Tissue collection
Seventy patients with PC were included in the present study, and the PC and corresponding adjacent normal pancreatic tissues were obtained from these PC patients in Cangzhou Central Hospital. The tissues were immediately frozen in liquid nitrogen and stored at -80 °C until used. This research was approved by the Ethics Committee of Cangzhou Central Hospital and carried out in accordance with the Declaration of Helsinki. All the patients provided the informed consents. Tumor stage was evaluated by two experienced pathologists according to the TNM staging of the International Union against Cancer/American Joint Committee on Cancer system (15).
Cell Culture
A normal human pancreatic cell line (HPDE) and six different PC cell lines (AsPC-1, Capan-2, SW1990, PANC-1, PaCa-2, and BxPC-3) were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China) and cultured in RPMI-1640 medium (Gibco) containing 10% fetal bovine serum (FBS, Gibco) in a humidified incubator containing 5% CO2 at 37 °C. All cell lines were authenticated and tested to be mycoplasma-free.
Construction Of Stable Cells And Cell Transfection
To generate cells stably overexpressing TSLNC8, cells were infected with a lentiviral vector containing full-length TSLNC8 or an empty vector control (GenePharm, Shanghai). To generate cells stably silencing TSLNC8, cells were infected with a lentiviral vector expressing TSLNC8 shRNA or negative control scramble shRNA (GenePharm, Shanghai). The target sequence of TSLNC8 shRNA (shTSLNC8) was shown as follow: GCTGAACTCTCTGCCCAAA. Stably clones were selected for 2 weeks using puromycin. Cell transfection was performed using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s instructions. pLKO.1 containing HuR shRNA was constructed by GenePharm (Shanghai). The target sequence of indicated shRNA was shown as follow: shHuR: TCGGGAGAACGAATTTGATCGTCAA.
Cell Proliferation Assay
Cell proliferation was detected by Cell Counting Kit-8 (CCK-8). 1 × 103 cells/well was seeded into 96-well plates. At indicated time point, 10 µL of CCK-8 reagent (Dojindo) was added to each well and incubated for additional 1 hour at 37 °C. Then, the absorbance was measured at 450 nm in a microplate reader (Bio-rad).
Colony Formation Assay
2000 cells/well were seeded into 6-well plates and cultured for one week. The cells were fixed with 4% paraformaldehyde and then stained with 0.5% crystal violet. The number of colonies was counted.
Transwell Assay
Cell invasion was tested by transwell assay. Briefly, 2 × 105 cells in 200 µL serum-free medium were added into the upper chamber with matrigel, while medium with 10% FBS was added into the lower chamber. 24 hours later, the cells in the upper chamber were carefully removed with a cotton swab, and the cells in the lower surface of the membrane was fixed with 4% paraformaldehyde and then stained with 0.5% crystal violet.
Quantitative Real-time PCR (qRT-PCR)
Total RNA from cells or tissue samples was isolated using RNeasy mini kit (Qiagen) and reserve transcribed using Reverse Transcription System (Promega). qRT-PCR was performed using the SYBR Green MasterMix (Takara) on ABI StepOne Plus system. 2−∆∆Ct method was used to calculate the relative expression of indicated genes. GAPDH was used as internal reference. The primer sequences were provided as follow:
TSLNC8-forward: CCCAAGAGTGTCCAGATGATAC
TSLNC8-reverse: GGAAGGGTCTCAGTGCTTATT
CTNNB1-forward: CTTCACCTGACAGATCCAAGTC
CTNNB1-reverse: CCTTCCATCCCTTCCTGTTTAG
HuR-forward: GGCTACGGCTTTGTGAACTA
HuR-reverse: GCGAGCATACGACACCTTAAT
GAPDH-forward: GTCAACGGATTTGGTCGTATTG
GAPDH-reverse: TGTAGTTGAGGTCAATGAAGGG
c-myc-forward: AAGCTGAGGCACACAAAGA
c-myc-reverse: GCTTGGACAGGTTAGGAGTAAA
c-jun-forward: CACAGAGAGACAGACTTGAGAAC
c-jun-reverse: ACTTGGATACCCTTGGCTTTAG
MMP7-forward: CACTGTTCCTCCACTCCATTTA
MMP7-reverse: GACATCTACCCACTGCAAGTATAG
CD44-forward: GAAATGGCACCACTGCTTATG
CD44-reverse: CTACTAGGAGTTGCCTGGATTG
AXIN2-forward: CTTATCGTGTGGGCAGTAAGA
AXIN2-reverse: GTTCTCGGGAAATGAGGTAGAG.
Immunoblotting
Cells were lysed using RIPA buffer (Beyotime). Equal amounts of protein samples were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), and then transferred onto PVDF membrane (Millipore). The membranes were incubated with antibodies against HuR (Abcam), β-catenin (Cell signaling) and GAPDH (Proteintech) overnight at 4 °C and then cultured with corresponding HRP-conjugated secondary antibody (Jackson) for 1 hour. Finally, signals were detected using an enhanced chemiluminescence (ECL) system (Millipore).
RNA Immunoprecipitation (RIP) Assay
RIP assay was performed using an EZ-Magna RIP Kit (Millipore) according to the manufacturer’s instructions. The anti-HuR antibody (Abcam) and negative control IgG (Cell Signaling) was used. The RNA in the immunoprecipitate complex was analyzed by qRT-PCR.
RNA Pull-down Assay
RNA pull-down assay was carried out using Magnetic RNA-Protein Pull-Down Kit (Thermo) according to the manufacturer’s instructions. The protein pulled down by TSLNC8 or negative control antisense TSLNC8 was subjected to western blot analysis.
Subcellular Localization Of TSLNC8
The PARIS Kit (Life Technologies) was used to isolate the cytoplasmic and nuclear RNA according to the manufacturer’s instructions. Then, the subcellular localization of TSLNC8 was detected by qRT-PCR. The GAPDH and U6 transcripts were used as internal reference of cytoplasmic and nuclear RNA, respectively.
Luciferase Reporter Assay
To detect the activity of Wnt signaling, TOPflash or FOPflash (Promega) with pRL-TK plasmid were transfected into cells. The luciferase activities were measured using a Dual-Luciferase Reporter Assay System (Promega). The relative ratio of firefly luciferase activity to Renilla luciferase activity was determined as the TOPflash reporter activity. FOPflash was taken as a negative control. To detect the luciferase activity of CTNNB1 promoter, full-length CTNNB1 promoter was cloned into pGL3 plasmid (pGL3-CTNNB1). pGL3 or pGL3-CTNNB1 with pRL-TK was transfected into stable PC cells. After 48 hours, the luciferase activities were measured using a dual-luciferase reporter gene assay system (Promega). The relative ratio of firefly luciferase activity to Renilla luciferase activity was measured.
Animal Experiments
Animal experiments were carried out following the protocol approved by the Ethics Committee of Cangzhou Central Hospital. To investigate tumor growth in vivo, 1 × 107 control and TSLNC8-knockdown PaCa-2 cells were subcutaneously inoculated into the right flank of nude mice. Tumor growth was monitored and volume was calculated as the formula 1/2 × length × width2. The mice were sacrificed after 30 days and tumors were excised and weighted. To investigate tumor metastasis in vivo, 1 × 106 control and TSLNC8-knockdown PaCa-2 cells were injected into tail vein of nude mice. After 60 days, the mice were sacrificed, and the lung tissues were excised and subjected to H&E staining according to the standard procedure. The pulmonary metastasis nodule was calculated under a microscope.
Statistical Analysis
All the experiments were repeated at least three times. Comparisons between groups were performed by Student’s t test or ANOVA method followed by Tukey’s test. Chi-square test was used to analyze the relationship between TSLNC8 expression and clinicopathological features of PC patients. Kaplan–Meier method and log-rank tests were used to evaluate survival curves. p < 0.05 was considered as statistically significant difference.