Yeast strain development and cultivation
Saccharomyces cerevisiae BY4741-derivative strain GabY36 (MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 XI-3: CamPr-GFP XII-5: TDH3-Cam-TA) was transformed with plasmid GabP54 [pCfB2904 (XI-3 MarkerFree), with the CamP driving expression of GFP] was transformed to contain a GFP expression cassette[31]. pCfB2904(XI-3 MarkerFree) was a gift from Irina Borodina (Addgene plasmid # 73276; http://n2t.net/addgene:73276 ; RRID:Addgene_73276)
General yeast manipulation, media, and transformation were performed by standard methods (Amberg, 2000). For CRISPR mediated construction, protocol was followed as described previously[32].Yeast was maintained in YPD +20% glucose (yeast extract (10 g L−1), peptone (20 g L−1) and glucose (20 g L−1); agar (20 g L−1) was used for plates.
Mesocosm experimental design and sampling procedure
Sorghum bicolor BTx623 seeds (shared by Scott Sattler USDA-29,30) were started in seedling trays containing ~25 ml packed commercial potting soil Soil Sunshine Mix #4 (Sungro, Agawam, MA) and cultivated in a Percival Growth Chamber E-41VL (Percival Scientific, Perry IA) at 25°C, under diurnal light conditions for 1 month at which point the seedlings reached five leaf coleoptile developmental stage.
Mesocosm experiments were conducted in 3D-printed pots (S. Fig. 1) that have 18 sampling ports which are sealed with neoprene stoppers (Eisco Labs, Victor, NY). A perforated base allows for root development. Plants self-water via wicking from a reservoir (Nalgene, Rochester, NY). To facilitate self-watering prior to root establishment each pot has a length of capillary wick chord from the pot to the reservoir (ORIMERC, USA).
Soil Sunshine Mix #4 was thoroughly mixed for homogenization and moistened with DI water, each pot was firmly packed with damp soil, and sorghum seedlings were transplanted to mesocosm pots and allowed to settle for 72 hours under the above growth conditions to stabilize the microbial community.
72 hours post-transplant, baseline samples were harvested from one set of ports on each plant. Briefly, a 3 ml syringe (BD Biosciences, Franklin Lakes, NJ) was modified by cleaving the top off and was then used to extract a horizontal soil core from each port. Soil samples were ~ 250 mg and either went directly into the lysis buffer for gDNA extraction (as described below) or were resuspended in 800 ml DI water and vortexed to be observed microscopically.
Immediately following the collection of baseline samples, mesocosms were inoculated with one of the following treatments, each was performed in triplicate: 1) 200 ml of DI water 2) 200 ml of YPD Yeast -Extract-Peptone-Dextrose (YPD) + 2% Glucose 3) 200mL of 0.1 OD BY4171 resuspended in fresh Yeast -Extract-Peptone-Dextrose (YPD) + 2% Glucose.
Microscopy
Soil aliquots were imaged at 40x on a EVOS M5000 (Thermo Fisher Scientific, USA) with trans light and through a GFP filter cube. Slides were scanned and imaged at a minimum of 3 fields of view. Representative images were chosen for each timepoint.
Plant Observations
All plants were started from seed and experiments were initiated when seedlings reached coleoptile stage (~30 days from starting seeds). Soil was removed from roots for endpoint analysis and plant matter was air-dried at 25°C and weighed to determine final dry weight.
Biological composition and diversity and physicochemical characterization of soils
An aliquot of the soil slurry used for the initial setup of the mesocosms and 250 grams of final soil from representative treatment groups were collected and analyzed by Ward Laboratories Inc (Kearney, NB). Community composition was assessed by Phospholipid Fatty Acid (PFLA) analysis. Employing Ward Laboratories standard protocols fresh soil is freeze dried, weighed into flasks, and combined with a 1:2:0.8 (vol:vol:vol) mixture of extracting solvents. The samples shake, then are centrifuged to allow for the separation of the organic fraction. The organic fraction is removed and now contains the fatty acids from the soils. Fatty acids can either be methylated to represent TSFAME or separated into neutral, glycolipids, and phospholipid fatty acids (PLFA) by solid phase extraction (SPE). Following SPE the desired fraction is then methylated. Samples are analyzed on a GC using Agilent’s ChemStation and MIDI’s Sherlock software systems. Soil respiration was assessed as follows; soils are dried and ground by standard laboratory procedures. A plastic beaker with holes drilled in the bottom and a piece of filter paper lining it is used to contain a 40 g (± 0.5 g) sample. The beaker is placed in a half pint mason jar and 20 mL of Deionized Water is added to the bottom of the jar. The jar is sealed and incubated at 24° C for 24 hours (± 1 hour). After incubation, the SR-1 instrument is used to measure the CO2 produced.” Physical and chemical traits of the soil were assessed by Haney Soil Health testing. “Haney Analysis Soils that have been dried and ground by standard laboratory procedures are scooped into appropriate containers in duplicate. One sub sample is extracted with H3A and the other with H2O. The H3A extract is analyzed for NO3, NH4, and PO4 on a Flow Injection Analyzer (FIA) and P, K, Ca, Mg, Na, Zn, Fe, Mn, Cu, S and Al are run on a Thermo ICAP. The H2O extract is also analyzed for PO4 on Flow Injection Analyzer but is also analyzed for Total Organic Carbon (TOC) and Total Nitrogen (TN) using a Teledyne-Tekmar Torch.
DNA Extraction and Sequencing
Total genomic DNA (gDNA) was extracted from soil samples collected from the top port at each timepoint using the DNeasy PowerSoil Kit (Qiagen, Germantown, MD). Modifications to the standard protocol included a 10-min incubation at 65 °C immediately following the addition of the lysis buffer, cell disruption and homogenization was done with a Digital Cell Disruptor Genie (Scientific Industries, Bohemia, NY) at 3000 RPM for 10 min. Extracted gDNA was normalized to 20ng/ul and sent to Genewiz (Azenta Lifesciences, USA) for targeted sequencing of the 16S and ITS hypervariable regions as follows. Next generation sequencing library preparations, Illumina MiSeq sequencing, and data analysis were conducted at AZENTA, Inc. (South Plainfield, NJ, USA). Employing AZENTAs standard protocol for 16S/ITS-EZ sequencing, the sequencing library was constructed using an ITS-2 Library Preparation kit (AZENTA, Inc., South Plainfield, NJ, USA). Briefly, 50 ng DNA was used to generate amplicons that cover ITS-2 hypervariable region of fungal ribosomal internal transcribed spacer (ITS) region. Indexed adapters were added to the ends of the ITS-2 amplicons by limited cycle PCR. Sequencing libraries were validated using an Agilent 4200 TapeStation (Agilent Technologies, Palo Alto, CA, USA), and quantified by Qubit 2.0 Fluorometer (Invitrogen, Carlsbad, CA) as well as by quantitative PCR (KAPA Biosystems, Wilmington, MA, USA). DNA libraries were multiplexed and loaded on an Illumina MiSeq instrument according to manufacturer’s instructions (Illumina, San Diego, CA, USA). Sequencing was performed using a 2x250 paired end (PE) configuration, image analysis and base calling were conducted by the MiSeq Control Software (MCS) on the MiSeq instrument.” “16S-EZ rDNA next generation sequencing library preparations and Illumina sequencing were conducted at Azenta Life Sciences (South Plainfield, NJ, USA). Sequencing library was prepared using a MetaVxTM 16s rDNA Library Preparation kit (Azenta Life Sciences, South Plainfield, NJ, USA). Briefly, the DNA was used to generate amplicons that cover V3 and V4 hypervariable regions of bacteria and archaea 16S rDNA. Indexed adapters were added to the ends of the 16S rDNA amplicons by limited cycle PCR. DNA libraries were validated and quantified before loading. The pooled DNA libraries were loaded on an Illumina MiSeq instrument according to manufacturer’s instructions (Illumina, San Diego, CA, USA). The samples were sequenced using a 2x 250 paired-end (PE) configuration. Image analysis and base calling were conducted by the Illumina Control Software on the Illumina instrument.”
Community profiling of the microbiome
Bioinformatics on the soil microbiome were performed in QIIME 2 version 2022.2[33]. Single-end FASTQ files were demultiplexed and quality filtered using the q2-demux plugin and denoising was performed with DADA2[34]. Amplicon sequence variants (ASVs) were aligned with MAFFT [35]and phylogeny was constructed using fasstree2 [36]. Faith’s Phylogenetic Diversity metric was used to estimate alpha-diversity [37]. Beta-diversity was assessed by Unweighted and Weighted UniFrac [38, 39]and Bray-Curtis dissimilarity; Principal Coordinate Analysis (PCoA) were estimated using q2-diversity after samples were rarefied to 4000 (16S) and 2300 (ITS) sequences per sample. The q2-feature-classifier, classify-sklearn naive Bayes classifier trained on the Greengenes2 taxonomic database[40] was used to assign taxonomy to ASVs [41] from the bacterial sequences and for fungal sequences we used the UNITE database (V8 Dynamic 10.05.2021 97, 99) [42, 43]. Statistical analyses of alpha-diversity were assessed with pairwise Kruskal-Wallis test, significance of is beta-diversity was assessed with pairwise comparisons using PERMANOVA. To evaluate the individual impacts of variables we employed the ADONIS regression model framework. Changes in relative abundances of microbial classes were evaluated with a Two-War ANOVA, using an interaction term and Geisser-Greenhouse correction.
Digital Droplet PCR
ddPCR was performed as previously described[44]using the BioRad QX200 with AutoDG system (Bio-Rad, Hercules CA) to monitor the persistence and fate of yeast in soils. A custom HEX fluorophore probe (Bio-Rad) targeting the SPA2 gene of S. cerevisiae[45] was used on gDNA extracted from total soil Fwd: AGAAAACCTTCAGGAACGGG Internal Oligo (HEX): CGCCCATAAAGGCAGTAACATCGGC Rev: TTTGGCTTGTGGAGGTAGTG. gDNA templates were normalized to 500 pg/rxn and final 20 ul reactions consisted of 2x ddPCR Supermix for Probes (no dUTP) (Bio-Rad), 20x target primer/probes, and DNAse free water. Droplets were produced by AutoDG (BioRad). The sample plate was heat-sealed on a PX1 PCR plate Sealer (BioRad) and thermocycling was performed on a C1000 Touch with a Deep Well Reaction Module (BioRad) using the following conditions: 95°C, 10 min; 94°C 30 sec; 59.4°C, 1:00 min, Ramp 2°C/s, repeat 39x; 98°C, 10 min; 12°C infinite hold. Final droplets were read by the QX2000 Digital PCR Reader (BioRad) and data was analyzed with QuantaSoft analysis package (BioRad) and graphed with GraphPad Software (Dotmatics, San Diego, CA).