Chemicals and Reagents
Cinobufagin and paclitaxel were purchased from TCI, (Tokyo, Cat. No:P1632 and Cat. No: C3460), a G361 melanoma cell line was purchased from ATCC (Cat. No: CRL-1424, Manassas, VA, USA), and a Human Cas3 enzyme-linked immunosorbent assay (ELISA) kit was purchased from BT-LAB (Bioassay technology laboratory Shanghai, China) All chemicals used in cell culture were purchased from Sigma-Aldrich (Sigma-Aldrich Chemie GmbH, Taufkirchen, Germany).
Cell Culture
The G361 melanoma cell line was cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) containing 10% fetal bovine serum (FBS), 5% glutamine, and 1% penicillin-streptomycin. The cells were maintained at 37°C in a humidified incubator with 5% CO2 and 100% humidity.
Cell Viability Assay
(MTT test) and Experimental Groups
Then cells were seeded in triplicate 96-well plates with 10,000 cells per well. The cells were treated with different concentrations (1nM, 10nM, 50µM, 100nM, 250nM, 500nM and 1000nM) of cinobufagin and paclitaxel (1pM, 10pM, 50pM, 100pM, 250pM, 500pM and 1000pM) for 24h, after which a 10µl MTT solution (5mg/ml) was added to each well and incubated for 4h at 37°C, with 5% CO2). After incubation for 4 h, 100µL dimethyl sulfoxide (DMSO) was added to each well until the absorbance of each well measured 570nm using an automated reader (Epoch, Biotek, USA). The IC50 values were calculated for cinobufagin and paclitaxel using GraphPad Prism version 8.0.1 (GraphPad Software, Inc., CA, USA) software. After the determination of the IC50 values, the IC50 doses for cinobufagin and paclitaxel were treated in the cells, both separately and together. Subsequently, four study groups were formed: a control group, a cinobufagin group, a paclitaxel group, and a cinobufagin and paclitaxel combination group. The effects of each of the drug treatments were evaluated for the treatment of melanoma based on a biochemical analysis, with each assay performed in triplicate.
Protein analyses
The cells were washed twice with PBS and then harvested using a -lysis buffer containing a protease inhibitor cocktail (Roche Complete, Indianapolis, USA). The lysates were centrifuged at 16,000g at 4˚C for 15 min, and the protein concentrations collected from the supernatants was determined using the BCA method (TaKaRa, Shiga, Japan)
Caspase-3 analyses
The cells treated with drugs were incubated for 24 hours, and then the Caspase-3 levels in the extracted protein were measured from the cell lysates according to the manufacturer’s instructions using an ELISA technique. The results were expressed as ng/mg protein.
Total RNA Isolation, Reverse Transcription and Quantitative Polymerase Chain Reaction
The cells were collected and washed with PBS at the end of 24h incubation. The mRNA expression level in the total RNA was isolated using a commercial kit (EURx GeneMatrix, Gdansk, Poland, Catalog No: E3598) according to the manufacturer’s instructions. The quantification and purity of the isolated RNAs were analyzed using the Epoch Take3 plate system (Agilent, USA), and a complementary DNA (cDNA) Synthesis kit, according to the manufacturer’s instructions. In the following stage, 1µg of total RNA was used as the template in a reverse transcription polymerase chain reaction (RT-PCR), after which, 1µl of cDNA of each sample was taken, and appropriate amounts of SYBR green PCR Master Mix and a double primer (oligonucleotide) were added according to the protocols. The expression levels of the target genes were normalized to the housekeeping gene GAPDH, and gene expression values were then calculated based on the ΔΔCt method using the equation: RQ = 2−ΔΔCt in the REST2009 program. The primer sequences used in the PCR and the PCR conditions are described in Table 1. Each assay was performed in triplicate and repeated three times.
Statistical analysis
The results obtained from this study were analyzed using IBM SPSS Statistics (Version 20.0. Armonk, NY: IBM Corp.). The conformity of the variables to a normal distribution was tested with a Shapiro-Wilk test. Descriptive statistics were expressed as mean ± standard deviation for normal distributions and median (min–max) for no normal distributions. Statistical significance in the study groups was examined with an ANOVA for parametric variables and with a Kruskal-Wallis test for nonparametric variables. A Student’s t-test was conducted for parametric variables and a Mann-Whitney U test for non-parametric variables. P < 0.05 was considered the threshold of statistical significance.
Table 1
Oligonucleotide Primer Sequences and PCR Programs
Genes | Primer sequences (5' → 3') | RT-PCR Programs | Cycle |
GAPDH | F-5’ GATTTGGTCGTATTGGGCGC 3’ R-5’AGTGATGGCATGGACTGTGG 3’ | 95˚C-30s/59˚C-1m/72˚C-30s | 40 |
β-catenin | F-5’ TTGAAGGTTGTACCGGAGCC 3’ R-5’ GCCACCCATCTCATGTTCCA 3’ | 95˚C-30s/59˚C-1m/72˚C-30s | 40 |
C-Myc | F-5’ ACTTCTACCAGCAGCAGCAG 3’ R-5’ GAGCAGAGAATCCGAGGACG 3’ | 95˚C-30s/59˚C-1m/72˚C-30s | 40 |
Cyclin D1 | F-5’ TGTGATGCTGGGCACTTCAT 3’ R-5’ GACAGACAAAGCGTCCCTCA 3’ | 95˚C-30s/59˚C-1m/72˚C-30s | 40 |
Bax | F-5’ CATGAAGACAGGGGCCCTTT 3’ R-5’ AAACACAGTCCAAGGCAGCT 3’ | 95˚C-30s/59˚C-1m/72˚C-30s | 40 |
Bcl2 | F-5’ ACAGGGTACGATAACCGGGA 3’ R-5’ CATCCCAGCCTCCGTTATCC 3’ | 95˚C-30s/59˚C-1m/72˚C-30s | 40 |
Caspase3 | F-5’ GTGCTACAATGCCCCTGGAT 3’ R-5’ GCTGGATGCCGTCTAGAGTC 3’ | 95˚C-30s/59˚C-1m/72˚C-30s | 40 |
Wnt1 | F-5’ CCCAAACAGACTCGCTAGCA 3’ R-5’CTGGGAGAATGGGGGCATTT 3’ | 95˚C-30s/59˚C-1m/72˚C-30s | 40 |