Lentivirus transfection
MG63 cells (1´106) were seeded to each 60-mm petri dish (about 80% confluence) 1 day before transfection. A standard transfection procedure from the manufacturer (Life Technology) was followed. The cDNA coding region to human CD146 was PCR amplified and subcloned into the lentiviral shuttle vector pwpxl. Lentiviruses were produced in HEK293 cells and amplified to obtain high titers, G418 (0.25 mg/ml; active component 0.19 mg/ml, LD50) was added for screening G418R clones. Each clone was expanded and huMUC18 expression was determined by Western blot analysis, resulting in the lentivirus expressing CD146 (Lenti-CD146) that also expressed GFP as a marker to monitor infection efficiency. Lenti-GFP was used as a control.
Cell culture
All cell lines were purchased from the American Type Culture Collection (Manassas, VA). A375SM, SB-2 melanoma and U2OS OS cell lines were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (Gibco Life Technologies) with 1 g/liter glucose and 10% fetal calf serum (FCS). MG63, 143B, Lenti-CD146, Lenti-GFP and Human umbilical vein endothelial cells (HUVECs) were propagated in RPMI 1640 medium (Gibco Life Technologies) supplemented with 10% FCS. All of the cells were incubated at 37°C in conditions of 5% CO2.
Immunofluorescence
All kinds of OS cells were plated on confocal dishes in advance 24 h, respectively. The cells were washed 3 times with phosphate-buffered saline, fixed in 4% paraformaldehyde, and permeabilized with 0.2% Triton X-100. After being washed with PBS and incubated with blocking reagent (5% nonfat milk in PBS) for 15 min, cells were incubated for 1 h at room temperature with anti-CD146 mAb ab75769 (Abcam, Cambridge, MA, USA)or irrelevant IgG1 mAb (1:500). Secondary labeling was then done for 2 h with PE sheep anti–rabbit IgG (1:100). The nucleus was stained by DAPI (10 mg/ml, Invitrogen) for 15 min at room temperature. Samples were examined with a confocal laser scanning microscope (Olympus, Tokyo, Japan), and using Image J software (National Institutes of Health, USA) merged images.
Western Blotting
All kinds of cell lines were washed with PBS and harvested in RIPA buffer. Total protein concentrations were measured using the bicinchoninic acid assay (Pierce Chemical Co Rockford, IL, USA). Samples were loaded at 40 mg /lane and separated on 8–12% SDS–polyacrylamide gels and then transferred to polyvinylidene difluoride membranes and probed with specific primary anti-CD146 mAb ab75769 or ab134065 (Abcam, Cambridge, MA, USA). To detect the signal, peroxidase-conjugated secondary antibody was added, followed by exposure using enhanced chemiluminescence (Amersham, Arlington Heights, IL, USA). The intensity of the amplified products was quantified by densitometry analysis and referred to that obtained with glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Densitometry analysis was performed by Image J software (National Institutes of Health, USA) on at least three independent experiments.
RNA extraction , semi-quantitative (sq) and real-time qPCR assay
Total RNAs were extracted from cells using Trizol solution (Invitrogen), according to the manufacturer’s instructions. RNA concentrations were measured using the Nanodrop2000 spectrophotometer. Complementary DNA (cDNA) was synthesized from RNA using a PrimeScript RT reagent kit (TaKaRa, Japan). Semi-quantitative PCR (sq-PCR)was carried out to determine the gene expression levels of CD146 and GAPDH in human MG63, A375SM, and HUVEC cells, while real-time quantitative PCR (qPCR) was used to assess expression of CD146 and GAPDH in all kinds of cells we researched. The generation of specific PCR products was confirmed with melting-curve analysis, and data presented as target gene expression normalized to GAPDH. According to the sequence of CD146 mRNA (NCBI Reference Sequence: NM-006500.2), we designed CD146 primers by using Premier Primer 5 software (Premier, Canada). The primers used were shown in Table 1.
Table 1 Sequences of primers for the PCR analysis
Gene
|
Primer 5'to3'
|
Fragment (bp)
|
CD146
|
F: AGTCCTGAGCACCCTGAATGTCC
|
263
|
|
R: CAATCACAGCCACGATGACCAC
|
|
GAPDH
|
F: CCTCTGACTTCAACAGCGACAC
|
174
|
|
R: TGGTCCAGGGGTCTTACTCC
|
|
Cell migration and invasion assay
Before migration, cells were serum-starved overnight. Then, 2×105 OS cells or 1×106 HUVECs in 200 μl of the serum-free RPMI 1640 medium were seeded to each top well of a 12-well Transwell Boyden system (8 mm pore size, Sigma, CLS3422),and 500 ml RPMI 1640 medium supplemented with 10% fetal calf serum was added to the lower chamber. Cells were allowed to migrate for 24 h at 37℃, in 5% CO2. After removing cells on the upper surface of the filter using cotton swabs, cells that invaded through the membrane were fixed with 4% paraformaldehyde for 20 min and stained with 0.1% crystal violet solution for 15-20 min. The number of cells that reached the lower part of the Transwell filter membrane was counted with Image J software (National Institutes of Health, USA) and plotted as the number of cells per optic field (´200). Experiments were carried out in at least 4 fields in triplicate.
The invasive procedure is almost the same as the migration assay except for the 8 μm pore size (corning, CLS3422) coated with 150 μg of Matrigel (65 μl of 2.3 mg/ml of Matrigel, Becton Dickinson Matrigel Basement membrane Matrix, phenol-red free, Collaborative Research Cat. no. 40234C) used.
Cyclic migration assay (Fig. S1)
5×105 MG63 cells in 0.1 ml of the serum-free RPMI 1640 medium were seeded to each top of Transwell chamber. After migration for 48 h at 37 ℃, in 5% CO2, cells that migrated through the membrane were collected and then amplified culture. When the number of cells is sufficient, the migration operation is carried out again according to the steps mentioned above until the 9th or 15th time. The cells prior to migration (i.e., 0th), migration 9th and 15th were cryopreserved in a -80℃ refrigerator for subsequent cell migration, proliferation, PCR and Western Blotting detection. Experiments were carried out in at least 4 fields (´200) in triplicate.
Matrix colony formation assay
The BD matrix (60μg/ml; BD, USA) and the medium were diluted with 1:3 and added to the 6-well plate. The bottom layer of the gel was poured and allowed to solidify after incubation with 4h at 37℃, in 5% CO2. The cells were laid in each well at 1×104/ml concentrations and cultured for more than 14 days. The culture process was not terminated until small clones were visible to the naked eye in the plate. After discarding the supernatant, the clones were washed twice with PBS carefully and fixed with 4% paraformaldehyde for 15 min and stained with 0.4% crystal violet solution for 10 min. The number of clones counted in a microscope (×100) was greater than 20 cells. The clone formation rate was calculated: clone formation rate = (number of clones / number of inoculated cells) ×100%.
Cell proliferation assay
143B cells (2.5×104/ml, 200 μl//well in 96-well plates) were treated with 1, 2, 4, 8 μg/ml ab75769 or IgG control Ab for 0h, 6h, 12h, 24h, 36h, 48h respectively, then analyzed for viability by MTT assay to explore the optimal inhibitory concentration of antibodies against cells. The most efficient inhibitory concentration group and the control group were defined as “ab75769 group” and “IgG group”, respectively, and follow-up experiments were conducted.
143B cells (ab75769 and IgG group), HUVECs, Lenti-CD146 MG63 or pwpxl vector-only transfected MG63 cells were seeded on 96-well plates at a density of 1x104/ml, 200μl/well, and cultured in medium for indicated time points. The colorimetric MTT assay was performed as indicated by the manufacturer. Absorbance was read at 490 nm. Experiments were performed at six times.
Another method of detecting cell proliferation, which we called Cell counting assay, was determined by plating cells (1×104/ml, 500μl//well) into 24-well plates and cultured in medium. The subconfluent cells were then collected by trypsinization at the indicated time point. The number of viable cells, as determined by trypan blue staining, was counted at the indicated time points at least three times.
It should be noted that the culture medium (CM) used to detect endothelial proliferation was derived from the CM for OS cells, as shown in the “Endothelial cells were cultured in OS CM” section.
Adhesion of OS cells to extracellular matrix (ECM)
We coated 96-well dishes with 0.2% type I collagen (Stemcell, Canada, 100 μl/well). The collagen was air dried to the surface, and the plate was incubated with 1% BSA for 2 h to block irrelevant attachment sites. OS cells (5×105/ml) were added to each well with and without ab75769 or IgG-control mAb for 2 h. The wells were washed with PBS after incubation for 0.5 h, 1 h and 3 h, respectively. The cell number was counted after taking photograph (´200 per optic field) with Image J software (National Institutes of Health, USA).
Three-Dimensional (3D) spheroid homotypic adhesion assay
Multicellular spheroids were generated by the liquid overlay technique. 24-well tissue culture plates were coated with 250μl of prewarmed 1% agarose (Roche, Switzerland) solution in serum-free medium. After the agarose was allowed to solidify and form a thin layer on the bottom of the dish, a single-cell suspension (2×104/ml, 500μl/well) of 143B cells (ab75769 and IgG group), Lenti-CD146 MG63 or pwpxl vector-only transfected MG63 cells were incubated at 37°C in 5% CO2 for 0.5h, 1h and 3h, respectively. Images were captured by bright-field microscopy and photographed in digital format. Three independent experiments were carried out.
Heterotypic adhesion of OS cells to HUVECs
HUVECs (5×104/ml, 100μl/well) were placed on 96-well dishes for 24 h. Following this attachment, the wells were coated with a thin overlay of 2% BSA for 1 h, and 1×105/well 143B cells (ab75769 and IgG group), Lenti-CD146 MG63 or pwpxl vector-only transfected MG63 cells were added to the plates with and without anti-CD146 monoclonal ab75769 or IgG control mAb (diluted 1:500) for 1 h. Wells were rinsed twice with PBS, and cells in each well were counted. Results are presented as the percentage of cells adhered from the total number of cells seeded. The experiment was repeated three times in triplicate.
Endothelial cells were cultured in OS CM
143B cells (ab75769 and IgG group), Lenti-CD146 MG63 or pwpxl vector-only transfected MG63 cells (1×105/ml, 8ml/dish) were seeded into culture dishes, and the OS CM was collected at 80% fusions. OS CM or RPMI 1640 medium (as a control group) was used to culture HUVECs for 24h to detect migration, permeability and tube formation, while the cells cultured at 72h were used for proliferation assays.
Endothelial permeability assays
12-well Transwell Boyden system (Sigma, CLS3414) was pre-coated with a layer of 0.05% gelatin (BD Biosciences), HUVECs were plated at 20,000 cells per well on membrane inserts (porosity 3µm) and allowed to form monolayers. 500 ml RPMI 1640 medium supplemented with 10% fetal calf serum was added to the lower chamber. Then HRP-BSA (1mg/ml, 10ml, Sigma, USA) was added at the apical surface of the cells and was incubated for 12 h at 37°C, in 5% CO2. The 100 ml CM of the upper and lower chambers were collected; following the 100ul TMB chromogenic liquid (Sigma, USA) was added. Absorbance was read at 630nm. The cell permeability was calculated: permeability rate = (OD value of below / OD value of above) ×100%. Experiments were performed at three times.
Tube formation assay
24-well plates were coated with 200 ml Matrigel (BD Biosciences) following the manufacturer’s directions. After the appropriate treatments, HUVECs (1×106/ml, 500μl/well) re-suspended in complete medium were added to each well and incubated at 37°C, in 5% CO2 , for 12 h. Pictures were captured with bright-field microscopy. Only the number of closed tubes (means no defects in any tube walls) was counted and their diameters were measured after taking photograph (´100 per optic field) with Image J software (National Institutes of Health, USA).
Endothelial cells and OS, MG63 and 143B co-culture system
In order to test the expression of CD146 in the interaction between endothelial and OS cells, using the Transwell system of 3 mm pore size that could not pass the cell but could carry out metabolic exchange, we designed the following experiment: 1×105/ml HUVECs in 150 μl complete medium were seeded to top well of a 12-well Transwell Boyden system (3 mm pore size, Sigma, CLS3414),and 1×105/ml OS in 500 μl complete medium was added to the lower membrane inserts. After co-culture with 48 h, different groups of cells were collected for real-time qPCR and Western blotting, and CM from co-culture system and CM from primary culture condition were collected for ELISA. In addition, we also co-cultured MG63 and 143B for 24 h or 48 h, and the culture method and the number of seeded cells were the same, as mentioned above. The cells before co-culture were recorded as 0 h.
ELISA
Dilute the standard substance according to the manufacturer’s instructions (R&D, USA) and add 100 μl per well into the ELISA plate for 1 h at 37 ℃. After four washes using PBS supplemented with 0.05% Tween 20, Biotin-conjugated secondary antibody working fluid (R&D, USA) at 1:100 in PBS were added in each well for 30 min at 37 ℃. Plates were washed four times, and then 100 μl of TMB substrate (Sigma, USA) were added in each well for 15 min at RT. The reaction was stopped by adding 50 μl of Stop Solution, and absorbances were read at 450 nm.
Cell culture environment models
The OS and endothelial cells with a density of 1×104/ml were placed on a 6-well plate for 48h, and divided into 5 groups according to the culture environment, as follows: 1) Hyperoxia (HO). The oxygen concentration was adjusted to 30% and 5% CO2 through the three-gas incubator; 2) Low oxygen (LO). Oxygen concentration was 1%, 5% CO2; 3) High glucose (HG): DMEM containing 10% fetal bovine serum was used as the basic medium, and the final glucose concentration was 4500mg/L; 4) Low glucose (LG). The final concentration of glucose is 1000mg/L; 5) Normal. Cells were cultured in 5% CO2, 21% O2, 37℃saturated humidity, and 2000 mg/L glucose concentration as a control group.
Statistical analyses
SPSS 19.0 was employed to perform the statistical analysis (IBM, Armonk, NY, USA). All data are presented as the mean ± SEM of at least three samples. Repeated measure ANOVA, One-way ANOVA or Student's t-test was applied to perform the statistical analysis. P<0.05 was considered to indicate statistical significance.