2.1 Cell culture
Four EC cell lines, namely ECa-109, TE-1, TE-10, and TE-11, as well as a human esophageal epithelial cell line HET-1A, were utilized in this study. The ECa-109 cells were purchased from CCTCC (Wuhan, China), while TE-1, TE-10, and TE-11 cells were obtained from the Center for Excellence in Molecular Cell Science (Shanghai, China). HET-1A cells were purchased from ATCC (Manassas, VA, USA). All cells were cultured in RPMI-1640 supplemented with 10% FBS and incubated at 37°C with 5% CO2.
2.2 RT-qPCR
To extract total RNA from the EC cells, the TRIzol reagent (Invitrogen, Carlsbad, CA, USA) was used. The extracted RNA was then reverse transcribed into cDNA using the Transcriptor First Strand cDNA Synthesis kit (Takara, Japan). For quantitative PCR, the SYBR Green II (Takara) was utilized with an ABI PRISM 7900 Sequence Detector system (Applied Biosystems, USA). GAPDH was used as the endogenous control to normalize the gene expression, which was calculated using the 2 − ΔΔCt method. The primers sequences are as follow. GAPDH, Forward: TCG ACA GTC AGC CGC ATC TTC TTT. Reverse: ACC AAA TCG GTT GAC TCC GAC CTT. E-Cadherin, Forward: AAG AAG CTG GCT GAC ATG TAC GGA. Reverse: CCA CCA GCA ACG TGA TTT CTG CAT. Vimentin, Forward: AGA ACC TGC AGG AGG CAG AAG AAT. Reverse: TTC CAT TTC ACG CAT CTG GCG TT. N-Cadherin, Forward: TGT GGG AAT CCG ACG AAT GGA TGA. Reverse: TGG AGC CAC TGC CTT CAT AGT CAA. Snail, Forward: TTT CTG GTT CTG TGT CCT CTG CCT. Reverse: TGA GTC TGT CAG CCT TTG TCC TGT.
2.3 Western blot
To prepare the cell lysates, RIPA buffer (Thermo Fisher Scientific, USA) with protease inhibitors was used. The proteins were separated by 10% SDS-PAGE and transferred to PVDF membranes. To block the membranes, 5% skim milk was applied, and they were then incubated with primary antibodies overnight at 4°C. After washing with TBST, the membranes were incubated with the secondary antibody for an additional 2 hours. The protein bands were detected using the ECL substrate (Advansta, Menlo Park, CA, USA) and analyzed using ImageJ (NIH). The primary antibodies used in this study are (GAPDH Santa Cruz, sc-365062, 1:100), E-Cadherin ( Santa Cruz #674A, 1 :50), N-Cadherin (Cell signaling technology Catalogue #4061, 1:1000), Snail (Cell signaling technology#3879 1:500), FBXO32 (#PA5-91959 1:20) and CDK9 (Cell Signaling technology #2316). Secondary antibodies were from cell signaling technology Anti mouse, #33416 and anti-rabbit, #5127)
2.4 Cell transfection
To elucidate the functional significance of DNMT1 and FBXO32 in EC cells, we employed transfection techniques to manipulate their expression levels. For knockdown experiments, we utilized specific shRNA molecules designed to target DNMT1 (sh-DNMT1; Genechem, Shanghai, China) or FBXO32 (Santa Cruz, sc-96506), along with corresponding negative control shRNA (sh-NC). The transfections were carried out using Lipofectamine 3000 (Invitrogen), a widely adopted transfection reagent known for its high efficiency in delivering nucleic acids into cells. Target sequences of DNMT1 shRNA was shDNMT1 : 5′GGAAATACTCCGACTACATCA3′; FBXO32 was 5′GATCCGGAGCAGGAATCTTACATTTTCAAGAGAAATGTAAGATTCCCTGCTCTTTTTTGGAAA3′ and shRNA was 5′UUCUCCGAACGUGUCACGUAA3′.
2.5 CCK-8 assay
A 96-well plate was used to seed cells at a density of 2 × 103 cells per well. Subsequently, 10 µl of CCK-8 solution (Dojindo, Japan) was added at 0, 24, 48, and 72 hours. After incubating for 2 hours, the optical density (OD) value at 450 nm was measured using a microplate reader (Molecular Devices, USA).
2.6 Colony formation assay
Cells were cultured in a 6-well plate for 14 days. Following this, the cells were washed with PBS and fixed with 4% formaldehyde before staining with crystal violet. The number of colonies was then determined.
2.7 Transwell assay
For the Transwell assay, 24-well Transwell plates with 8.0-µm-pores (Corning Costar, USA) were used. EC cells suspended in serum-free medium were added to the upper chamber, which was coated with Matrigel (BD Biosciences) for the invasion assay. The lower chamber was filled with culture medium containing 10% FBS. After 24 hours, the cells in the lower chamber were stained with 0.1% crystal violet and observed using a microscope (Olympus, Japan).
2.8 Animal experiments
BALB/c nude mice (6–8 weeks old, weighing 22–25 g) were procured from the Qinhuai Medical District at the General Hospital of Eastern Theater Command. The experimental procedures were approved by the Ethics Committee of the hospital (#GH-5567HDE). ECa-109 cells stably expressing pcDNA3.1-FBXO32 or pcDNA3.1-NC were subcutaneously injected into the left dorsal flanks of the mice. Tumor volume was monitored starting from the fifth day and every five days until the 25th day. On the 25th day, the mice were sacrificed, and the tumors were extracted. To assess lung metastasis, BALB/c-nude mice were injected with 100 µL of EC109 cells (5 × 106/mL) via the tail vein. After 45 days, the mice were euthanized, and their lung tissues were collected. The Xenogen imaging system (Perkin Elmer, USA) was used for analysis.
2.9 H& E staining
The fixed tissues were processed by embedding them in paraffin and sectioning them into 4 µm-thick slices. These sections were passed through a series of xylene, alcohol and subsequently stained with Hematoxylin and Eosin. Finally, the slides were dehydrated using alcohol, cleared, and sealed with mounting media. The sections were observed using an Olympus microscope.
2.10 Immunohistochemistry (IHC)
The tissue sections were deparaffinized with xylene and a graded ethanol series. Subsequently, the sections were incubated with antibodies against Ki67 or PCNA (Abcam, USA) overnight at 4°C, followed by incubation with IgG secondary antibodies (Abcam) for 2 h. After washing with PBS, sections were treated with streptavidin-peroxidase for 30 minutes and then incubated with DAB substrate. The sections were counterstained with hematoxylin, dehydrated, cleared, and mounted with neutral gum. Finally, the microscope was used for observation.
2.11 Methylation specific PCR (MSP)
The primers used to assess methylation of the CpG islands were designed to amplify bisulfite-converted DNA from the FBXO32 promoter region. A quantity of 2 µg of bisulfite-treated DNA from cells was subjected to qPCR to determine the methylation status. The sequencing analysis was carried out at GeneTech (Shanghai) co., Ltd. To induce demethylation, cells were treated with 3 µM of 5-aza-2-deoxycytidine for 72 hours.
2.12 Coimmunoprecipitation (Co-IP)
Cells were lysed using Co-IP buffer mixed with protease inhibitor from Roche, Switzerland. The lysates were incubated overnight at 4°C with gentle rotation, with either anti-FBXO32 or anti-CDK9 antibody obtained from Abcam. The antigen-antibody complexes were retrieved using protein A beads from Cell Signaling Technology, USA, and then washed with PBS. The complexes were eluted with Laemmli buffer and analyzed by western blotting.
2.13 GST-pulldown assay
The purified recombinant proteins were mixed with glutathione sepharose 4B and incubated in pulldown buffer (20 mM Tris-Cl, 5 mM MgCl2, 100 mM NaCl, 1 mM DTT, 1 mM EDTA, 0.5% NP-40, and 10 µg/ml BSA pH 7.5). The beads were then washed with pulldown buffer and denatured in SDS-PAGE loading buffer. The protein complexes were analyzed by western blotting.
2.14 Ubiquitination and cycloheximide (CHX) assay
The cells were transfected with ubiquitin and relevant plasmids for 48 hours. After being treated with RIPA buffer, the lysates were subjected to immunoprecipitation using antibodies (Abcam) on protein A/G beads at 4°C overnight, followed by boiling in SDS buffer. The proteins were then analyzed using western blotting.
To measure CHX-chase, cells were treated with 10 µg/mL CHX and incubated for 0, 2, 4, 6, or 8 hours. The lysates were then analyzed by western blotting with anti-CDK9 (Abcam).
2.15 ChIP assay
The cells were treated with 1% formaldehyde to cross-link the chromatin. Subsequently, lysis buffer was added to the cells and sonication was performed to fragment the chromatin into DNA fragments ranging from 150 to 900 bp. Anti-DNMT1 or anti-IgG (Abcam) was then added to the sonicated mixtures. The precipitated complexes were washed, and the cross-linking was reversed. The DNA was purified and extracted, followed by qPCR amplification.
2.16 Statistical analysis
The data presented are the means ± standard deviation (SD) of three independent experiments. Statistical analysis was performed using GraphPad Prism 8 software, and the data were analyzed by either Student's t-test or one-way ANOVA as appropriate. A p-value of less than 0.05 was considered statistically significant.