2.1 Patients and sample collection
This study received approval from the Hunan Cancer Hospital Hospital Ethics Committee (SBQLL-2021-255), and written informed consent was obtained from all participating patients who were diagnosed with LUAD at Hunan Cancer Hospital. A total of 8 patients were included, with 7 males and 1 female. The age of the patients ranged from 43 to 65 years, with a mean age of 54.25. Half of the patients had a history of smoking. The majority of patients (62.5%) had tumor stage I, with 12.5% having stage II, and 25% having stage III. The primary tumor location was found in all areas of the lung except for the left middle lung. All patients had a post-surgical pathological resection status of R0 and 100% survived. Tissue samples were collected from both LUAD and para-carcinoma tissues.
2.2 LUAD xenograft model
Male nude mice, 4 weeks old, were obtained from Hunan SJA Laboratory Animal Co., Ltd. A549 cells (2 × 106/mL, AW-CCH011, Abiowell) were subcutaneously injected into the right axilla at a volume of 100 µL to establish the Model group[21]. The sh-NC and sh-COPZ1 groups were created by injecting A549 cells transfected with sh-NC or sh-COPZ1 plasmids, respectively. Both sh-NC and sh-COPZ1 vectors were purchased from Invitrogen. Evaluation began on day 7 after tumor inoculation, and tumor measurement were performed twice weekly. After 21 days, the nude mice were sacrificed by intraperitoneal injection of sodium pentobarbital (100mg/kg), and tumor tissue was collected for weighing and subsequent experiments. All animal procedures were approved by Institutional Animal Care and Use Committees of Hunan Cancer Hospital (2021 − 185).
2.3 Cell culture
The human LUAD cell line NCI-H1975 (AW-CCH095, Abiowell) was cultured in DMEM medium supplemented with 10% FBS and 1% P/S in a 5% CO2, 37°C incubator. Transfection of sh-COPZ1 or negative control sh-NC into NCI-H1975 cells was performed using Lipofectamine 2000 (Invitrogen) following the manufacturer’s instructions, and the cells were cultured for 48 hours. To investigate the impact of NCOA4 on COPZ1 functionality, sh-COPZ1 and si-NCOA4 were co-transfected into NCI-H1975 cells and cultured for 48 hours. Plasmids si-NCOA4 and si-NC were ordered from Invitrogen.
2.4 Co-inmunoprecipitation (co-IP) assay
Co-IP was utilized to detect protein interactions. Protein extraction from tissues or cells was performed using IP lysate (AWB0144, Abiowell). The protein supernatant was incubated overnight at 4°C with normal mouse IgG (B900620, Proteintech), normal rabbit IgG (B900610, Proteintech), or NCOA4 antibodies (mouse or rabbit source). Protein A/G agarose beads were added to the IP lysate, mixed well, centrifuged, and the precipitate was retained. The cell lysate and agarose beads were mixed thoroughly at 4°C for 2 hours to attach the antibody to the sugar beads. The agarose beads were then washed using IP lysis buffer to obtain the co-IP product, followed by Western blotting analysis.
2.5 Quantitative real-time PCR (qRT-PCR)
Total RNAs from cells and tumor tissues were extracted with TRIzol (15596026, Thermo), followed by reverse transcription with the HiFiScript cDNA Synthesis Kit (CW2569, ConWin). qRT-PCR was performed with UltraSYBR Mixture kit (CW2601, ConWin), using β-actin as internal reference. The relative mRNA levels of targets were determined using the 2−ΔΔCt method. The primers are shown in Table 1.
Table 1
Primer sequences used in the study were listed.
Targets | F (5'-3') | R (5'-3') |
COPZ1 | ATGGAGGCGCTGATTTTGTACT | TCCTCAGCATCTGGCTCAAT |
NCOA4 | ACCGTTGGGAATTTTCAGATCC | AGGCTGCTCAACTCTTGTCC |
PTGS2 | CTGCGCCTTTTCAAGGATGG | CCCCACAGCAAACCGTAGAT |
β-actin | ACCCTGAAGTACCCCATCGAG | AGCACAGCCTGGATAGCAAC |
2.6 Western blot
Total protein from cell lysates or tumour tissue was extracted using RIPA (AWB0136, Abiowell) and subsequently the BCA kit (AWB0104, Abiowell) was applied to quantify protein concentrations. Total protein was then separated by SDS-PAGE and transferred to NC membranes. After blocking, the membranes were incubated with COPZ1 (1:1000, 20440-1-AP, Proteintech), NCOA4 (1:1000, ab86707, Abcam), FTH1 (1:1000, #4393, CST), LC3 (2 µg/mL, ab48394, Abcam), and β-actin (1:5000, 66009-1-Ig, Proteintech) overnight at 4°C. The membranes were mixed with HRP goat anti-mouse IgG (1:5000, SA00001-1, Proteintech) or anti-rabbit (1:6000, SA00001-2, Proteintech) for 90 minutes. Finally, membranes were mixed thoroughly with ECL Plus (AWB0005, Aiowell) and protein bands were visualised on a gel imaging system (ChemiScope 6100, CLiNX).
2.7 Hematoxylin-eosin (HE) staining
The tumor tissues collected were embedded and sliced into thin sections of 2–3 µm. Hematoxylin (AWI0009, Abiowell) and eosin (AWI0020, Abiowell) staining were performed sequentially on the sections. Subsequently, the sections were dehydrated with gradient alcohol and immersed in a xylene solution. Neutral gum was used to seal the sections, and the histomorphological changes were observed through a microscope (BA410, Motic).
2.8 Biochemical analysis
To detect the levels of reactive oxygen species (ROS), Malondialdehyde (MDA), 4-hydroxynonenal (HNE), glutathione peroxidase (GSH-Px), and Fe2+ in tumor tissues and cells, the following kits were included: ROS assay kit (E004-1, Nanjing Jiancheng Bioengineering Institute), MDA assay kit (A003-1, Nanjing Jiancheng Bioengineering Institute), human 4-HNE kit (CSB-E16214h, CUSABIO), mouse 4-HNE kit (CSB-E13412m, CUSABIO), GSH-Px (A005-1, Nanjing Jiancheng Bioengineering Institute), and ferrous iron colorimetric assay kit (tissue, E-BC-K773-M; cell, E-BC-K881-M, Elabscience).
2.9 Apoptosis assay
The Annexin V-APC/PI Apoptosis Detection Kit (KGA1030, KeyGen BioTECH) was utilized to assess apoptosis. Cells were collected through EDTA-free trypsin digestion and adjusted to a cell concentration of 3.2 × 105 cells. The cells were then suspended in binding buffer, and annexin V-APC and propidium iodide were sequentially added and mixed thoroughly with the cells. Following this, the mixture was incubated for 10 minutes at room temperature and in the dark. Finally, flow cytometry (A00-1-1102, Beckman) was performed to analyze the changes in each group.
2.10 Flow cytometry
To measure ROS levels in the cells, the ROS assay kit (S0033S, Beyotime) was used. Cells were treated with 10 µM DCFH-DA, ensuring complete coverage of the cells. The cells were then incubated in a 37°C incubator for 20 minutes. After incubation, the cells were washed with serum-free cell culture medium to remove DCFH-DA that had not entered the cells. Subsequently, the cells were collected through trypsin digestion and assayed using flow cytometry.
2.11 Immunofluorescence (IF) staining
IF assay was used to examine the localization of ferritin and lysosomes in cells. Cells were fixed with 4% paraformaldehyde and permeabilized with 0.3% Triton X-100 for 30 minutes. The cells were then blocked with 5% BSA for 1 hour and incubated overnight at 4°C with Ferritin (1:50, ab65080, Abcam) or Lamp2 (1:50, 66301-1-IG, Proteintech) antibodies. Following this, cells were exposed to anti-Rabbit IgG (H + L) (1:200, SA00013, Proteintech) and incubated for 90 minutes at room temperature. Nuclei were stained using DAPI. Fluorescent images (magnification 400×) were captured on a fluorescence microscope (BA210E, Motic), where green indicated a Ferritin positive signal, red indicated a Lamp2 positive signal, and blue indicated a nucleus positive signal.
2.12 Statistical analysis
Statistical analysis was performed using GraphPad Prism 9, and all data were presented as mean ± standard deviation (SD). The Stusent's t-test was employed for comparisons between two groups. Differences between three or more groups were determined by ANOVA. P < 0.05 was considered as statistical significance.