Targeting osteoclast-derived DPP4 alleviates inflammation-mediated ectopic bone formation in ankylosing spondylitis.

doi:10.21203/rs.3.rs-3226517/v1

Download PDF

Research Article

Targeting osteoclast-derived DPP4 alleviates inflammation-mediated ectopic bone formation in ankylosing spondylitis.

https://doi.org/10.21203/rs.3.rs-3226517/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Background: Ankylosing spondylitis (AS) is a chronic inflammatory disease characterized by ectopic bone formation. The anti-inflammatory function of dipeptidyl peptidase-4 (DPP4) inhibitor has been reported in bone metabolism, but its utility in AS has not previously been investigated.

Methods: We assessed DPP4 level in serum, synovial fluid, and facet joint tissue of AS patients. Additionally, we investigated the effect of a DPP4 inhibitor in an experimental AS mouse model induced by intraperitoneal injection with 3 mg curdlan. Following curdlan injection, SKG mice were orally administered a DPP4 inhibitor three times per week for 5 weeks, and ankles of mice were scored for thickness and given clinical arthritis scores. At the end of 5 weeks, mice were sacrificed, and micro-CT and histological analyses were performed. Furthermore, osteoclast precursor cells (OPCs) from curdlan-injected SKG mice were treated with DPP4 inhibitor, and the effects of this treatment on osteoclastogenesis and differentiation markers were evaluated.

Results: Soluble DPP4 level was elevated in the serum and synovial fluid of patients with AS compared to those in the control group. Expression of DPP4 increased gradually during human osteoclastogenesis and was high in mature osteoclasts. Histological analysis revealed that oral administration of a DPP4 inhibitor resulted in a decrease in thickness of the hind paw, clinical arthritis scores, and enthesitis at the ankle in curdlan-injected SKG mice compared to the control group. Micro-CT data showed a significant reduction in inflammation-induced low bone density and ectopic bone formation in the DPP4 inhibitor group compared to those in the control group. Intriguingly, DPP4 co-expressed in TRAP-positive osteoclasts was detected in ectopic bone in the tibia of curdlan-injected SKG mice as well as spinal bone tissue of AS patients. Moreover, treatment with a DPP4 inhibitor significantly reduced osteoclastogenesis in the bone marrow of curdlan-injected SKG mice in addition to decreasing expression of osteoclast differentiation markers.

Conclusion: Our findings suggest that inhibiting DPP4 may have a therapeutic effect on excessive bone formation in AS patients.

Dipeptidyl peptidase-4 (DPP4) inhibitor

osteoclasts

curdlan-injected SKG mice

inflammation-mediated ectopic bone formation

Ankylosing spondylitis (AS) is a chronic inflammatory disease that affects the joints and enthesis in the axial skeleton [1, 2]. Clinically, TNF or IL-17 inhibitors can reduce inflammation and slow the progression of ankylosis [3–7]. Pathophysiologically, the progression of spinal ankylosis can be explained by the formation of bony bridges (syndesmophytes) that form as a result of long-term exposure to chronic inflammation [8]. Excessive osteoblast activity is considered the main mechanism underlying AS. However, recent studies have shown that active osteoclasts are present in ectopic bone in AS and could contribute to the progression of ectopic bone formation [9, 10]. Therefore, factors derived from active osteoclasts could potentially trigger excessive osteoblast activity, leading to the onset and progression of AS.

Osteoclasts are responsible for bone resorption and play a crucial role in bone remodeling and homeostasis [11]. Osteoclast precursor cells (OCPs) are derived from CD14-positive monocytes of peripheral mononuclear cells (PBMCs). OCPs differentiate into osteoclasts upon stimulation by two key ligands: macrophage colony-stimulating factor (M-CSF) and receptor activator of nuclear factor kappa-B ligand (RANKL) [12, 13]. Binding of RANKL to the receptor activator of nuclear factor kappa-B (RANK/TNFRSF11a) induces nuclear factor-activated T cells c1 (NFATc1), which plays a crucial role in osteoclastogenesis and the maturation of osteoclasts. In particular, osteoclast-derived coupling factors not only control bone remodeling, but are also associated with bone-related diseases [14–17].

Dipeptidyl peptidase-4 (DPP4) is a widely expressed multifunctional serine peptidase that exists as a membrane-anchored cell surface protein or in soluble form in the plasma [18]. It is a novel adipokine that plays a crucial role in the development of obesity and insulin resistance [19], both of which have been suggested to be involved in the pathogenesis of osteoporosis [20]. Interestingly, DPP4 inhibitors have been shown to reduce the risk of bone fracture based on meta-analyses of randomized clinical trials [21–23]. Additionally, DPP4 activity was shown to be positively correlated with osteoporosis in post-menopausal women [24–27], while the use of denosumab in patients with osteoporosis decreased DPP4 level compared to the placebo group [28]. DPP4 expression is enriched in human osteoclasts [29], and DPP4 inhibitors have been shown to reduce osteoclast differentiation and bone resorption in vivo [28, 30]. Although DPP4 inhibitors decrease fibroblast ossification in AS [31], the exact relationship between DPP4 and AS remains uncertain.

In this study, we observed significant elevation of DPP4 level in the serum and synovial fluid of patients with AS compared to the control group. We also demonstrated that expression of DPP4 in mature osteoclasts and targeting of DPP4 reduced arthritis, enthesitis, and ectopic bone formation in the ankles of curdlan-injected SKG mice in vivo as well as of osteoclastogenesis in vitro.

Sample collection and DPP4 measurement

All patients with AS enrolled in this study fulfilled the evaluation of 1984 modified New York criteria for AS [32]. Thirty AS serum were collected from male patients and 26 healthy control (HC) serum samples were collected from males without inflammatory disease. Synovial fluid was collected from seven patients with osteoarthritis (OA) who met the criteria for knee OA [33], in addition to 24 patients with AS. Facet bone tissue samples were obtained from five patients with AS and five patients without inflammatory disease. Demographic information of the patients from which the serum and synovial fluid samples were collected was described in a previous study [34]. DPP4 level in serum and synovial fluid was determined using a commercial ELISA kit (RK02755, ABclonal) according to the manufacturer’s protocol.

Immunohistochemistry

Immunohistochemistry was performed as described previously [35]. Briefly, 5-µm paraffin-embedded sections of facet joints were deparaffinized and permeabilized. Endogenous peroxidase was eliminated, and antigen retrieval was performed using protein K. Slides were incubated with a primary antibody against DPP4 overnight and then with a secondary antibody, followed by staining and visualization using an ABC kit and DAB substrate kit. Stained slides were visualized under a microscope (Ti-U; Nikon, Tokyo, Japan). To quantify the expression of DPP4, the number of positively stained cells was determined among the total number of cells in three random fields. High-power fields were observed at 200x magnification.

Human CD14 isolation and osteoclasts differentiation

Human and murine OCP isolation and osteoclast differentiation were performed as described previously [36, 37]. Briefly, human peripheral blood mononuclear cells (PBMC)/CD14 + cells (130-050-201; Miltenyi Biotec) were cultured in 20 ng/mL human M-CSF (300 − 25; Peprotech) in α-MEM medium (Gibco) including 10% FBS (Gibco) and 1% penicillin/streptomycin (Gibco) for 2 days to generate osteoclast precursor cells (OCPs). Then, OCPs were incubated with 20 ng/mL M-CSF and 40 ng/mL RANKL (310-01; Peprotech) for an additional 6 days. Culture medium was replenished every 3 days. Murine bone marrow cells were obtained from femurs and tibias of curdlan-injected SKG mice and were treated with ACK lysis buffer (A10492-01; Gibco) to remove RBCs and cultured on dishes with 10 ng/mL murine M-CSF (315-02; Peprotech) for 1 day. Then, suspension cells were collected and further cultured with 20 ng/mL murine M-CSF for 1 day, followed by treatment with 50 ng/mL M-CSF and 100 ng/mL RANKL (315 − 11; Peprotech) for 4 days. The culture medium was replaced every 3 days.

At the end of the culture period, mature osteoclasts were fixed in 10% formalin and stained for acid phosphatase 5, tartrate resistant (TRAP) using a commercial kit (PMC-AK04-COS; CosmoBio) according to the manufacturer’s recommendations. TRAP + osteoclasts (more than three nuclei) were counted. To detect F-actin ring formation, cells were fixed and permeabilized with 0.1% Triton X-100 and then incubated with FITC-conjugated phalloidin (P5282; Sigma- Aldrich) for 60 min at 37°C. Images of stained cells were collected under a microscope equipped with a camera (Ti-U; Nikon, Tokyo, Japan).

RNA extraction and mRNA analysis

RT-PCR and qPCR were performed as previously described [35]. Primers used for RT-qPCR reactions were as follows: hTRAP-qF, TGGCTTTGCCTATGTGGA; hTRAP-qR, CCTGGTCTTAAAGAGGGACTT; mTRAP-qF, ACGGCTACTTGCGGTTTC; mTRAP-qR, TCCTTGGGAGGCTGGTC; hCTK-qF, CTCTTCCATTTCTTCCACGAT; hCTK-qR, ACACCAACTCCCTTCCAAAG; mCTK-qF, AAGATATTGGTGGCTTTGG; mCTK-qR, ATCGCTGCGTCCCTCT; hITGB3-qF, GGAAGAACGCGCCAGAGCAAAATG; hITGB3-qR, CCCCAAATCCCTCCCCACAAATAC; mITGB3-qF, GAAACAGAGCGTGTCCCGTA; mITGB3-qR, GGTCTTGGCATCCGTGGTAA; hDC-STAMP-qF, AAAGCTTGCCAGGGTTTGAG; hDC-STAMP-qR, GGTTTTGGGATACAGTTGGGTTC; mDC-STAMP-qF, TCCTCCATGAACAAACAGTT; mDC-STAMP-qR, AGACGTGGTTTAGGAATGCA; hNFATc1-qF, GCATCACAGGGAAGACCGTGTC; hNFATc1-qR, GAAGTTCAATGTCGGAGTTTCTGAG; mNFATc1-qF, CCCGTCACATTCTGGTCCAT; mNFATc1-qR, CAAGTAACCGTGTAGCTCCACAA; hDPP4-qF, GACACCGTGGAAGGTTCTTCT; hDPP4-qR, CTGTAGCATCATCTGTGCCTT; hGAPDH-qF, ATCAAGAAGGTGGTGAAGCA; hGAPDH-qR, GTCGCTGTTGAAGTCAGAGGA; mB-Actin-qF, CCTGAACCCTAAGGCCAACC; mB-Actin-qR, ATGGCGTGAGGGAGAGCATA.

Protein extraction and immunoblotting analysis

Immunoblotting was performed as described previously with minor modifications [10]. Primary antibodies against NFATc1 (556602, BD Biosciences), DPP4 (A1455, ABclonal), GAPDH (AC033, ABclonal), phosY527 SRC (2105, Cell Signaling), phos-Y416 SRC (2101, Cell Signaling), total SRC (2108, Cell Signaling), phos-p38 (9215, Cell Signaling), total-p38 (sc-535, Santa Cruz), phos-ERK (9102, Cell Signaling), phos-JNK (9255, Cell Signaling), and β-actin (A2228, Sigma) were used. Secondary antibodies and HRP-conjugated IgGs (111-035-003 and 115-035-003) were from Jackson Immune Research. Immunoblots were visualized with a ChemiDoc XRS System (Bio-Rad) and analyzed with Image Lab 5.2 software (Bio-

Immunofluorescence

Cells were seeded onto glass coverslips in 24-well plates at 5×10⁴ cells per well. The next day, cells were rinsed with ice-cold PBS and fixed with 4% paraformaldehyde in PBS. Following cell fixation, cells were blocked with blocking solution (0.3% Triton X-100, 1% bovine serum albumin, and 10% normal goat serum in PBS) for 1 h at room temperature. Cells were incubated with appropriate primary antibodies in blocking solution overnight at 4^oC and then with Cy3-conjugated anti-rabbit antibody (111-165-144, Jackson ImmunoResearch Laboratories) or Alexa Fluor 594-conjugated anti-mouse antibody (A-11005, Thermo Fisher Scientific). After mounting with VECTASHIELD Mounting Medium with DAPI (H-1200, Vector Laboratories). images were acquired by confocal microscopy (Leica Microsystems, Germany).

Curdlan-injected SKG mice

All experimental procedures were performed in accordance with the Guide for the Care and Use of Laboratory Animals and were approved by the Animals Ethics Screening Committee of Hanyang University (2022-0027A). ZAP-70 mutant SKG mice were originally obtained from Dr. Sakaguchi (Osaka University, Japan). Eight-week-old male SKG mice (total n = 10) were intraperitoneally injected with 3 mg of curdlan. One week later, SKG mice were randomly divided into two groups (n = 5 mice for each group). One group received PBS injections, while the other received oral administration of DPP4 inhibitor, (30 µg; S3031, Selleckchem) three times weekly for 5 weeks. All mice were monitored for up to 5 weeks and scored by the same observer, who was blinded, as follows: 0 = no swelling or redness, 0.1 = swelling or redness of digits, 0.5 = mild swelling and/or redness of wrists or ankle joints, and 1 = severe swelling of the larger joints. Scores of the affected joints were summed, with a maximum possible score of 6 [38]. Histopathological features of mouse ankles were scored on a scale of 1–4, where 1 = few infiltrating immune cells, 2 = 1–2 small patches of inflammation, 3 = inflammation throughout the ankle joint, and 4 = inflammation in soft tissue/entheses/fasciitis [38]. To quantitatively evaluate the severity of enthesitis, mouse paws were scored using a previously described scoring system where 1 = mild inflammation at the tendon insertion site, 2 = mild-to moderate inflammatory infiltrate at the insertion site and along the tendon, 3 = severe inflammation with bone involvement, and 4 = severe inflammation with obliteration of the tendon-bone interface [39].

Mice were then sacrificed, and their femurs and tibia were collected to isolate bone marrow cells for osteoclast differentiation.

Histological and microCT analysis

Ankles of sacrificed mice were fixed with 10% formalin for 1 week and decalcified with 20% EDTA at 4°C for at least 1 month. Paraffin-embedded tissue blocks were sectioned at 5-µm thickness. Sections were used for histological analysis and osteoclasts for TRAP examination. Staining procedures were conducted in accordance with standard protocols or the manufacturer’s instructions. Slides were stained with hematoxylin (1.05174.0500, Merck) and eosin (H&E) for histological observation. All slides were mounted with permanent mounting medium (H-5000, Vector Lab).

Micro-computed tomography (MicroCT) analyses were conducted, and data were analyzed by the 2nd Analysis Lab (Seoul, Korea). Mouse ankles were fixed in 10% formalin for 1 week and analyzed by high-resolution MicroCT (Skyscan1272, Bruker microCT, Kontich, Belgium). Scanner settings were as follows: voltage of 60 kV, aluminum filter of 0.25 mm, and a resolution of 9 µm per pixel. MicroCT images were used for three-dimensional (3D) histomorphometric analyses. Images were reconstructed with NRecon v1.7.3.1 software (Bruker microCT) + InstaRecon software (InstaRecon), analyzed by CTAn v1.20.3.0 software (Bruker microCT), and visualized using the 3D model visualization software CTVol v2.3.2.0 (Bruker microCT).

Statistics analysis

Graph-Pad Prism 7 was used to produce graphs and to perform statistical analyses. The normality of the data was assessed with the Shapiro-Wilk test. The Mann-Whitney test or Student’s t-test was performed to assess the statistical significance of differences between groups for data with a normal distribution. When more than two groups were compared, either one-way ANOVA or the Kruskal-Wallis test was used. Values are presented as mean ± standard error of the mean (SEM). All experiments were conducted at least three times. Asterisks represent the level of statistical significance (* p < 0.05, ** p < 0.01, *** p < 0.001).

DPP4 expression is elevated in the serum, synovial fluid, and facet joint tissue samples of AS patients

We first examined the DPP4 level in collected human serum and synovial fluid of AS patients and compared it to that in control patients. Soluble DPP4 was significantly elevated in serum (Fig. 1A) and synovial fluid (Fig. 1B) samples of AS patients. Given this finding, we next examined expression of DPP4 in the facet joint tissues of AS patients. Immunohistochemistry analysis and quantification revealed that DPP4 expression was higher in the bone marrow cells of AS patients than control patients (Figs. 1C and 1D). These results indicate that DPP4 expression is elevated in AS patients.

DPP4 is highly expressed in human mature osteoclasts

Recently, Weivoda and colleagues reported that DPP4 is highly expressed in bone marrow-derived osteoclasts [28] and GSE225974 was reanalyzed to reveal an increase of DPP4 in human osteoclasts (Fig. 1A). To test whether DPP4 is expressed by osteoclasts, we differentiated osteoclasts from human CD14-positive monocytes of human blood as shown in Fig. 2B. Human mature osteoclasts at 9 days were well-formed, as determined by TRAP and F-actin assays (Fig. 2C). NFATc1 protein level was upregulated in mature osteoclasts at 9 days, and DPP4 protein level increased gradually during osteoclastogenesis (Fig. 2D). RT-qPCR data indicated that DPP4 mRNA expression was gradually upregulated during osteoclastogenesis in addition to levels of osteoclast differentiation markers such as tartrate-resistant acid phosphatase (TRAP), cathepsin K (CTK), integrin beta chain beta 3 (ITGB3), and dendritic cell-specific transmembrane protein (DC-STAMP). As shown in Figure S1A, DPP4 expression was observed in M-CSF-exposed osteoclast precursors cells (OCPs), while DPP4 expression was relatively pronounced after osteoclastogenesis stimulated by M-CSF and RANKL. Consistent with the data shown in Fig. 1A, DPP4 was expressed in osteoclasts (Figure S1B). Immunofluorescence revealed DPP4 expression in human mature osteoclasts (Fig. 2F), and TRAP-positive DPP4-expressing osteoclasts were enriched in AS facet joints that had undergone bone remodeling (Figure S2, white arrows). These findings indicate that DPP4 is expressed by mature human osteoclasts.

Oral administration of DPP4 inhibitor attenuates arthritis and inflammation-mediated ectopic bone formation in the peripheral joints of curdlan-injected SKG mice in vivo

Since we identified high level of DPP4 in AS patients, we investigated the effects of the DPP4 inhibitor metformin in a curdlan-injected SKG mice model (Fig. 3A). As shown in Fig. 3B, dactylitis, arthritis, enthesitis, and ectopic bone in ankles were observed in curdlan-injected SKG mice, whereas oral administration of DPP4 inhibitor dramatically alleviated clinical symptoms such as arthritis scores and hind paw thickness in curdlan-injected SKG mice (Fig. 3B and 3C). Moreover, popliteal lymph node size was greater in curdlan-injected SKG mice than control mice but reduced in the DPP4 inhibitor group (Figure S3). Micro-CT analysis indicates that mice treated with the DPP4 inhibitor had reduced inflammation-induced ectopic bone formation and low bone density in their feet (Figs. 3D and 3E, red arrows). MicroCT analysis revealed that there was no difference of normal bone density between them, but significant reduction on low bone density was shown in DPP4 inhibitor group compared to the control (Fig. 3F, red arrows). Interestingly, histologic analysis of the ankles of curdlan-injected SKG mice showed elevation in the percentages of hypertrophic chondrocytes and TRAP-positive cells (Fig. 3G, black arrows), whereas mice in the DPP4 inhibitor group showed a significant reduction in ectopic bone formation and TRAP-positive cells in the ankle (Fig. 3G). Moreover, histological scores for the ankle including inflammation at the bone marrow and enthesitis were reduced in the DPP4 inhibitor group compared to the curdlan-injected SKG mice group (Fig. 3H). Taken together, these data confirm that DPP4 inhibitor treatment decreased arthritis, including dactylitis and inflammation-mediated ectopic bone formation, in the peripheral joints of curdlan-injected SKG mice.

DPP4 inhibitor treatment diminishes osteoclast differentiation from curdlan-injected SKG mice in vitro

To explore whether DPP4 inhibitor treatment affected osteoclastogenesis, we isolated bone marrow cells of curdlan-injected SKG mice and treated these murine OPCs with a DPP4 inhibitor. Treatment with the DPP4 inhibitor decreased the number of TRAP-positive osteoclasts as well as osteoclast differentiation markers such as ITGB3, DC-STAMP, NFATc1, CTK, and TRAP (Figs. 4A and 4B). DPP4 inhibitor treatment also inhibited expression of NFATc1 in murine osteoclasts accompanied by decrease in phos-p38 and phos-Y527 SRC protein expression as revealed by immunoblotting (Fig. 4C). Interestingly, expression of osteoblast differentiation markers (ALP and IBSP) tended to increase during differentiation whereas DPP4 expression decreased (Fig. 4D). The DPP4 inhibitor had no effect on the osteogenic differentiation of primary osteoprogenitor cells (Fig. 4E). Collectively, these data demonstrate that DPP4 inhibitor treatment diminishes osteoclast differentiation but not osteoblast differentiation in curdlan-injected SKG mice.

This study highlights the potential therapeutic effect of DPP4 inhibitor treatment on ectopic bone formation in AS in vivo and in vitro. We demonstrated elevated level of DPP4 in serum, synovial fluid, and facet joint tissue samples of AS patients compared to control samples. Furthermore, we demonstrated high expression of DPP4 in mature osteoclasts. In vivo experiments using curdlan-injected SKG mice showed that targeting DPP4 significantly alleviated arthritis, dactylitis, and ectopic bone formation in peripheral joints. In vitro experiments revealed that the DPP4 inhibitor metformin reduced TRAP-positive osteoclast formation and NFATc1 expression in addition to decreasing phos-Y527 SRC and phos-p38 expression. Collectively, these findings suggest that DPP4 expressed in mature osteoclasts plays a crucial role in inflammation-mediated ectopic bone formation in AS pathogenesis, indicating that targeting DPP4 could be a promising therapeutic option.

Bone is a dynamic tissue that constantly changes and regenerates by three consecutive steps: bone resorption by osteoclasts, transition from catabolism to anabolism, and bone formation by osteoblasts. Each step is tightly controlled by molecules mediating communication among bone cells (osteoclasts, osteoblasts, and osteocytes) to maintain bone homeostasis and remodeling. However, an imbalance in bone remodeling leads to various forms of bone disorder such as osteoporosis, osteopenia, osteopetrosis, or AS [40]. Importantly, osteoclast-derived coupling factors are crucial in bone-related disorders [14] as they release several soluble factors that stimulate osteoblast activity such as platelet-derived growth factor-BB (PDGF-BB), cardiotrophin-1 (CT-1), sphingosine-1-phosphate (S1P), WNT10B, BMP6, and complement factor 3a (C3a) [17, 41–45]. Therefore, controlling osteoblast activity in bone-related disease may have therapeutic potential.

A higher body mass index (BMI) is associated with an increased risk of developing type 2 diabetes. DPP4 inhibitors are commonly used to treat type 2 diabetes. Obesity is also positively associated with inflammation, disease activity, and syndesmophyte formation in patients with axial spondyloarthritis [46–48]. Additionally, the use of anti-TNF therapy in AS patients influences body weight and composition [49]. While the association between type 2 diabetes and AS is complex and undetermined, previous studies have reported the anti-inflammatory effects of metformin, a DPP4 inhibitor, in various experimental disease models including rheumatoid arthritis, inflammatory bowel disease, obesity, scleroderma, Sjögren's syndrome, and lupus. Moreover, metformin has been shown to have therapeutic effects on multiple sclerosis and osteoporosis. These studies suggest that DPP4 inhibitors, such as metformin, may target pathological immune cells and ameliorate autoimmune and autoinflammatory diseases.

We observed that treatment with metformin reduced murine osteoclastogenesis in bone marrow cells from curdlan-injected SKG mice (Fig. 4A). Previous study reported that a DPP4 inhibitor had potent suppressive effects on the ossification of fibroblasts in AS In contrast, our findings suggest that DPP4 inhibitor treatment did not influence osteogenic differentiation of primary osteoprogenitor cells (Fig. 4E). The DPP4 inhibitor we used selectively regulated osteoclasts differentiation without affecting osteoblasts. Moreover, previous studies have reported that DPP4 is increased in postmenopausal women and correlated with increased bone turnover [24, 50]. These findings suggest that DPP4 inhibitor treatment could be a potential therapeutic option for conditions such as osteoporosis or rheumatoid arthritis due to the specific expression of DPP4 in osteoclasts and the anti-inflammatory effects of its suppression.

Cho and colleagues reported the anti-inflammatory effects of metformin in various experimental disease models including rheumatoid arthritis, inflammatory bowel disease, obesity, scleroderma, Sjögren's syndrome, and lupus [51–57]. Other studies have also demonstrated the therapeutic effects of metformin in multiple sclerosis and osteoporosis [58, 59]. These findings suggest a new role for DPP4 inhibitor in suppressing inflammation and inhibiting osteoclastogenesis.

Our study has several limitations that should be considered. First, we compared DPP4 levels in the serum and synovial fluid of AS patients to that in healthy donors and osteoarthritis patients, respectively. While DPP4 levels were higher in both RA and AS patients than their respective control groups, there was no significant difference between the two patient groups. Second, the prevalence of type 2 diabetes among AS patients was not taken into consideration. Although AS treatment reduces inflammation and disease progression, it does not halt bony progression. In our study, we evaluated the effects of a DPP4 inhibitor on arthritis and ectopic bone formation in peripheral joints using a curdlan-injected SKG mice model. Further research is required to investigate the potential preventive effects of DPP4 inhibitors on AS. Additionally, we did not examine the association between DPP4 and platelet-derived growth factor-BB (PDGF-BB), which is secreted by active osteoclasts and can exacerbate bone mineralization in enthesis cells. Finally, we did not consider disease activity or disease indicators in AS patients when analyzing DPP4 level in serum and synovial fluid samples. Further large-scale multicenter cohort studies are needed to better understand the relationship between type 2 diabetes and AS.

In summary, we demonstrated elevated level of DPP4 in the serum, synovial fluid, and spinal tissues of AS patients. Moreover, DPP4 was expressed at high levels by osteoclasts, particularly those in the spinal bone tissues of AS patients. Inhibition of DPP4 effectively reduced ectopic bone formation and osteoclastogenesis in curdlan-injected SKG mice, both in vivo and in vitro. These findings highlight the potential of DPP4 inhibitors as therapeutic agents for alleviating ectopic bone formation in AS.

Ethics approval and consent to participate

This study was approved by the ethics committee of Hanyang University Seoul Hospital, and written informed consent was obtained from all study participants [2014-05-001, 2014-05-002].

Consent for publication

Not applicable.

Competing Interest

The authors declare no conflicts of interest.

Funding

This work was supported by the Basic Science Research Program through grants from the National Research Foundation of Korea (2019R1A2C2004214, 2020R1A2C1102386, and 2021R1A6A1A03038899) and the Korea Healthy Industry Development Institute (HI23C0661).

Author contributions

KHL, SJ, and SHL, designed the experiments. SJ, SHL, CJ, MW, and H-RJ performed the experiments and assisted with the laboratory work. JY provided SKG mice. KHL, C-HL, Y-SP provided and evaluated the human bone samples. SJ and T-HK conceived the project and was responsible for the overall design and oversight of the project.

Acknowledgments

Not applicable.

Availability of data and materials

All data and materials supporting the conclusions are included in the main figures and additional files. Corresponding authors can be contacted for more details methods and raw results.

Zhu W, He X, Cheng K, Zhang L, Chen D, Wang X, Qiu G, Cao X, Weng X. Ankylosing spondylitis: etiology, pathogenesis, and treatments. Bone Res. 2019;7:22.
Inman RD. Axial Spondyloarthritis: Current Advances, Future Challenges. J Rheumatic Dis. 2021;28(2):55–9.
Ward MM, Deodhar A, Gensler LS, Dubreuil M, Yu D, Khan MA, Haroon N, Borenstein D, Wang R, Biehl A, et al. 2019 Update of the American College of Rheumatology/Spondylitis Association of America/Spondyloarthritis Research and Treatment Network Recommendations for the Treatment of Ankylosing Spondylitis and Nonradiographic Axial Spondyloarthritis. Arthritis Rheumatol. 2019;71(10):1599–613.
Haroon N, Inman RD, Learch TJ, Weisman MH, Lee M, Rahbar MH, Ward MM, Reveille JD, Gensler LS. The impact of tumor necrosis factor alpha inhibitors on radiographic progression in ankylosing spondylitis. Arthritis Rheum. 2013;65(10):2645–54.
Koo BS, Oh JS, Park SY, Shin JH, Ahn GY, Lee S, Joo KB, Kim TH. Tumour necrosis factor inhibitors slow radiographic progression in patients with ankylosing spondylitis: 18-year real-world evidence. Ann Rheum Dis. 2020;79(10):1327–32.
Abate MV, Sandrin C, Pastore S. Secukinumab for ankylosing spondylitis. Lancet. 2014;383(9919):780.
Baeten D, Baraliakos X, Braun J, Sieper J, Emery P, van der Heijde D, McInnes I, van Laar JM, Landewe R, Wordsworth P, et al. Anti-interleukin-17A monoclonal antibody secukinumab in treatment of ankylosing spondylitis: a randomised, double-blind, placebo-controlled trial. Lancet. 2013;382(9906):1705–13.
Baraliakos X, Listing J, Rudwaleit M, Sieper J, Braun J. The relationship between inflammation and new bone formation in patients with ankylosing spondylitis. Arthritis Res Ther. 2008;10(5):R104.
Yu T, Zhang J, Zhu W, Wang X, Bai Y, Feng B, Zhuang Q, Han C, Wang S, Hu Q, et al. Chondrogenesis mediates progression of ankylosing spondylitis through heterotopic ossification. Bone Res. 2021;9(1):19.
Jo S, Lee SH, Park J, Nam B, Kim H, Youn J, Lee S, Kim TJ, Sung IH, Choi SH, et al. Platelet-Derived Growth Factor B Is a Key Element in the Pathological Bone Formation of Ankylosing Spondylitis. J Bone Miner Res. 2023;38(2):300–12.
Boyle WJ, Simonet WS, Lacey DL. Osteoclast differentiation and activation. Nature. 2003;423(6937):337–42.
Ikebuchi Y, Aoki S, Honma M, Hayashi M, Sugamori Y, Khan M, Kariya Y, Kato G, Tabata Y, Penninger JM, et al. Coupling of bone resorption and formation by RANKL reverse signalling. Nature. 2018;561(7722):195–200.
Kong YY, Yoshida H, Sarosi I, Tan HL, Timms E, Capparelli C, Morony S, Oliveira-dos-Santos AJ, Van G, Itie A, et al. OPGL is a key regulator of osteoclastogenesis, lymphocyte development and lymph-node organogenesis. Nature. 1999;397(6717):315–23.
Henriksen K, Karsdal MA, Martin TJ. Osteoclast-derived coupling factors in bone remodeling. Calcif Tissue Int. 2014;94(1):88–97.
Kim BJ, Lee YS, Lee SY, Baek WY, Choi YJ, Moon SA, Lee SH, Kim JE, Chang EJ, Kim EY, et al. Osteoclast-secreted SLIT3 coordinates bone resorption and formation. J Clin Invest. 2018;128(4):1429–41.
Su W, Liu G, Liu X, Zhou Y, Sun Q, Zhen G, Wang X, Hu Y, Gao P, Demehri S et al. Angiogenesis stimulated by elevated PDGF-BB in subchondral bone contributes to osteoarthritis development. JCI Insight. 2020;5(8).
Xie H, Cui Z, Wang L, Xia Z, Hu Y, Xian L, Li C, Xie L, Crane J, Wan M, et al. PDGF-BB secreted by preosteoclasts induces angiogenesis during coupling with osteogenesis. Nat Med. 2014;20(11):1270–8.
Drucker DJ. Glucagon-like peptides. Diabetes. 1998;47(2):159–69.
Conarello SL, Li Z, Ronan J, Roy RS, Zhu L, Jiang G, Liu F, Woods J, Zycband E, Moller DE, et al. Mice lacking dipeptidyl peptidase IV are protected against obesity and insulin resistance. Proc Natl Acad Sci U S A. 2003;100(11):6825–30.
Napoli N, Chandran M, Pierroz DD, Abrahamsen B, Schwartz AV, Ferrari SL, Bone IOF, Diabetes Working G. Mechanisms of diabetes mellitus-induced bone fragility. Nat Rev Endocrinol. 2017;13(4):208–19.
Ustulin M, Park SY, Choi H, Chon S, Woo JT, Rhee SY. Effect of Dipeptidyl Peptidase-4 Inhibitors on the Risk of Bone Fractures in a Korean Population. J Korean Med Sci. 2019;34(35):e224.
Schwartz AV, Vittinghoff E, Bauer DC, Hillier TA, Strotmeyer ES, Ensrud KE, Donaldson MG, Cauley JA, Harris TB, Koster A, et al. Association of BMD and FRAX score with risk of fracture in older adults with type 2 diabetes. JAMA. 2011;305(21):2184–92.
Monami M, Dicembrini I, Antenore A, Mannucci E. Dipeptidyl peptidase-4 inhibitors and bone fractures: a meta-analysis of randomized clinical trials. Diabetes Care. 2011;34(11):2474–6.
Zheng T, Yang L, Liu Y, Liu H, Yu J, Zhang X, Qin S. Plasma DPP4 Activities Are Associated With Osteoporosis in Postmenopausal Women With Normal Glucose Tolerance. J Clin Endocrinol Metab. 2015;100(10):3862–70.
Yang F, Zheng T, Gao Y, Baskota A, Chen T, Ran X, Tian H. Increased plasma DPP4 activity is an independent predictor of the onset of metabolic syndrome in Chinese over 4 years: result from the China National Diabetes and Metabolic Disorders Study. PLoS ONE. 2014;9(3):e92222.
Meier C, Schwartz AV, Egger A, Lecka-Czernik B. Effects of diabetes drugs on the skeleton. Bone. 2016;82:93–100.
Qiu M, Zhai S, Liu D. DPP4 Activities Are Associated with Osteopenia/Osteoporosis and Fracture Risk in Newly Diagnosed Type 2 Diabetes. Int J Endocrinol. 2020;2020:8874272.
Weivoda MM, Chew CK, Monroe DG, Farr JN, Atkinson EJ, Geske JR, Eckhardt B, Thicke B, Ruan M, Tweed AJ, et al. Identification of osteoclast-osteoblast coupling factors in humans reveals links between bone and energy metabolism. Nat Commun. 2020;11(1):87.
Nishida H, Suzuki H, Madokoro H, Hayashi M, Morimoto C, Sakamoto M, Yamada T. Blockade of CD26 signaling inhibits human osteoclast development. J Bone Miner Res. 2014;29(11):2439–55.
Ishida M, Shen WR, Kimura K, Kishikawa A, Shima K, Ogawa S, Qi J, Ohori F, Noguchi T, Marahleh A, et al. DPP-4 inhibitor impedes lipopolysaccharide-induced osteoclast formation and bone resorption in vivo. Biomed Pharmacother. 2019;109:242–53.
Qin X, Jiang T, Liu S, Tan J, Wu H, Zheng L, Zhao J. Effect of metformin on ossification and inflammation of fibroblasts in ankylosing spondylitis: An in vitro study. J Cell Biochem. 2018;119(1):1074–82.
van der Linden S, Valkenburg HA, Cats A. Evaluation of diagnostic criteria for ankylosing spondylitis. A proposal for modification of the New York criteria. Arthritis Rheum. 1984;27(4):361–8.
Altman R, Asch E, Bloch D, Bole G, Borenstein D, Brandt K, Christy W, Cooke TD, Greenwald R, Hochberg M, et al. Development of criteria for the classification and reporting of osteoarthritis. Classification of osteoarthritis of the knee. Diagnostic and Therapeutic Criteria Committee of the American Rheumatism Association. Arthritis Rheum. 1986;29(8):1039–49.
Jo S, Wang SE, Lee YL, Kang S, Lee B, Han J, Sung IH, Park YS, Bae SC, Kim TH. IL-17A induces osteoblast differentiation by activating JAK2/STAT3 in ankylosing spondylitis. Arthritis Res Ther. 2018;20(1):115.
Jo S, Nam B, Lee YL, Park H, Weon S, Choi S-H, Park Y-S, Kim T-H. The TNF-NF-κB-DKK1 Axis Promoted Bone Formation in the Enthesis of Ankylosing Spondylitis. J Rheumatic Dis. 2021;28(4):216–24.
Oh Y, Park R, Kim SY, Park SH, Jo S, Kim TH, Ji JD. B7-H3 regulates osteoclast differentiation via type I interferon-dependent IDO induction. Cell Death Dis. 2021;12(11):971.
Jeon C, Jang Y, Lee SH, Weon S, Park H, Lee S, Oh Y, Choi SH, Wang SE, Kim TH, et al. Abnormal kynurenine level contributes to the pathological bone features of ankylosing spondylitis. Int Immunopharmacol. 2023;118:110132.
Ruutu M, Thomas G, Steck R, Degli-Esposti MA, Zinkernagel MS, Alexander K, Velasco J, Strutton G, Tran A, Benham H, et al. : beta-glucan triggers spondylarthritis and Crohn's disease-like ileitis in SKG mice. Arthritis Rheum. 2012;64(7):2211–22.
Benham H, Rehaume LM, Hasnain SZ, Velasco J, Baillet AC, Ruutu M, Kikly K, Wang R, Tseng HW, Thomas GP, et al. Interleukin-23 mediates the intestinal response to microbial beta-1,3-glucan and the development of spondyloarthritis pathology in SKG mice. Arthritis Rheumatol. 2014;66(7):1755–67.
Feng X, McDonald JM. Disorders of bone remodeling. Annu Rev Pathol. 2011;6:121–45.
Sims NA, Martin TJ. Coupling Signals between the Osteoclast and Osteoblast: How are Messages Transmitted between These Temporary Visitors to the Bone Surface? Front Endocrinol (Lausanne). 2015;6:41.
Walker EC, McGregor NE, Poulton IJ, Pompolo S, Allan EH, Quinn JM, Gillespie MT, Martin TJ, Sims NA. Cardiotrophin-1 is an osteoclast-derived stimulus of bone formation required for normal bone remodeling. J Bone Miner Res. 2008;23(12):2025–32.
Ryu J, Kim HJ, Chang EJ, Huang H, Banno Y, Kim HH. Sphingosine 1-phosphate as a regulator of osteoclast differentiation and osteoclast-osteoblast coupling. EMBO J. 2006;25(24):5840–51.
Pederson L, Ruan M, Westendorf JJ, Khosla S, Oursler MJ. Regulation of bone formation by osteoclasts involves Wnt/BMP signaling and the chemokine sphingosine-1-phosphate. Proc Natl Acad Sci U S A. 2008;105(52):20764–9.
Matsuoka K, Park KA, Ito M, Ikeda K, Takeshita S. Osteoclast-derived complement component 3a stimulates osteoblast differentiation. J Bone Miner Res. 2014;29(7):1522–30.
Kim SK, Choe JY, Lee SS, Shin K. Body mass index is related with the presence of syndesmophyte in axial spondyloarthritis: Data from the Korean College of Rheumatology BIOlogics (KOBIO) registry. Mod Rheumatol. 2017;27(5):855–61.
Handler SD. Trauma to the larynx and upper trachea. Int Anesthesiol Clin. 1988;26(1):39–41.
Roberts MJ, Leonard AN, Bishop NC, Moorthy A. Lifestyle modification and inflammation in people with axial spondyloarthropathy-A scoping review. Musculoskelet Care. 2022;20(3):516–28.
Briot K, Gossec L, Kolta S, Dougados M, Roux C. Prospective assessment of body weight, body composition, and bone density changes in patients with spondyloarthropathy receiving anti-tumor necrosis factor-alpha treatment. J Rheumatol. 2008;35(5):855–61.
Kim H, Baek KH, Lee SY, Ahn SH, Lee SH, Koh JM, Rhee Y, Kim CH, Kim DY, Kang MI, et al. Association of circulating dipeptidyl-peptidase 4 levels with osteoporotic fracture in postmenopausal women. Osteoporos Int. 2017;28(3):1099–108.
Moon J, Lee SY, Choi JW, Lee AR, Yoo JH, Moon SJ, Park SH, Cho ML. Metformin ameliorates scleroderma via inhibiting Th17 cells and reducing mTOR-STAT3 signaling in skin fibroblasts. J Transl Med. 2021;19(1):192.
Kim EK, Min HK, Lee SY, Kim DS, Ryu JG, Na HS, Jung KA, Choi JW, Park SH, Cho ML. Metformin rescues rapamycin-induced mitochondrial dysfunction and attenuates rheumatoid arthritis with metabolic syndrome. Arthritis Res Ther. 2020;22(1):77.
Jang SG, Lee J, Hong SM, Kwok SK, Cho ML, Park SH. Metformin enhances the immunomodulatory potential of adipose-derived mesenchymal stem cells through STAT1 in an animal model of lupus. Rheumatology (Oxford). 2020;59(6):1426–38.
Kim JW, Kim SM, Park JS, Hwang SH, Choi J, Jung KA, Ryu JG, Lee SY, Kwok SK, Cho ML, et al. Metformin improves salivary gland inflammation and hypofunction in murine Sjogren's syndrome. Arthritis Res Ther. 2019;21(1):136.
Kim EK, Lee SH, Lee SY, Kim JK, Jhun JY, Na HS, Kim SY, Choi JY, Yang CW, Park SH, et al. Metformin ameliorates experimental-obesity-associated autoimmune arthritis by inducing FGF21 expression and brown adipocyte differentiation. Exp Mol Med. 2018;50(1):e432.
Kim EK, Lee SH, Jhun JY, Byun JK, Jeong JH, Lee SY, Kim JK, Choi JY, Cho ML. Metformin Prevents Fatty Liver and Improves Balance of White/Brown Adipose in an Obesity Mouse Model by Inducing FGF21. Mediators Inflamm. 2016;2016:5813030.
Lee SY, Lee SH, Yang EJ, Kim EK, Kim JK, Shin DY, Cho ML. Metformin Ameliorates Inflammatory Bowel Disease by Suppression of the STAT3 Signaling Pathway and Regulation of the between Th17/Treg Balance. PLoS ONE. 2015;10(9):e0135858.
Nath N, Khan M, Paintlia MK, Singh I, Hoda MN, Giri S. Metformin attenuated the autoimmune disease of the central nervous system in animal models of multiple sclerosis. J Immunol. 2009;182(12):8005–14.
Mai QG, Zhang ZM, Xu S, Lu M, Zhou RP, Zhao L, Jia CH, Wen ZH, Jin DD, Bai XC. Metformin stimulates osteoprotegerin and reduces RANKL expression in osteoblasts and ovariectomized rats. J Cell Biochem. 2011;112(10):2902–9.

Download PDF

Reviewers agreed at journal
27 Sep, 2023
Reviewers invited by journal
25 Sep, 2023
Editor invited by journal
08 Aug, 2023
Editor assigned by journal
03 Aug, 2023
First submitted to journal
01 Aug, 2023

You are reading this latest preprint version

Targeting osteoclast-derived DPP4 alleviates inflammation-mediated ectopic bone formation in ankylosing spondylitis.

Status:

Version 1

Abstract

Figures

Introduction

Materials and Methods

Sample collection and DPP4 measurement

Immunohistochemistry

Human CD14 isolation and osteoclasts differentiation

RNA extraction and mRNA analysis

Protein extraction and immunoblotting analysis

Immunofluorescence

Curdlan-injected SKG mice

Histological and microCT analysis

Statistics analysis

Results

DPP4 is highly expressed in human mature osteoclasts

Discussion

Declarations

References

Supplementary Files

Status:

Version 1