Animals and mouse breeding
SARM1 Nestin -CKO conditional knockout mice were generated by crossing the floxed SARM1 allele (SARM1f/f) mice with Nestin-Cre transgenic mice (003771, from The Jackson Laboratory; donated by Dr Rudiger Klein), which expresses Cre recombinase in neural stem cells under the control of the nestin promoter and conditional knockout genes in neural stem cells and as well as their derivatives including neurons and astrocytes [22]. SARM1f/f mice were obtained by crossing between SARM1f/w mice, which were generated by Shanghai Biomodel Organism Science & Technology Development Co., Ltd. A targeting vector containing the first two exons of the SARM1 gene was created by recombineering. Briefly, transformed ES colonies were screened by long-template PCR with the following primer sets: P5F (5'- GGAGTTATAGAGGATCACGAGCCAC − 3') and P5R (5'- GGCCTACCCGCTTCCATTGCTC − 3') to generate a 5.1-kb band for positive clones; P3F (5'- CCGTGCCTTCCTTGACCCTGG − 3') and P3R (5'- AGCCTTTGCCCACTGAGACATC − 3') to generate a 4.7-kb band for positive clones. Successfully targeted ES clones (confirmed by both 5'PCR and 3'PCR) were microinjected into C57BL/6 blastocysts. Germline transmission from generated chimeric offspring was confirmed by long-template PCR. Mice carrying the targeted allele were bred to Flp recombinase transgenic mice to remove the FRT-flanked Neo cassette and to generate the SARM1 flox mice. Genomic DNAs extracted from tail biopsies were genotyped with a PCR primer set (P1: 5'- AGCAACAAGCACTCTGAATGG − 3', P2: 5'- AGATCACGCCTAGACCGATG − 3') that generated a 466-bp band from the wild-type allele, a 500-bp band from the SARM1 floxed allele. Flp was isolated by crossing SARM1f/w; Flp mice with wild-type mice. Genomic DNAs extracted from tail biopsies were genotyped with a PCR primer set (PA: 5'- CACTGATATTGTAAGTAGTTTGC − 3', PB: 5'- CTAGTGCGAAGTAGTGATCAGG − 3') that generated no band from the wild-type allele, a 715-bp band from the Flp allele. Nestin-Cre-tdTomato reporter (Nestin-Cre+/−; Ai14) mice were generated by crossing the floxed tdTomato at Rosa 26 locus allele (Ai14) with Nestin-Cre transgenic mice. All wild-type, SARM1f/w, SARM1f/f, Nestin-Cre+/−; SARM1f/w, SARM1Nestin-CKO and Nestin-Cre+/−; Ai14 mice were maintained in C57BL/6 strain background. For all experiments, 8–12 weeks old male mice were used unless specifically stated. All experimental animals were approved by the Laboratory Animals Ethics Committee of Wenzhou Medical University.
SCI surgical procedures
All of the animals (2 M male wild-type, SARM1f/f and SARM1Nestin-CKO mice) underwent general anesthesia (20 ml/kg) by intraperitoneal injection of avertin (2, 2, 2-tribromoethanol, Sigma-Aldrich) in 0.9% saline solution. Surgical procedures were described previously [23, 24]. Briefly, a laminectomy from T8 to T10 of spinal cords was performed on a surgical microscope (Nikon SMZ745) and a mouse spinal cord adapter. Spinal cord was contused in T9 by a weight (10 g) from 5 cm height on a mouse spinal cord impactor (RWD, 68094). After SCI, the bladder was manually evacuated twice daily until the restoration urinating function. In sham group, all animals were subjected to laminectomy alone. All animals were randomly distributed into the following groups and evaluated blind to genotype and experimental condition. Mice were utilized to assess histological, biochemical and behavioral function procedures as described below.
Behavioral analysis
Mice were evaluated using four behavioral experiment assays to assess hindlimb functions as previously described [25].
Open-field locomotor task
The objective of this evaluation was to assess gross voluntary use of the hindlimbs, and did not attempt to define subtle differences in usage that might be correlated with specific neural mechanisms that might underlie dysfunctions. We used a simple six-point scale, as described before [26]. All animals were evaluated in an open field by the same one or two observers blind to the experimental condition and received a score for gross voluntary movement of each hindlimb using an operationally defined six-point scale: (0) no voluntary hindlimb movement, (1) little voluntary hindlimb movement, (3) hindlimb assisted in occasional weight support and plantar placement but not in stepping, (4) hindlimb used for weight support and stepping, but obvious disability, and (5) hindlimb function essentially normal.
Footprint analysis
To assess the athletic ability of forelimbs and hindlimbs, mice were running along a paper-lined runway, as described before [27, 28]. Each forelimb and hindlimb was brushed with black (forelimbs) and red (hindlimbs) nontoxic ink, and qualitative analyzed plantar stepping, stride length and width, and overall stepping ability.
Rotarod performance
To evaluate the function of balance, grip strength and motor coordination, animals were put in a single-lane rotarod (Anhui Zhenghua Biological Instrument Equipment, YLS-10A) for three trials per session, which was set for 3 to 30 rpm over 180 sec, and scored on seconds to fall.
Pole test
To evaluate the ability of balance and coordination, animals were placed on a 50 cm-high pole and the time all four limbs land on were recorded. When the animal paused and could not turn but instead descended with a lateral body position, the trial was repeated. Each trial was scored individually and averaged for a final score per session.
Western blot
Spinal cords and other nerve tissues were lysed in the lysis buffer: ice-cold RIPA Buffer (P0013B, Beyotime), 100 mM NaF, 100 mM Na3VO4, 100 mM PMSF (ST506, Beyotime), and incubated at 4 ℃ for 30 min, and centrifuged at 12, 000 rpm for 30 min, and extracted with 5 ⋅ loading buffer (P1040, Solarbio). Finally, the lysates were boiled at 100 ℃ for 10 min. The samples were separated using 8%, 10% or 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto nitrocellulose membranes (Life sciences, USA). After blocking in 5% skim milk (232100, BD Bioscience) for 1.5 h, the immunoblots were incubated with different primary antibodies for overnight at 4 ℃. Primary antibodies included rabbit mouse anti-β-actin (A5316, Sigma-Aldrich, 1:10, 000), mouse anti-MBP (ab62631, Abcam, 1:1, 000), rabbit anti-SARM1 (ab226930, Abcam, 1:1, 000), rabbit anti-NF-κB (p65) (ab16502, Abcam, 1:1, 000), rabbit anti-IKB-α (ab32518, Abcam, 1:1, 000), rabbit anti-p-JNK (#4668, Cell Signaling, 1:1, 000), rabbit anti-JNK (bs-2592R, Bioss, 1:1, 000), rabbit anti-c-Jun (bs-0670R, Bioss, 1:1, 000), rabbit anti-NF (ab8135, Abcam, 1:1, 000). Using the secondary antibodies, goat anti-mouse IgG-HRP (31460, Pierce, 1:5, 000) or goat anti-rabbit IgG-HRP (31420, Pierce, 1:5, 000), for 1.5 h. The western blots were detected by the ECL detection kit (Bio-Rad, USA). Subsequently, blots were analyzed using Quantity One software (Bio-Rad, USA).
Nissl staining
Nissl staining was performed as previously described [29]. After mice were perfused with 0.1 mol/L PBS followed by 4% paraformaldehyde (PFA), the spinal cords were immersed in 4% PFA for 24 h and transferred to 30% sucrose solution until they sank. Subsequently, the spinal cords were cut into 20-um-thick transverse and horizontal sections using a freezing microtome (Thermo, USA). After the sections were incubated with 0.1% cresyl violet for 5 min at room temperature, the sections were rinsed in double distilled water followed by 95% ethanol, dehydrated in 100% ethanol and cleared in xylene, and covered by neutral resins. The images were acquired with a microscope (Nikon, Tokyo, Japan) and the ventral horn neurons were counted with ImageJ software (Media Cybernetics, Bethesda, MD, USA). Quantitative analysis of histological staining and fluorescence was used by Image J.
Hematoxylin-Eosin (HE) staining
Briefly, after perfusion with 0.1 M PBS followed by 4% PFA, the spinal cords of mice were immersed in 4% PFA for 24 h and transferred to 30% sucrose solution until they sank. Subsequently, the spinal cords were embedded in OCT (optimal cutting temperature) and were cut into 20 µm-thick transverse sections using a freezing microtome (Thermo, USA). After staining with hematoxylin for 1 min, the sections were washed three times in double distilled water. Then the sections were incubated in the acidic liquid alcohol differentiation for 30 s, staining with eosine for 50 s, followed by 95% ethanol, 100% ethanol, and finally cleared in xylene, and mounted by neutral resins. The images were acquired with a microscope (Nikon, Tokyo, Japan) and quantitative analysis of the images was done by Image J.
Immunostaining
For staining of the spinal cord tissue sections, after fixed 30 min and antigen repaired 30 min at 90℃ by sodium citrate antigen retrieval solution (C1032, Solarbio), the spinal cord tissue sections were processed for immunostaining by 1 h blocking in 5% BSA (4240GR100, Biofroxx) plus 0.3% Triton X-100 (T8200, Solarbio) at room temperature, for overnight incubation with primary antibodies at 4℃, and washed three times in PBS and then were incubated for 1 h at room temperature with appropriate secondary antibodies. Primary antibodies included mouse anti-NeuN (ab177487, Abcam, 1:500), mouse anti-GFAP (MAB360, Millipore, 1:500), goat anti-Iba1 (ab5076, Abcam, 1:500), mouse anti-MBP (ab62631, Abcam, 1:500), rabbit anti-SARM1 (ab226930, Abcam, 1:500), rabbit anti-CD45 (ab10558,Abcam, 1 : 500), rabbit anti-NF (ab8135, Abcam, 1:500). Secondary antibodies included donkey anti-rabbit Alexa Fluor488 (A21206, Invitrogen, 1:1, 000), donkey anti-mouse Alexa Fluor488 (A21202, Invitrogen, 1:1, 000), donkey anti-rabbit Alexa Fluor546 (A10040, Invitrogen, 1:1, 000), donkey anti-mouse Alexa Fluor546 (A10036, Invitrogen, 1:1, 000), donkey anti-goat Alexa Fluor488 (A11055, Invitrogen, 1:1, 000). Images were acquired using confocal microscopes (TCS SP8, Lecia) or microscope (Li2, Nikon) and analyzed with Image J and Photoshop (Adobe).
Quantitative Real-Time PCR (qRT-PCR).
For qRT-PCR, total RNA was extracted from spinal cord of SARM1f/f or SARM1Nestin-CKO mice at 3 d after SCI using TRIzol™ reagent (#15596026, Ambion) according to the protocol provided by the manufacturer. Then, RNA was reversely transcribed into cDNA with a SuperScript™ One-Step Reverse Transcription Kit (#10928-034, Invitrogen, CA, USA). The expression levels of mRNA were quantified using the iTaq™ Universal SYBR Green Supermix (Bio-Rad, USA) on the Real-Time PCR detection System (Applied Biosystems, USA). Samples were amplified independently at least three times. Relative gene expression was converted using the 2−ΔΔCt method against β-actin. β-actin primer: forward, 5’- GTGACGTTGACATCCGTAAAGA-3’ and reverse, 5’- GCCGGACTCATCGTACTCC-3’. NF-κB primer: forward, 5’- AGAGGGGATTTCGATTCCGC − 3’ and reverse, 5’- CCTGTGGGTAGGATTTCTTGTTC − 3’. IFN-α primer: forward, 5’- GGATGTGACCTTCCTCAGACTC − 3’ and reverse, 5’- ACCTTCTCCTGCGGGAATCCAA − 3’. IFN-β primer: forward, 5’- GCCTTTGCCATCCAAGAGATGC − 3’ and reverse, 5’- ACACTGTCTGCTGGTGGAGTTC − 3’. IFN-γ primer: forward, 5’- AGCGGCTGACTGAACTCAGATTGTAG − 3’ and reverse, 5’- GTCACAGTTTTCAGCTGTATAGGG − 3’. IL-1β primer: forward, 5’- TGGACCTTCCAGGATGAGGACA − 3’ and reverse, 5’- GTTCATCTCGGAGCCTGTAGTG − 3’. MIP-1α primer: forward, 5’- ACTGCCTGCTGCTTCTCCTACA − 3’ and reverse, 5’- ATGACACCTGGCTGGGAGCAAA − 3’. TNF-α primer: forward, 5’- GGTGCCTATGTCTCAGCCTCTT − 3’ and reverse, 5’- GCCATAGAACTGATGAGAGGGAG − 3’. RANTES primer: forward, 5’- CTCACCATATGGCTCGGACA − 3’ and reverse, 5’- ACAAACACGACTGCAAGATTGG − 3’.
Pharmacological interference with the FK866
Sham control and spinal cord injured C57BL/6J mice were treated with FK866 (10 mg/kg i.p., Sigma-Aldrich, catalog #F8557) twice every day until the experiments were terminated [30, 31]. Meanwhile, the control group mice were injected intraperitoneally with the same amount of normal saline.
Statistical analysis
All data presented represent results as mean ± SEM from at least three independent experiments. Statistical analysis was performed using Student’s t-test or using ANOVA with Bonferroni post-tests. Statistical significance was defined as P < 0.05.