4	4	4	4	-	4	3
15	Chang 4640	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
16	Andros	0	0	0	4	-	0	4	0	4	4	0	0	4	0	0	-	0	0	0	0	0	3	4	4	0	4
17	Aria	1	4	0	4	3	4	3	4	4	4	4	4	4	3	4	4	1	4	4	-	4	4	4	4	4	4
18	Mrl"S"-Buc"S"	2	4	3	3	4	3	4	4	2	4	4	4	4	0	3	4	4	4	4	0;	0	4	4	3	0	4
19	759 C1-2212	1	4	4	3	4	3	4	3	4	4	4	4	4	4	3	4	0;	4	4	4	4	4	4	3	4	4
20	Napo 63	1	4	4	4	4	0	4	4	4	4	4	4	4	4	4	4	4	4	4	0;	4	4	4	3	4	4
21	Yekaola	2	4	4	4	4	4	4	4	4	4	4	4	4	4	4	4	-	4	4	4	4	4	4	3	3	4
22	Paidengmai	1	4	4	4	1	3	1	3	4	4	4	4	4	0	3	4	2	3	4	4	3	3	4	3	4	4
23	Baiqimai	0	0	0	4	0	0	0	0	0	0	0	4	0	0	0	0	0	0	0	0	0	0	0	0	0	0
24	Emai 16	0	0	0	0	-	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
25	Emai 18	0	0	0	0	-	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
26	ML728	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0

Resistance evaluation using multiple Bgt isolates

To evaluate the resistant spectrum of the 25 resistant genotypes to Bgt isolate E09, they were used to test their reaction patterns to 25 extra Bgt isolates. The result indicated that 7 of 25 accessions, including Xinmai 296, HengS29, Xinong 556, Chang 4640, Emai 16, Emai 18 and ML728, remained resistance to all the tested isolates, indicating these accessions possess gene(s) with broad spectrum resistance and hence may have high breeding value against powdery mildew. Ten accessions showed resistance to more than half of the tested Bgt isolates with ITs 0–2. However, Mrl“S”-Buc“S”, Paidengmai, Aria, Xuzhou 21, Napo, 63759 C1-2212, Yekaola and Xiaoyan 4 were susceptible to most of the tested isolates, and may almost already lost their resistance to powdery mildew (Table 2).

Molecular detection of the Pm gene(s) in all the 558 wheat accessions

Closely linked/diagnostic markers of Pm1, Pm2, Pm4, Pm5, Pm6, Pm8, Pm21, Pm24, Pm41, Pm60 and Pm69 were used to detect if these genes were present in the 558 wheat accessions (Table S1, Table 1). Based on the results of markers detection, 558 accessions could be divided into three categories (Fig. 2, Fig. 3 and Fig. 4). The first category included 249 accessions that could carry only one of the tested Pm genes. Among them, 153 accessions produced the specific bands by using the diagnostic marker Sfr43 for Pm8, indicating that they are most likely to carry Pm8 with the frequency of 61.45% (Fig. 3b). Thirty-eight, 26, 20, six, four and two accessions were amplified successfully with markers Pm2b-map-3 for Pm2, BCD135-2 for Pm6, JS717/JS718 for Pm4, MBH1 for Pm21, M-Pm60-S1 for Pm60 and Pm1aSTS1 for Pm1, respectively (Fig. 2a, Fig. 3 and Fig. 4). The second category consisted of 75 wheat accessions carrying two or more of the tested Pm genes, referring to 65, eight and two accessions that carried two, three and four tested genes combination, respectively (Fig. 2b, Fig. 3 and Fig. 4). No specific PCR products were generated by all of the tested markers in 234 accessions of the third category, suggesting that these accessions had none of the tested Pm genes (Fig. 2b). It was obvious that Pm8 was widely present in the wheat accessions, whereas none of the 558 accessions carried Pm5, Pm24, Pm41 and Pm69 (Fig. 5).

Relevance of resistance with the tested Pm gene(s)

To analyze the relevance between the powdery mildew resistance and the tested Pm gene(s), for the seven accessions which were resistant to all the 26 tested isolates, Pm21 was detected in four of these wheat accessions, including Heng S29, Chang 4640, Xinong 556 and ML728. Pm2 and Pm60 were identified in Emai 18 and Xinmai 296, respectively. No any of the tested genes were detected in Emai 16, indicating novel broad spectrum resistant gene(s) might be present in this accession (Table 2, Table S1). In addition, wheat accessions Mrl“S”-Buc“S”, Paidengmai, Aria, Napo 63, 759 C1-2212 and Yekaola which showed resistance to few of tested Bgt isolates also carry no any of the tested genes. Xuzhou 21 and Xiaoyan 4 which carried Pm8 and Pm4, respectively, were only resistant to Bgt isolate E09, suggesting these two genes were not effective in this genetic background and some new Pm genes need be introduced.

Powdery mildew is one of the most destructive wheat diseases, causing significant yield and quality losses worldwide. The utilization of resistant genes and cultivars is preferred method to control powdery mildew. Although more than 100 Pm genes/alleles have been identified from common wheat and its relatives, they have not been widely commercially used due to their association with negative linkage drag [33, 34]. For example, 1RS/1BL translocations have been usually associated with bad dough traits [35, 36]. Some of those race-specific Pm genes showed a ‘boom-and-bust’ cycle due to the emergence of new virulent races, thus accelerating strong selection pressure [37, 38]. Therefore, investigating powdery mildew resistance genes in the common wheat, such as cultivars, breeding lines and landraces, would be more useful for popularization of these wheat accessions and developing new cultivars with coordinated resistance and agronomic traits [39, 40]. In the present study, 558 wheat accessions including cultivars, breeding lines and landraces were assessed their powdery mildew resistance and the genetic basis for the resistance, providing the reference information for the rational distribution and breeding use of resistance resources. However, only 25 out of 558 cultivars/lines were resistant to Bgt isolate E09, accounting for 4.48%. These results suggested that the overall level of powdery mildew resistance of these accessions is inadequate and more disease-resistant germplasm resources are needed to be identified and utilized in wheat production programs.

Identifying the gene(s) distribution in the released wheat cultivars and breeding lines is helpful for their deployment and breeding of new cultivars with improved resistance to powdery mildew. Molecular markers can directly identify the genotype of wheat accessions at the DNA level, which was more efficient and not affected by environmental conditions. In this study, the functional markers of Pm1, Pm2, Pm4, Pm5, Pm8, Pm21, Pm24, Pm41, Pm60 and Pm69 and the linked marker of Pm6 were used to detect the presence of the genes in 558 wheat cultivars/lines. The results showed that these markers are stable and robust and can be well used for gene detection. However, among more than 100 reported Pm genes, not every Pm gene contained good markers used in gene detection, and the accuracy of linked markers in predicting the presence of a target gene also depends on the linkage distance. Therefore, it is necessary to develop more closely linked molecular markers, even functional markers to accurately identify the resistance genes in different wheat genetic backgrounds in future.

The gene Pm8, originated from ‘Petkus’ rye [41], has been widely present in wheat cultivars in the form of 1RS/1BL translocation and ever play an important role in wheat powdery mildew resistance breeding worldwide. Pm8 is closely linked to several disease resistance genes on chromosome arm 1RS, including Sr31, Lr26, and Yr9 for resistance to stem rust, leaf rust, and stripe rust, respectively. It is reported that more than 70% of the released wheat cultivars grown in total wheat producing regions in China carry 1RS/1BL translocation [42]. In this study, 195 wheat cultivars/lines carried single Pm8 or Pm8 with other tested genes, accounting for the highest frequency of 34.95% in the tested wheat accessions. Consistently, pedigree tracking indicated that resistant stocks carrying Pm8, such as ‘Kavkaz’ and ‘Lovrin’ lines, were used as breeding parents in tested wheat accessions, suggesting the origin of Pm8 in these wheat cultivars [43]. Our results were also consistent with previous reports. For example, Jin et al. (2021) reported that Pm8 was identified in 157 out of 659 wheat accessions (23.80%) [30]. Liu et al. (2019) found that the frequency of 1RS/1BL translocation in Huang-Huai wheat region was 59% [44]. Although Pm8 and Lr26 have successively lost their effectiveness, no virulent races of Puccinia graminis f. sp. tritici to resistance gene Sr31 has been found in China. Therefore, Pm8 should be used in combination with other effective Pm genes in wheat breeding programs to enhance the durability and effectiveness.

Pm21 is derived from the chromosome arm 6VS of Dasypyrum villosum, 2n = 14, VV) and have been introduced into wheat backgrounds for many years. And it has been widely used as its broad resistance spectrum to powdery mildew in many released commercial cultivars [22]. Jiang et al. (2014) identified 7.4% of the tested 118 Chinese cultivars contained Pm21 using closely linked marker Scar1265 [45]. With the development of high-throughput sequencing technology, Bie et al. (2015) developed the functional marker MBH1 based on the sequence variation of promoter, contributing to the effective tracking and utilization of Pm21 [46]. In the present study, Pm21 was identified in 11 cultivars Luomai 21, HengS29, Chang 4640, Andros, Baiqimai, ML728, Zhengyumai 9989, Jintai 102, Linhan 917, Xinong 556 and Xinong 938 using the marker MBH1. Then, these wheat cultivars showed high level resistance to 26 tested Bgt isolates in the study. However, recent research found that the virulent races of Pm21 have arisen in some wheat producing regions. Therefore, Pm21 should be pyramided with other effective Pm genes to ensure its durable resistance to powdery mildew.

Pm24, Pm41 and Pm69, derived from landraces Chiyacao, wild emmer wheat (WEW) IW2 and G305-3M, respectively, have been cloned successively [8, 24, 27]. The functional markers of these genes were used to test the 558 wheat cultivars or breeding lines in this study. The results showed that these genes have not been found in any of the tested accessions. Similarly, Pm24 was also not detected in any of 1065 common wheat and Aegilops tauschii accessions, indicating that Pm24 is a rare gene in the Chinese wheat landraces that is associated with powdery mildew resistance [24]. Pm41 was only found in eight WEW accessions by screening geographically diverse accessions of 796 tetraploid and 1122 hexaploid wheat using the Pm41 gene-specific marker WGGB427 [27]. Li et al. (2023) didn’t detect Pm69 in any of 536 common wheat germplasms [8]. Their results, together with our study, indicate that Pm24, Pm41 and Pm69 could be used in breeding programs in future.

In the present study, a total of 558 wheat accessions were evaluated the seedling resistance to powdery mildew and the presence of resistance genes Pm1, Pm2, Pm4, Pm5, Pm6, Pm8, Pm21, Pm24, Pm41, Pm60 and Pm69 in these accessions using gene specific molecular markers. This information could provide a theoretical basis for diseases management by rationally deploying these cultivars with various resistance genes in different areas and also for their breeding use against powdery mildew.

Plant materials and Bgt isolates. A total of 558 wheat accessions used in the study included cultivars, breeding lines, introduced cultivars and landraces, and the seeds were collected and provided by Dr. Fengtao Wang, Institute of Plant Protection, Chinese Academy of Agricultural Sciences and Dr. Bin Bu, College of Agriculture, Shanxi Agricultural University. (Table S1). Mingxian 169, susceptible to all tested Bgt isolates, was used as the susceptible control for phenotypic assessment and molecular markers detection. Thirteen wheat accessions including Axminster/8*Cc (Pm1), D57-5D (Pm2), Yuma (Pm4a), Fuzhuang 30 (Pm5e), Coker 747 (Pm6), Disponent (Pm8), Yangmai 5/Sub.6V (Pm21), Chiyacao (Pm24), IW2 (Pm41), PI 428309 (Pm60) and G305-3M (Pm69), were used as the positive control in molecular markers detection. Twenty-six Bgt isolates, E05, E07, E09, E15, E17, E18, E20, E21, E23-1, E31, E32, F02, F03, F05, F06, F07, F09, F10, F11, F17, F18, F19, F21, F23, F24 and F25 with different virulence patterns were used to evaluate resistance of 558 wheat accessions. Among them, The Bgt isolate E09, which has been prevalent in the main wheat-producing regions of China, was used to preliminarily test the wheat accessions to powdery mildew [47]. All these isolates were provided by Prof. Hongxing Xu, Henan University, and preserved in our lab.

Reactions to powdery mildew at the seedling stage. The 558 wheat accessions were initially evaluated the seedling’s resistance to powdery mildew using the Bgt isolate E09 in the greenhouse of Yantai University, Yantai, China. The inoculation procedure and infection types (ITs) were described as previous study [48]. About 8–10 seeds of each wheat accession were sown in rectangular trays (54 × 28 × 4 cm), each of which consisted of 72 cells (3.8 × 3.8 × 4 cm). The highly susceptible wheat cultivar Mingxian 169 was planted with three cells randomly in each tray as the susceptible control for evaluating uniformity of inoculation. Furthermore, the resistant genotypes to Bgt isolate E09 were evaluated the resistance reaction to powdery mildew by other 32 Bgt isolates. The seeds were planted in 32 rectangular trays and plants in different trays were inoculated with the 32 Bgt isolates separately, and each tray was covered with a glass shroud to avoid cross infection of different strains after inoculation. About 10 days later, when the first leaf was fully expanded, all seedlings were inoculated with fresh conidia increased on Mingxian 169 seedlings in a greenhouse with a daily cycle of 14 h of light at 22°C and 10 h of darkness at 18°C. When the spores were fully developed on the first leave of susceptible control Mingxian 169 about 10–14 days after inoculation, ITs on the first leaves were assessed on a 0–4 scale, of which 0 = no visible symptoms and signs, 0; = necrotic flecks without sporulation, 1 = sparse aerial hypha and little sporulation, the diameter of colonies < 1 mm, 2 = moderate aerial hypha and sporulation, the diameter of colonies < 1 mm, 3 = thick aerial hypha and abundant sporulation, the diameter of colonies > 1 mm, and 4 = abundant sporulation with more than 80% of the leaf area covered with aerial hypha [49]. Plants with IT 0, 0;, 1, and 2 were regarded as resistant (R), and IT 3 and 4 as susceptible (S). All tests were repeated three times to ensure the reliability of the data. Furthermore, the resistant genotypes to Bgt isolate E09 were evaluated the resistance reaction to powdery mildew by other 32 Bgt isolates. The seeds were planted in 32 rectangular trays and plants in different trays were inoculated with the 32 Bgt isolates separately, and each tray was covered with a glass shroud to avoid cross infection of different strains after inoculation.

Molecular marker detection of the Pm genes. Total genomic DNA was extracted from 2 cm-length young leaf tissues of each wheat accession using the cetyltrimethylammonium bromide (CTAB) method described by Sharp et al. (1988) [50]. Eleven Pm-gene specific primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. China (Table 1). Polymerase chain reactions (PCR) was performed using a Veriti™ 96-Well Fast Thermal Cycler (Applied Biosystems) with a 10 µL reaction mixture containing 1 µL of 50 ng µL^− 1 template DNA, 0.5 µL of 10 µmol L^− 1 of each primer, 4 µL 2 × Taq Master Mix (Vazyme Biotech Co., Ltd. China) and 4 µL ddH₂O. The PCR profile included one cycle of 95°C for 3 min followed by 36 cycles of 95°C for 15 s, 50 to 65°C (depending on the specific primers) for 15 s, and 72°C for 20 s and a final extension at 72°C for 5 min. Products amplified were separated in either 8% non-denaturing polyacrylamide gels with 29:1 ratio of acrylamide and bis-acrylamide and visualized after silver staining [51], or 1.5% agarose gel and visualized using the Gel Documentation System (Gel Doc XR+, BIO-RAD, Hercules, CA) [52]. The information of molecular markers was described in Table 1.

Acknowledgements

We are grateful to Prof. Hongxing Xu, School of Life Sciences, Henan University for providing Blumeria graminis f. sp. tritici isolates.

Authors' contributions

PM and HY conceived the research. YJ, GH and WZ performed the experiments. HY analyze the data. BB and HG provided and assessed the experimental materials. YZ, JW and RL performed the phenotypic assessment. YJ wrote the manuscript. All authors read and approved the final manuscript.

Funding

This research was financially supported by the National Natural Science Foundation of China (32072053), the Key Research and Development Project of Shandong Province (2020CXGC010805) and Key Research and Development Project of Yantai City (2022XCZX092).

Availability of data and materials

All the data generated or analyzed during the current study were included in the manuscript. The raw data is available from the corresponding author on reasonable request.

Declarations

Ethics approval and consent to participate

All methods complied with relevant institutional, national, and international guidelines and legislation.

Consent for publication

Not applicable.

Conflict of interest

The author(s) declare no conflicts of interest.

Guideline statement

The authors confirm that all methods were carried out in accordance with relevant guidelines and regulations.

Mondal S, Sallam A, Sehgal D, Sukumaran S, Farhad M, Krishnan JN et al. Advances in breeding for abiotic stress tolerance in wheat. Genomic Des Abiotic Stress Resist Cereal Crop. 2021;71–103.
Paux E, Sourdille P, Salse J, Saintenac C, Choulet F, Leroy P, et al. A physical map of the 1-gigabase bread wheat chromosome 3B. Sci. 2008;322(5898):101–4.
Costamilan LM, Trigo E, Fundo P, Grande R. Variability of the wheat powdery mildew pathogen Blumeria graminis f. sp. tritici in the 2003 crop season. Fitopatol Bras. 2005;30(4):420–2.
El-Shamy M, Sallam M, Awad H. Powdery mildew infection on some Egyptian bread wheat cultivars in relation to environmental conditions. J Plant Prot Pathol. 2012;3(4):363–72.
Huang LS, Zhang DY, Dong L, Lin L, Ling ZJ, Sheng HG, et al. Continuous wavelet analysis for diagnosing stress characteristics of leaf powdery mildew. Int J Agric Biol. 2013;15(1):34–40.
Maxwell JJ, Lyerly JH, Cowger C, Marshall D, Brown-Guedira G, Murphy JP. MlAG12: a Triticum timopheevii-derived powdery mildew resistance gene in common wheat on chromosome 7AL. Theor Appl Genet. 2009;119(8):1489–95.
He HG, Liu RK, Ma PT, Du HN, Zhang HH, Wu QH, et al. Characterization of Pm68, a new powdery mildew resistance gene on chromosome 2BS of Greek durum wheat TRI 1796. Theor Appl Genet. 2021;134(1):53–62.
Li YH, Wei ZZ, Sela HN, Govta L, Klymiuk V, Roychowdhury R, et al. Long-read genome sequencing accelerated the cloning of Pm69 by resolving the complexity of a rapidly evolving resistance gene cluster in wheat. Plant Commun. 2023;5:100646.
McIntosh RA, Dubcovsky J, Rogers WJ, Xia XC, Raupp WJ. Catalogue of Gene Symbols For Wheat 2020 Supplement. 2020. https://wheat.pw.usda.gov/GG3/WGC.
Cloutier S, Mccallum BD, Loutre C, Banks TW, Wicker T, Feuillet C, et al. Leaf rust resistance gene Lr1, isolated from bread wheat (Triticum aestivum L.) is a member of the large psr567 gene family. Plant Mol Biol. 2007;65(1–2):93–106.
Tomar SMS, Singh SK, Sivasamy M. Vinod. Wheat rusts in India: resistance breeding and gene deployment-A review. Indian J Genet Plant Breed. 2014;74(2):129–56.
Yahiaoui N, Srichumpa P, Dudler R, Keller B. Genome analysis at different ploidy levels allows cloning of the powdery mildew resistance gene Pm3b from hexaploid wheat. Plant J. 2004;37(4):528–38.
Brancourt-Hulmel M, Lecomte C. Effect of environmental variates on genotype × environment interaction of winter wheat: A comparison of biadditive factorial regression to AMMI. Crop Sci. 2003;43(2):608–17.
Andersen JR, Lübberstedt T. Functional markers in plants. Trends Plant Sci. 2003;8(11):554–60.
Hewitt T, Müller MC, Molnár I, Mascher M, Holušová K, Šimková H et al. A highly differentiated region of wheat chromosome 7AL encodes a Pm1a immune receptor that recognizes its corresponding AvrPm1a effector from Blumeria graminis. New Phytol. 2021;229:2812–2826.
Sánchez-Martín J, Steuernagel B, Ghosh S, Herren G, Hurni S, Adamski N, et al. Rapid gene isolation in barley and wheat by mutant chromosome sequencing. Genome Biol. 2016;17:1–7.
Sánchez-Martín J, Widrig V, Herre G, Wicker T, Zbinden H, Gronnier J, et al. Wheat Pm4 resistance to powdery mildew is controlled by alternative splice variants encoding chimeric proteins. Nat Plants. 2021;7:327–41.
Xie JZ, Guo GH, Wang Y, Hu TZ, Wang LL, Li JT, et al. A rare single nucleotide variant in Pm5e confers powdery mildew resistance in common wheat. New Phytol. 2020;228:1011–26.
Hurni S, Brunner S, Buchmann G, Herren G, Jordan T, Krukowski P, et al. Rye Pm8 and wheat Pm3 are orthologous genes and show evolutionary conservation of resistance function against powdery mildew. Plant J. 2013;76:957–69.
Zhu SY, Liu C, Gong SJ, Chen ZZ, Chen R, Liu TL, et al. Orthologous genes Pm12 and Pm21 from two wild relatives of wheat show evolutionary conservation but divergent powdery mildew resistance. Plant Commun. 2023;4(2):100472.
Singh SP, Hurni S, Ruinelli M, Brunner S, Sanchez-Martin J, Krukowski P, et al. Evolutionary divergence of the rye Pm17 and Pm8 resistance genes reveals ancient diversity. Plant Mol Biol. 2018;98:249–60.
He HG, Zhu SY, Zhao RH, Jiang NZ, Ji YY, Ji J et al. Pm21, Encoding a typical CC-NBS-LRR protein, confers broad-spectrum resistance to wheat powdery mildew disease. Mol. Plant. 2018;11:879–882.
Xing LP, Hu P, Liu JQ, Witek K, Zhou S, Xu JF, et al. Pm21 from Haynaldia villosa encodes a CC-NBS-LRR protein conferring powdery mildew resistance in wheat. Mol Plant. 2018;11:874–8.
Lu P, Guo L, Wang ZZ, Li BB, Li J, Li YH, et al. A rare gain of function mutation in a wheat tandem kinase confers resistance to powdery mildew. Nat Commun. 2020;11(1):680.
Krattinger SG, Lagudah ES, Spielmeyer W, Singh RP, Huerta-Espino J, McFadden H, et al. A putative ABC transporter confers durable resistance to multiple fungal pathogens in wheat. Science. 2009;323:1360–3.
Luo PG, Luo HY, Chang ZJ, Zhang HY, Zhang M, Ren ZL. (2009) Characterization and chromosomal location of Pm40 in common wheat: a new gene for resistance to powdery mildew derived from Elytrigia intermedium. Theor Appl Genet. 2009;118(6):1059–1064.
Li MM, Dong LL, Li BB, Wang ZZ, Xie JZ, Qiu D, et al. A CNL protein in wild emmer wheat confers powdery mildew resistance. New Phytol. 2020;228:1027–37.
Moore JW, Herrera-Foessel S, Lan CX, Schnippenkoetter W, Ayliffe M, Huerta-Espino J, et al. A recently evolved hexose transporter variant confers resistance to multiple pathogens in wheat. Nat Genet. 2015;47:1494–8.
Zou SH, Wang H, Li YW, Kong ZS, Tang DZ. The NB-LRR gene Pm60 confers powdery mildew resistance in wheat. New Phytol. 2018;218:298–309.
Jin YL, Shi FY, Liu WH, Fu XY, Gu TT, Han GH, et al. Identification of resistant germplasm and detection of genes for resistance to powdery mildew and leaf rust from 2,978 wheat accessions. Plant Dis. 2021;105(12):3900–8.
Wu XX, Bian Q, Gao Y, Ni XY, Sun YQ, Xuan YH, et al. Evaluation of resistance to powdery mildew and identification of resistance genes in wheat cultivars. Peer J. 2021;9:e10425.
Cao TJ, Chen YX, Li D, Zhang Y, Wang XC, Zhao H, et al. Identification and molecular detection of powdery mildew resistance of new bread wheat varieties (lines) in Henan province, China. Acta Agron Sin. 2015;41(08):1172–82.
Friebe B, Heun M, Tuleen N, Zeller FJ, Gill BS. Cytogenetically monitored transfer of powdery mildew resistance from rye into wheat. Crop Sci. 1994;34(3):621–5.
Zeller FJ, Hsam SLK. Chromosomal location of a gene suppressing powdery mildew resistance genes Pm8 and Pm17 in common wheat (Triticum aestivum L. em. Thell) Theor Appl Genet. 1996;93:38–40.
Graybosch RA, Peterson CJ, Hansen LE, Mattern PJ. Relationships between protein solubility characteristics, 1BL/1RS, high molecular weight glutenin composition, and end-use quality in winter wheat germ plasm. Cereal Chem. 1990;67(4):342–9.
Martin DJ, Stewart BG. Dough stickiness in rye-derived wheat cultivars. Euphytica. 1990;51:77–86.
Parks R, Carbone I, Murphy JP, Marshall D, Cowger C. Virulence structure of the eastern US wheat powdery mildew population. Plant Dis. 2008;92(7):1074–82.
Golzar H, Shankar M, D’Antuono M. Responses of commercial wheat varieties and differential lines to western Australian powdery mildew (Blumeria graminis f. sp. tritici) populations. Australas. Plant Pathol. 2016;45:347–55.
Li GQ, Xu XY, Bai GH, Carver BF, Hunger R, Bonman JM. Identification of novel powdery mildew resistance sources in wheat. Crop Sci. 2016;56(4):1817–30.
Qiu D, Huang J, Guo GH, Hu JH, Li YH, Zhang HJ, et al. The Pm5e gene has no negative effect on wheat agronomic performance: Evidence from newly established near-isogenic lines. Front Plant Sci. 2022;13:918559.
Graybosch RA. Uneasy unions: quality effects of rye chromatin transfers to wheat. J Cereal sci. 2001;33(1):3–16.
Li HJ, Wang XM, Song FJ, Wu CP, Wu XF, Zhang N, et al. Response to powdery mildew and detection of resistance genes in wheat cultivars from China. Acta Agron Sin. 2011;37(6):943–54.
Li TY, Cao YY, Wu XX, Xu XF, Wang WL. Seedling Resistance to Stem Rust and Molecular Marker Analysis of Resistance Genes in Wheat Cultivars of Yunnan, China. PLoS ONE. 2016;11(10):e0165640.
Liu WL, Zhang HJ, Sun Y, Liu DJ, Yang SP, Zhang R, et al. Detection and Composition Analysis of Powdery Mildew Resistance Genes in Heilongjiang Spring Wheat Cultivars Since the Founding of New China. J Agric Sci. 2019;33(1):0039–47.
Jiang Z, Wang QL, Wu JH, Xue WB, Zeng QD, Huang LL, et al. Distribution of powdery mildew resistance gene Pm21 in Chinese winter wheat cultivars and breeding lines based on gene-specific marker. Sci Agric Sin. 2014;47(11):2078–87.
Bie TD, Zhao RH, Zhu SY, Chen SL, Cen B, Zhang BQ, et al. Development and characterization of marker MBH1 simultaneously tagging genes Pm21 and PmV conferring resistance to powdery mildew in wheat. Mol Breed. 2015;35:10–007.
Zhou RH, Zhu ZD, Kong XY, Huo NX, Tian QZ, Li P, et al. Development of wheat near-isogenic lines for powdery mildew resistance. Theor Appl Genet. 2005;110(4):640–8.
Zhang WJ, Yu ZY, Wang DM, Xiao LN, Su FY, Mu YJ, et al. Characterization and identification of the powdery mildew resistance gene in wheat breeding line ShiCG15-009. BMC Plant Biol. 2023;23:113.
Si QM, Zhang XX, Duan XY, Sheng BQ, Zhou YL. On gene analysis and classification of powdery mildew (Erysiphe graminis f. sp. tritici) resistant wheat varieties. Acta Phytopathol Sin. 1992;22(4):349–55.
Sharp PJ, Kreis M, Shewry PR, Gale MD. Location of β-amylase sequences in wheat and its relatives. Theor Appl Genet. 1988;75:286–90.
Santos FR, Pena SD, Epplen JT. Genetic and population study of a Y-linked tetranucleotide repeat DNA polymorphism with a simple non-isotopic technique. Hum Genet. 1993;90(6):655–6.
Gebrewahid TW, Zhang PP, Yao ZJ, Li ZF, Liu DQ. Identification of leaf rust resistance genes in bread wheat cultivars from Ethiopia. Plant Dis. 2020;104(9):2354–61.
Wan WT, Xiao J, Li ML, Tang X, Wen MX, Cheruiyot AK et al. Fine mapping of wheat powdery mildew resistance gene Pm6 using 2B/2G homoeologous recombinants induced by the ph1b mutant. Theor. Appl. Genet. 2020;133:1265–1275.

No competing interests reported.

SupplementaryTable1.xlsx

Download PDF

Journal Publication

published 01 Mar, 2024

Read the published version in New Crops →

Version 1

posted

You are reading this latest preprint version

Evaluation and genetic dissection of the powdery mildew resistance in 558 wheat accessions

Status:

Journal Publication

Version 1

Abstract

Figures

Background

Results

Screening of resistant wheat accessions

Discussion

Conclusion

Materials and methods

Declarations

References

Additional Declarations

Supplementary Files

Status:

Journal Publication

Version 1