Animals: 18 months C57BL/6J mice were purchased from the Experimental Animal Center of Wenzhou Medical University. Six mice were housed per cage in a temperature-controlled holding room (22 ± 1°C) on a 12-hour light/dark cycle and fed ad libitum food and water. Experimental protocols were approved by the Institutional Animal Care and Use Committee of Wenzhou Medical University and met the guidelines of the National Institutes of Health Guide for the Care and Use of Laboratory Animals. All the mice were randomly divided into five major groups: 1) control naive mice, in which the mice do not undergo anesthesia and surgery; 2) anesthesia mice, in which mice were only anesthetized with 1% pentobarbital solution in the surgery-treated day(7 mL/kg, i.p.); 3) mice with anesthesia plus splenectomy; 4) mice treated with ACY-1215(a specific inhibit HDAC6) after navigational training and subjected to splenectomy in day 6; (5) mice treated with the vehicle (5% DMSO) to exclude the vehicle's influence and subjected to splenectomy in day 6. Each major group contains three subgroups(n=6/subgroup). The mice were sacrificed on days 1, 3, and 7 after the intervention. Based on the alternative use of the surgical group, the subgroup number of the surgical group was adjusted from 6 to 10, the subgroup number of the Vehicle and Ricolinostat group were adjusted from 6 to 8.
Experimenter:The operators will be trained after the experimental animals were randomly labeled. The surgical operators were not allowed to investigate the groups of mice and the drug injection operation will be performed by Dr. Liu respectively.
Surgery: Since the inhalation anesthetics, especially isoflurane, potentially caused cognitive dysfunction, we used the pentobarbital instead. After the surgical area was shaved and sanitized by 75% ethanol, a length of 1.0 cm vertical incision below the lower left rib was made. The muscle and fascia were bluntly separated to expose the spleen. Two main vessels were ligated before the spleen was removed. After the operation, the peritoneum and skin were closed with sutures. Lincomycin-lidocaine gel was used to prevent pain after the surgery. The surgical procedure took approximately 25 minutes. The mice were then placed on a heated pad and recovered from anesthesia. For the anesthesia group, mice were anesthetized only.
Drug injection: ACY-1215, a selective inhibitor of HDAC6, can be detected in the brain tissue 1 hour after oral administration and 4 hours after the intraperitoneal injection [16][17]. The drug was dissolved in 5%DMSO. Based on our pilot work, ACY-1215 at the dose of 3 mg/kg was injected intraperitoneally. A Morris Water Maze (MWM) test was performed on the mice one day after the injection.
Morris Water Maze (MWM) Test: The MWM test is used to evaluate spatial learning and memory function through a computerized video tracking system. Briefly, an invisible round platform (10 cm in diameter) was placed 1 cm below the water surface in the center of a circular pool's target quadrant (SW quadrant). The mice were released into the water facing the tank wall in one of the four quadrants. Mice were trained on five consecutive days with four tests per day (up to 60 seconds per test). The mice had 60 seconds to search the platform. Otherwise, they were gently guided to the platform and stayed at the platform for 15 seconds. On days 1, 3, and 7 after operating, the mice were subjected to a probe test where they were released into the water in the quadrant opposite the target quadrant. The time to locate the platform (latency), the percentage of time spent in the target quadrant, and the number of level crossings were recorded.
Cytokine Analysis (ELISA): The blood from all mice was collected through extirpating eyeballs. After the blood was centrifuged, the supernatants were collected. Levels of corticosterone (CORT), adrenocorticotropic hormone (ACTH), and aldactone (ALD) were determined by using commercially ELISA kits (Xi Tang Biotechnology Co., Ltd., Shanghai, China). The procedures were performed according to the manufacturer's instructions. The concentrations of ALD and ACTH were presented as ng/l and the concentration of CORT as ng/ml.
Western blot: Samples were homogenized in radioimmunoprecipitation assay (RIPA) lysis buffer containing phosphatase and protease inhibitors. Protein concentrations were detected by using the BCA Protein Assay Kit (Thermo Fisher, USA). Equal amounts of the samples (20 μg/lane) were separated by SDS-PAGE gels and subsequently transferred to polyvinylidene fluoride membranes (Bio-Rad, USA). The membrane was blocked in 5% skim milk for 1 hour at room temperature and then incubated with primary antibody overnight at 4°C. The antibodies used include rabbit anti-HDAC6 antibody (1:1000, #7612S, Cell Signaling Technology), mouse anti-GR antibody (1:400, sc-393232, Santa Cruz), rabbit anti-HSP90 antibody (1:400, sc-13119, Santa Cruz), rabbit anti-Phospho-Glucocorticoid Receptor antibody (1:1000, #97285, Cell Signaling Technology), rabbit anti-TATA-box-binding protein (TBP) antibody (1:200, A00302, Boster) and mouse anti-beta-actin antibody (1:3000, TA-09, ZSGB-Bio). After the membrane was incubated with horseradish peroxidase (HRP)-conjugated goat anti-rabbit or goat anti-mouse secondary antibodies (1:3000, Proteintech) for 1.5 hours at room temperature, the bands were visualized by using enhanced chemiluminescence (ECL) detection reagents (Affinity) and exposed to an imaging film. The mean intensities of the bands were calculated by using Quantity One software after they were normalized to the corresponding beta-actin.
Immunofluorescence staining: After mice were perfused with 4% paraformaldehyde in PBS, the brains were collected and dehydrated in 30% sucrose in PBS overnight at 4°C. Coronal brain sections at 5 μm thickness were serially cut on a Leica cryostat. The sections were washed three times (lasting for 10 minutes each time) and then permeabilized with the use of PBST (containing 0.2% Triton X-100 in PBS) for 40 minutes. The sections were then incubated with the blocking solution (10% bovine serum albumin in PBS) for 2 hours. For double-labeling immunofluorescence, the sections were incubated with a mixture of mouse anti-GR antibody (1:100, sc-393232, Santa Cruz) plus rabbit anti-GFAP antibody (1:100, AF6166, Affinity), rabbit anti-Iba-1 antibody (1:100, 10904-1-AP, Proteintech), or rabbit anti-NeuN antibody (1:200, ab177487, Abcam) respectively, for 24 hours at 4℃. On the second day, the sections were washed with PBS 3 times and then incubated with a mixture of Alexa Fluor 594 and 488 conjugated secondary antibodies for 1.5 hours at 37 °C followed by counterstaining with DAPI (Invitrogen). Finally, these brain sections were mounted on slides. Fluorescent images were captured by a scanning confocal microscope (MZ10F, Leica).
Co-immunoprecipitation: Immunoprecipitation is performed to examine the status of acetylated HSP90 and its binding function to the client protein glucocorticoid receptor in hippocampus tissue. The tissues collected from mice were immediately homogenized in Cell lysis buffer for Western and IP (P0013, Beyotime, China), together with protease inhibitor mixture. A total of 1 μg mouse monoclonal anti-HSP90 (sc-13119, Santa Cruz Biotechnology) or mouse IgG (A7028, Beyotime, China) was added into 400 μg of hippocampi lysates with gentle rotation for 1.5 h at 4 °C. The samples were incubated at 4 °C overnight with gentle rotation after adding 20 L of Protein A/G Plus beads (Santa Cruz Biotechnology, SC-2003). The pellets were washed with PBS four times after being centrifuged at 2500 rpm for five minutes. Finally, the samples were resolved on SDS-PAGE and analyzed with Western blot analysis as described above by using the anti-acetyl-lysine antibody (1:500; sc-32268; Santa Cruz Biotechnology Inc.) or anti-GR antibody (1:200; sc-393232; Santa Cruz Biotechnology Inc.).
Quantitative real-time polymerase chain reaction (RT-qPCR): Total RNA was extracted from the hippocampus by using Trizol reagent (Aidlab, China) according to the protocol of the manufacturer. After the concentrations of RNA samples were measured by using a spectrophotometer (Thermo Fisher), RNA was reversely transcripted into cDNA. Quantitative real-time PCR was performed on the real-time detection system (Illumina, USA) by using the SYBR Green Master Mix (TAKARA, China). The PCR reaction was carried out with an initial 30-second denaturation step at 95°C, followed by 40 cycles at 95°C for 5 seconds and 60°C for 30 seconds (Bio-Rad Laboratories, CA, USA), melting curves were checked in the final. The sequences of the specific primers for RT-qPCR were designed based on the previously reported sequence of mouse genes (FKBP51, GR alpha, GR beta, and RPS16) by biotechnology company (Qingke, China) and shown in Table 1. The housekeeping gene RPS16 was used as an internal control. Relative changes in gene expression were calculated by the use of the comparative (2−ΔΔCT) method.
Table 1 The Primers Used for qPCR Analysis
Name
|
|
Sequences (5ʹ→3ʹ)
|
FKBP51
|
Forward primer
|
GATGAGGGCACCAGTAACAATG
|
|
Reverse primer
|
CAACATCCCTTTGTAGTGGACAT
|
GR alpha
|
Forward primer
|
GGCAGCGGTTTTATCAACTG
|
|
Reverse primer
|
TCAATACTCATGGACTTATCCAAAAA
|
GR beta
|
Forward primer
|
AAAGAGCTAGGAAAAGCCATTGTC
|
|
Reverse primer
|
CTGTCTTTGGGCTTTTGAGATAGG
|
RPS16
|
Forward primer
|
CAGGTCTTCGGACGCAAGAAA
|
|
Reverse primer
|
CGGCTCGATCATCTCCAGG
|
Statistical Analysis: The continuous variables are presented with Mean and SD for normally distributed variables and median with interquartile range (IQR) for nonnormally distributed variables. The Western blot band densities were quantified by Quantity one software (Bio-Rad, CA, USA). The results were confirmed normality and variance homogeneity using homogeneity of variance test before one-way ANOVA, after ANOVA showed a significant difference, pair-wise comparisons between mean were tested by Bonferroni multiple comparison, Kruskal-Wallis test was used for the comparison of nonnormally distributed variables between more than two groups. A value of p < 0.05 was considered to manifest a statistically significant difference. All statistical tests were performed using SPSS software 25.0 (IBM, Armonk, NJ, USA). The results were presented using GraphPad Prism software 8.0.2 (GraphPad, San Diego, CA, USA)