5.1 Clinical samples
Fifty pairs of CRC and corresponding adjacent normal tissues were obtained from the Second Affiliated Hospital of Nanjing Medical University. All patients were not subjected to other treatments before the surgery. All tumor tissues and adjacent normal tissues were determined by pathological examination. Our research was approved by the Ethics Committee of the Second Affiliated Hospital of Nanjing Medical University ([2019]-KY-121).
5.2 Cell culture
CRC cell lines (LOVO, HCT116, SW480, DLD1, W620, and HT-29) and the human normal colon epithelial cell line (FHC cell line) were purchased from the Cell Bank of the Chinese Academy of Sciences. Cells were incubated in F12K, RPMI 1640, or DMEM medium (Gibco, Grand Island, NY, USA) with 10% fetal bovine serum (FBS) (Gibco, Grand Island, NY, USA) and 1% penicillin/streptomycin (Gibco, Grand Island, NY, USA). All cells were cultured in a humid environment with 5% CO2 at 37° C.
5.3 Cell transfection
SiRNAs were synthesized by Proteinbio (Nanjing, China). The shRNA was selected for the xenograft tumor assay due to its stable transfection ability. The overexpression plasmid pcDNA3.1-USP2-AS1 was designed by GenePharma (Shanghai, China). Mimics and inhibitors of miR-134-5p were purchased from RiboBio (Guangzhou, China). Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) was applied to transfecting.
5.4 RNA extraction and qRT-PCR
Total RNA was extracted using the Trizol reagent (Invitrogen, Carlsbad, CA, USA). The qRT-PCR was applied to examine relative gene expression on LightCycler 480 system with SYBR Green Master (Vazyme, Nanjing, China). U6 (for miR-134-5p) and GAPDH (for USP2-AS1, PHLDA2, and IGF2BP2) were the internal reference genes. The 2
-ΔΔCt method was applied to process data. The primer sequences are listed in Table
2.
Table 2
The primer sequences used in this study.
Gene
|
Forward-(5'−3')
|
Reverse-(5'−3')
|
GAPDH
|
GAAGGTGAAGGTCGGAGTC
|
GAAGATGGTGATGGGATTTC
|
U6
|
CTCGCTTCGGCAGCACA
|
AACGCTTCACGAATTTGCGT
|
USP2-AS1
|
gtggactggaatgtcacacg
|
acagtcttgaatcgctgacg
|
PHLDA2
|
ctcggcacgacatgaaatc
|
cttgaggatggagtggaagc
|
miR−134−5p
|
CGCGTGTGACTGGTTGACCA
|
AGTGCAGGGTCCGAGGTATT
|
IGF2BP2
|
ctacgccttcgtggactacc
|
catccaacacctcccactg
|
5.5 Western blot assay
RIPA lysis buffer (Beyotime, Shanghai, China) was applied to extract protein. The protein was electrophoresed through 10% or 15% SDS-PAGE gels to PVDF membranes (Millipore, Billerica, MA, USA). Subsequently, the membranes were blocked with 5% milk for 1 hour, followed by incubation with primary antibodies at 4°C overnight. Then, membranes were immersed into the corresponding secondary antibodies at room temperature for 2 hours. The specific bands were visualized using the ECL reagents (Vazyme, Nanjing, China). The antibodies are as follows: anti-IGF2BP2 (11601-1-AP, Proteintech), anti-PHLDA2 (14661-1-AP, Proteintech), anti-GAPDH (10494-1-AP, Proteintech), anti-β-actin (66009-1-Ig, Proteintech).
5.6 CCK-8 assay
After 24 hours of transfection, the CRC cells were inoculated into the 96-well plates (2 × 103 cells/well). Every 24 hours, we used CCK-8 reagent (Vazyme, Nanjing, China) to examine the absorbance set at 450 nm of cells.
5.7 Colony formation assay
After 24 hours of transfection, the CRC cells were inoculated into the 6-well plates (500–1000 cells/well). 14 days later, after being washed with PBS, cells were stained with 0.1% crystal violet for 20 minutes.
5.8 EdU assay
The CRC cells were incubated with 10 mM EdU (Beyotime, Shanghai, China) solution for 2 hours, fixed with 4% neutral paraformaldehyde for 15 minutes, permeabilized with 0.3% Triton X-100 for 10 minutes, stained with EdU reaction buffer for 30 minutes, and stained with Hoechst 33342 solution for 10 minutes in the 96-well plates. Last, the cells were examined with fluorescence microscopy.
5.9 Cell migration assay
6–8 × 104 CRC cells were cultured in the upper chamber with 300 µL serum-free medium, and 700 µL medium with 20% FBS was placed in the lower chamber. 48–72 hours later, the cells were stained with 0.1% crystal violet for 20 minutes and examined under a microscope.
5.10 Cell apoptosis assay
The cell apoptosis was examined using Annexin V-FITC/PI Apoptosis Detection Kit (Vazyme, Nanjing, China). 5 × 105 CRC cells were resuspended in 500 µL Binding Buffer containing 5 µL Annexin V-FITC and 5 µL PI Staining Solution and incubated for 10 minutes. Flow cytometry was applied to examine the apoptotic cells.
5.11 Mouse xenograft model
4–6 weeks old BALB/c nude mice were maintained under pathogen-free conditions. In each nude mouse, 1 × 106 pretreated cells were injected subcutaneously. The tumor size was detected every four days using the formula: volume = 1/2 × length × width2. 22 days later, the nude mice were euthanized, and their tumors were isolated and weighed.
5.12 Subcellular fractionation location
The NE-PER Nuclear and Cytoplasmic Extraction Kit (Thermo, Waltham, MA, USA) was used to isolate the nucleus and cytoplasm from the CRC cells. The CRC cells were treated with cell fraction buffer and disruption buffer to obtain cell cytoplasm or nucleus. The cytosolic and nuclear RNA level of GAPDH and U6 was detected by qRT-PCR.
5.13 Dual-luciferase reporter assay
The HEK293 cells were placed in the 96-well plates (2 × 104 cells/well) and co-transfected with miR-134-5p mimics and WT-USP2-AS1/MUT-USP2-AS1 or WT-PHLDA2/MUT-PHLDA2. 48 hours later, the luciferase activity was detected by a dual-luciferase reporter assay system.
5.14 RNA stability assay
Actinomycin D was purchased from Abmole company and used to treat CRC cells. Then cells were collected at 0, 4, 8, 12 hours. Total RNA extraction and qRT-PCR were conducted as previously described.
5.15 RIP assay
The RIP experiments were conducted with the Magna RIP Kit (Millipore, Billerica, MA, USA). The treated CRC cells were lysed with RIP lysis buffer on ice and incubated with magnetic beads ligated with anti-IGF2BP2 and anti-IgG (30000-0-AP, Proteintech) at 4°C overnight. The elution buffer was applied to separate the precipitated RNAs. Finally, RNAs obtained were examined by qRT-PCR.
5.16 Statistical analysis
All data processing was conducted with GraphPad Prism 8.0. Student's t-test was conducted to evaluate the difference between the two groups. Chi-Square test was conducted to process clinicopathological data. P < 0.05 was considered to be significant. Data were expressed as the mean ± standard deviation (SD).