Animals
One-day-old specific-pathogen-free (SPF) chickens, SPF chicken embryos, and SPF duck embryos were purchased from Lihua Agricultural Co., Ltd. (Lihua, Zhejiang, China). The birds were kept in a healthy and controlled environment with the temperature maintained according to the age and behavior of the birds at 30 to 35 ℃.
Viruses
The DAdV-3 in this study, A/Muscovy duck/Anhui/DK2022 (DK2022), was isolated from the liver tissue of Muscovy ducks at a duck farm in Anhui in 2022. Total DNA and RNA were extracted from the liver of the Muscovy duck using a viral RNA/DNA purification kit (Tiangen, Beijing, China) according to the manufacturer's instructions. For the hexon and fiber-2 genes of DAdV-3, two pairs of primers were designed to amplify the target genes, and the sequence and fragment sizes of the primers are shown in Table 1. The method of virus identification and the preparation of SPF chick embryo or duck embryo allantoic fluid was performed according to our reported methods[21]. The 50% tissue culture infectious dose (TCID50) of the virus was determined by infection of the chicken liver cancer cell (LMH), and values were calculated using the Reed-Muench method[22]. In addition to DAdV-3 detection, the sample was also tested for other potential pathogens, such as duck stellate virus (DAstV), duck Tembusu virus (DTMUV), avian pulmonary virus (AMPV), avian influenza virus (AIV), and duck circovirus (DuCV), according to other studies[13, 23, 24].
Genetic and phylogenetic analyses
The genomic DNA of DAdV-3 was extracted from the liver of the Muscovy duck using a DNA extraction kit (Anheal, Beijing, China). Genomic DNA was quantified by using a TBS-380 fluorometer (Turner BioSystems Inc., Sunnyvale, CA, USA). High-quality DNA samples with an optical density (OD) 260/280 of 1.8 to 2.0, which exceeded 6 µg, were used to construct a fragment library. Sequencing and genome assembly were performed by Company. (Biozeron Biotechnology, Shanghai, China). The genome sequence was submitted to NCBI. The nucleotide sequence was compared to the NCBI GenBank database using the BLAST algorithm Search Tool (BLASTn). The amino acid sequences of the putative proteins were compared to proteins in the NCBI GenBank database using basic local alignment (BLASTp) and with those reported by DAdV-2 (KJ469653) and mapped.
The hexon gene sequences of the genome were input into NCBI for gene comparison analysis, and the amino acid sequences of hexon protein 18 avian adenovirus strains, FAdV-A, B, C, D, E, and DAdV, were also selected for phylogenetic analysis. The amino acid sequences were aligned using BioEdit v7.2.5. The best amino acid substitution models were selected using MEGA v6.0. Phylogenetic trees were generated using the maximum likelihood method implemented in MEGA v6.0, and the tree was constructed using the neighbor-joining method with bootstrapping over 1,000 replicates.
PCR amplification of the major amino acid differential regions
The major variation domains of the isolated DAdV-3 (HF-AH-2022) and nonvirulent strain DAdV-3 (HF-AH-2020) were compared and amplified. In previous studies, a nonvirulent strain DAdV-3 called HF-AH-2020 was isolated, and MEGA v6.0 was applied to compare the genome of two strains DAdV-3 labeled HF-AH-2020 and HF-AH-2022. The main changed regions between different virulent DAdV-3 strains were ORF19B and ORF66. Some scholars found that ORF67 was the main difference between different strains of DAdV-3[25]. In this study, PCR was used to amplify the three ORF regions ORF19B, ORF66, and ORF67 from viruses isolated from chickens and Muscovy ducks, infected by HF-AH-2022 in and MEGA v6.0 was used to compare the differences. Primers were designed for amplification and comparison analysis of these regions, and the sequences of the primers are shown in Table 3.
Table 3
The sequences of primers used in this study.
| Amplified gene | Primer sequences(5'-3') | Size/bp |
|---|
| Hexon | F: atggccgctctgacccctga R: attcagccttagctactttc | 600 |
| Fiber-2 | F: gcttcgcgactatttcaacca R: gccttaacgactgcggtttc | 127 |
| ORF66 | F: atgggaatgtagatcgtggtg R: ttttgctgggatcctcaacct | 420 |
| ORF67 | F: acctaagccacccctaccag R: gcaggatacgtcaccacgat | 398 |
| ORF19B | F: tggtggtggaaattgatgaaga R: ttggcagtcagtgtgattcct | 307 |
| Note: Underline is the restriction site. F: forwad primer, R: reverse primer. |
Pathogenicity of HF-AN-2022 Strain in Chickens
Fifteen- and 30-day-old SPF chickens (n = 210) were randomly divided into 14 groups (n = 15 per inoculated group). Two inoculation routes were used in this experiment, namely, subcutaneous injection of neck and eye-nose drops. The allantoic fluid from chicken embryos was inoculated, and the method, dosage, and frequency of inoculation are shown in Table 1.
Groups 1–4 were subcutaneously inoculated, in which chicks in Groups 1 and 2 were inoculated with 0.2 mL chick embryo allantoic fluid containing 2×105.41 TCID50/0.1 mL. Chicks in Groups 3 and 4 were inoculated with 0.2 mL PBS (Beyotime, Shanghai, China) in the same way as negative controls. Groups 5–10 were inoculated with eye-nose drops, among which Groups 5 and 7 were inoculated with 0.2 mL only once. Groups 6 and 8 were inoculated with 0.2 mL each time twice a day for three consecutive days. Chicks in Groups 9 and 10 were inoculated with the same dose of PBS in the same way as negative controls. Meanwhile, chicks in Groups 11 and 12 were inoculated with duck embryo allantoic fluid, and the methods, dosage, and frequency of inoculation are shown in Table 2. Chicks in Groups 13 and 14 were inoculated with the same dose of PBS in the same manner as negative controls. All chickens were observed for 12 d. At 3–5 days postinoculation (dpi), the heart, liver, spleen, lung, kidney, gizzard, glandular stomach, brain, duodenum, and bursa of 3 sacrificed chickens in Group 2 were collected separately. Meanwhile, the same tissues in Group 4 were collected as a negative control. All chickens were kept according to standard protocols, and all data, such as clinical signs and symptoms, were collected on a daily basis.
Histopathological assays
Tissues were fixed in 4% paraformaldehyde fixing solution at pH 7.4 and then embedded in paraffin blocks. From the paraffin-embedded gizzards, 3 µm thick tissue slices were prepared using a Microm HM 360 microtome (Microm Laborgeräte GmbH, Walldorf, Germany). Sections were mounted on glass slides and stained with hematoxylin and eosin staining (HE). Pictures were taken by a bright field microscope, and photomicrographs were taken on a DP25 digital camera (Olympus, Tokyo, Japan).
Quantification of viral DNA load in the infected chickens
To analyze the distribution of DAdV-3 in infected chickens, after 3–5 dpi, tissues were collected from three sacrificed chickens in Group 2, including the heart, liver, spleen, kidney, brain, gizzard, glandular stomach, duodenum, lung and bursa, frozen in liquid nitrogen and stored at − 80°C. Fifty milligrams was taken from each tissue for DNA extraction. The DNA was extracted according to the method noted earlier. The viral load in different tissues was detected by quantitative real-time PCR (qPCR). SYBR RT‒PCR with primers annealing within the highly conserved fiber-2 region was performed to determine the viral load in Table 1. The quantification of the virus through RT‒PCR was performed using AceQ® RT‒PCR SYBR® Green Master Mix (Vazyme, China). Standard curves were obtained by using 10-fold serial dilutions of a linearized plasmid containing the partial fiber-2 gene of DAdV-3 and were run three times in duplicate. Negative and no template controls were included during sample preparation and qPCR to monitor possible contamination. The number of viral genome copies per reaction was calculated by comparing the threshold cycle (CT) values of the investigated samples’ threshold CT values with the standard curves. An assessment of the specificity of the RT‒PCR products was accomplished by analyzing the melting curve. Each reaction was performed in triplicate, and the results are expressed as the mean ± standard deviation (SD). The SD value of each organ was used as the final copy number. Finally, viral load was calculated as the number of viral copies per g tissues.
ELISA
Before the experiment, the indirect enzyme-linked immunosorbent assay (ELISA) method was established to determine the DAdV-3-specific antibody levels in the serum of surviving chickens. Twenty milliliters of positive chicken embryo allantoic solution was collected for virus superisolation, and centrifugation at 134 000 × g for 4.5 h was performed to obtain 1 mL of concentrated allantoic solution. The protein concentration of the virus was detected with the BCA protein concentration assay kit (Beyotime, Shanghai, China). Rabbits were immunized by multiple subcutaneous injections (600 µg/kg body weight) on Days 0, 14, and 28 after emulsifying and mixing with the adjuvant (Sebenwhite oil: glycerin = 3:1). On the 14th day after the third immunization, blood was collected, serum was separated through the rabbit auricular vein, and serum was obtained as a positive control serum. Meanwhile, rabbits in the blank group were injected with PBS only, and serum was collected in the same way at the same time as the negative control. The optimal dilution of the antigen and serum were determined by a checker board titration with rabbit DAdV-3-positive and -negative sera. The obtained virus diluted in 0.05 M carbonate buffer (pH 9.6) were coated separately in ELISA plates (Shenggong, Shanghai, China) ranging from 0.125 to 4 µg/µl. The dilutions of rabbit serum ranged from 1:500 to 1:120 000. Both reference positive and negative sera were diluted serially 2-fold and tested in separate plates. Dilutions that resulted in the maximum difference in absorbance at 450 nm for the positive and negative sera (P/N) were defined as the optimal working conditions to test the experimental chicken serum samples (Groups 8 and 10).
Briefly, 100 µl of concentrated virus (1 µg/µl) was placed into each well of the ELISA plates and incubated overnight at 4 ℃. After incubation, the plates were washed three times with PBS containing 0.05% Tween-20 (PBST) and then incubated with 5% FBS (Beyotime, Shanghai, China) for 1 h at 37 ℃. After three washes, chicken serum samples were diluted 1:20 000 and incubated for 1 h at 37 ℃. Following incubation, samples were washed three times and incubated for 1 h at 37°C with HRP-conjugated secondary antibody bird IgY (Bioss, Beijing, China) diluted 1:2500. After washing, 100 µl tetramethylbenzidine substrate (Beyotime, Shanghai, China) was added to each well, and the plates were incubated in the dark for 10 min. The enzymatic reaction was quenched by hydrofluoric acid, and the optical density (OD) was determined at 450 nm. The cutoff value was an OD of 0.2 at 450 nm. The OD values of the positive control (ODpos) and the samples (ODsample) were corrected by subtracting the OD value of the negative control (ODneg). The sample value was calculated as a ratio using the formula: value = (ODsample-ODneg)/(ODpos-ODneg). Each sample was analyzed in triplicate.