Plant materials and tissue culture conditions
Calluses of five P. ginseng accessions, one cultivar (‘Gumpoong’), three collections from local landraces (‘YP’, ‘GH’, and ‘JK’), and one wild collections (‘Kangwon’), were maintained and amplified in basal Murashige and Skoog medium (MS) supplemented with 1.0 mg/L 2,4-D (2,4-dichlorophenoxyacetic acid), 30 g/L sucrose, and 7 g/L plant agar at 23 ± 1°C in the dark. The medium was adjusted to pH 5.8 before adding agar, and then sterilized for 15 min in an autoclave at 121°C. After 30 days of subculture, calluses were used for transformation.
Agrobacterium strains and binary vector
A. rhizogenes strain R1000 was kindly provided by Prof. Sang Un Park, Department of Crop Science, Chungnam National University, Deajeon, South Korea. The binary vector pBI121 (Jefferson 1987), containing a CaMV 35S promoter-GUS gene fusion, and the NPT II gene as a selectable marker, was transferred into A. rhizogenes R1000 by electroporation. Transformed A. rhizogenes were cultured in LB medium containing 50 mg/L kanamycin at 28°C with shaking (220 rpm) to the mid-log phase (OD A600 = 0.5). Bacterial cells were collected by centrifugation at 3000 g for 10 min, and resuspended in half-strength MS (½ MS) liquid medium containing 30 g/L sucrose for inoculation.
Plant transformation
Subcultured calluses were excised by scalpel and directly used for co-cultivation with A. rhizogenes. Excised explants were dipped into the liquid inoculation medium containing the A. rhizogenes for 10 min, then dried on sterilized filter paper, and incubated in the dark at 23 ± 1°C on solid ½ MS medium. After 2 days of co-cultivation, explants were washed several times with sterilized water to remove A. rhizogenes on their surfaces, and dried on sterilized filter paper. Co-cultivated explants were transferred to hormone-free solid ½ MS medium containing 250 mg/L cefotaxime to eliminate residual bacteria, and incubated in the dark at 23 ± 1°C for 1 week. Explants were then transferred to hormone-free solid ½ MS medium containing 30 g/L sucrose, 250 mg/L cefotaxime, and 50 mg/L kanamycin to select transgenic hairy roots. Putative transgenic hairy roots were observed emerging from explant wound sites after 4 weeks of incubation. Subsequently, the induced putative transgenic hairy roots were isolated and transferred to 30 ml of hormone-free Schenk and Hildebrandt (SH) liquid medium containing 30 g/L sucrose, 250 mg/L cefotaxime, and 50 mg/L kanamycin, in a 100-mL flask on a rotary shaker (100 rpm) at 23 ± 1°C in the dark. Subculture was done every 30 days.
Histochemical GUS assay
The transgenic hairy roots which is induced by Ri plasmid transformation (hairy roots) and the adventitious roots which is induced in vitro without transformation (adventitious roots) were examined in staining solution (100 mM sodium phosphate, 1 mg/mL X-gluc, 0.1% Triton X-100, 10 mM EDTA, 2 mM potassium ferricyanide, and 2 mM potassium ferrocyanide) for histochemical GUS activity. Hairy roots were soaked in staining solution, and incubated overnight at 37°C. Stained roots were rinsed extensively in 70% ethanol to remove residual phenolic compounds, and observed using a microscope equipped with a camera.
Isolation of DNA and RNA, and cDNA synthesis
Total genomic DNA and RNA of hairy and adventitious roots were extracted using the DNeasy and RNeasy Plant Mini Kits (Qiagen, Hilden, Germany), respectively, according to the manufacturer’s protocol. cDNAs were synthesized from 5 µg of total RNA using the SMARTer cDNA Synthesis Kit (Clontech Laboratories, Inc.), following the manufacturer’s protocol.
Validation of transformants
Polymerase chain reaction (PCR) was used to confirm the presence of transgenes and introgressed rol genes. The oligonucleotide sequences used to amplify fragments of the GUS (GenBank accession number AF485783.1) and rol (GenBank accession number X03433.1) genes are provided in Table 1. PCR was conducted in a 25-µL reaction mixture containing 20 ng of DNA template, 5 pmol of each primer, 1.25 mM deoxynucleotide triphosphate (dNTP), 1.25 units of Taq DNA polymerase (Inclone, Korea), and 2.5 µL of 10× reaction buffer. PCR cycling parameters were 94°C (5 min); 35 cycles of 94°C (30 s), 54–58°C (30 s); 72°C (30–60 s), with a final extensions of 72°C (7 min). PCR products were visualized on agarose gels (1.0%) containing a safe gel stain.
Table 1
Primer information for PCR and RT-PCR analysis
Target gene | Direction | Sequence (5'◊3') | Melting temperature (ºC) |
RolB | F | GCTCTTGCAGTGCTAGATTT | 53.0 |
| R | GAAGGTGCAAGCTACCTCTC | 55.3 |
RolC | F | ATGGCTGAAGACGACCTGTGT | 58.7 |
| R | TTAGCCGATTGCAAACTTGCA | 55.8 |
GUS | F | ATGTTACGTCCTGTAGAAACCCC | 56.5 |
| R | TCATTGTTTGCCTCCCTGCTGC | 60.6 |
Actin7 | F | CTTGAGACCTCAAAGACTAGAC | 52.2 |
| R | TCTCGTGAATTCCTGCAGCT | 56.5 |
Gene expression analysis by RT-PCR
Expression of transgenes was analyzed by reverse transcriptase PCR (RT-PCR). Synthesized cDNA was diluted to 1/10 strength, and used as a template for PCR analysis. PCR conditions and primers for GUS, rol and Actin7 (GenBank accession number DC03005B05) genes were the same as those described for transformation validation, and in Table 1.
Production of liquid culture and bioreactor for biomass production
Transgenic hairy roots, selected in hormone-free SH liquid medium containing 30 g/L sucrose, 250 mg/L cefotaxime, and 50 mg/L kanamycin, were transferred to hormone-free SH liquid medium containing 50 g/L sucrose without cefotaxime and kanamycin for amplification. Subsequently, these hairy roots were used to compare growth rates. One gram (fresh weight) of hairy roots were inoculated into 30 mL of SH liquid medium containing 50 g/L sucrose with or without 3 mg/L IBA in a 100-mL flask with shaking (100 rpm) at 23 ± 1°C in the dark. Data were collected after 30 days of culture. Biomass production of transgenic hairy roots was performed in air-lift balloon-type bioreactors. To begin with, 12 g hairy roots (fresh weight) were inoculated into a 3-L air-lift balloon-type bioreactor containing 1 L of hormone-free SH liquid medium supplemented with 5% sucrose. The airflow rate was adjusted at 0.1 vvm (100 mL/min) during cultivation. The bioreactor was maintained in the dark at 23 ± 1°C. Hairy root biomass was harvested after 30 days of culture.
Sample preparation and quantification of ginsenosides
Pulverized, freeze-dried adventitious and hairy roots (25 mg each) were extracted by sonication with 1 mL of 70% methanol for 180 min at room temperature. The crude extract was centrifuged at 13,000 rpm for 5 min, then the supernatant was diluted with water (1:3) and filtered using a 0.2-µm RC-membrane filter (Minisart RC15, Sartorius Stedim Biotech, Gottingen, Germany). Reference standards for the ginsenosides Rf, Rb1, Rb2, Ro, Rh1, Rg2, Rg3, and F2 were purchased from Chengdu Biopurify Phytochemicals Co., Ltd. (Chengdu, China), and Rb3, Rc, Rd, and Re from Chromadex (Irvine, CA, USA). Ginsenoside standard Rg1 was kindly provided by The Korean Food and Drug Administration agency (KFDA). Stock solutions of the 13 ginsenoside reference standards were prepared in methanol and working solutions were prepared to a series of known concentrations. Solutions were filtered through a 0.2-µm RC-membrane filter before quantitative analysis. All solutions were stored at 4°C until required for analysis.
Ginsenoside quantification using LC–MS
Ginsenoside content was quantified using an Agilent 6460 Triple Quadrupole liquid chromatography–mass spectrometry (LC–MS) system coupled with an Agilent 1290 Infinity II LC system (Agilent Technologies, Palo Alto, CA, USA). Chromatographic separation was obtained using an ACQUITY UPLC BEH C18 column (100 mm × 2.1 mm, 1.7 µm; Waters Co., Milford, MA, USA) operated at 40°C. The mobile phase, which comprised water (A) and acetonitrile (B), both of which were added with 0.1% formic acid, was delivered at a flow rate of 0.3 mL/min with the following gradient program: 0–9 min, 20% (B); 9–14 min, 20–30% (B); 14–17 min, 30% (B); 17–21 min, 30–32% (B); 21–26 min, 32–42.5% (B); 26–29 min, 42.5–90%; 29–31 min, 90% (B); 31–32 min, 90–20%; 32–35 min, 20% (B). The sample injection volume was set to 2.0 µL. The triple quadrupole MS system was equipped with an electrospray ionization (ESI) interface, and operated in the negative ion mode. Parameters for MS were set as follows: capillary voltage 3.5 kV, Vcharge 2.0 kV, drying and sheath gas temperature 320°C, drying gas flow 10 L/min, sheath gas flow 11 L/min, and nebulizer pressure 50 psi.
Statistical analysis
All statistical analysis was conducted using R (version 4.2.0). Data were analyzed by one-way analysis of variance (ANOVA), and significant differences between values were calculated using Tukey’s multiple comparison test. P-values ≤ 0.05 were considered statistically significant.