Screening and validation of optimal miRNA reference genes in different developing stages and tissues of Lilium henryi Baker

doi:10.21203/rs.3.rs-3292891/v1

Download PDF

Article

Screening and validation of optimal miRNA reference genes in different developing stages and tissues of Lilium henryi Baker

https://doi.org/10.21203/rs.3.rs-3292891/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 17 Jan, 2024

Read the published version in Scientific Reports →

You are reading this latest preprint version

Dynamic miRNA detection using the qRT-PCR technique requires appropriate reference genes to ensure data reliability. Previous studies have screened plant internal reference genes during embryonic development and various stress treatment, involving relatively few tissues and organs. There is no relevant miRNA study in Lilium henryi Baker and limited research on the optimal miRNA reference genes in lilies. Twelve genes were selected as candidate reference genes whose expression stability was analyzed in petals at different developmental stages and other tissues using various algorithms, such as geNorm, Normfinder, Bestkeeper, and Delta CT. The results revealed that the optimal combination of reference genes in the Lilium henryi Baker petals at different developmental stages was osa-miR166m and osa-miR166a-3p, while that in the different tissues of Lilium henryi Baker was osa-miR166g-3p and osa-miR166a-3p.Four important genes related to growth and development regulation, namely, osa-miR156a, osa-miR395b, osa-miR396a-3p, and osa-miR396a-5p, were selected for validation. The findings of the present study would contribute to future investigations on the miRNA expression and the related functions in Lilium henryi Baker while providing important references for the normalization of the miRNA expression in other varieties of lily.

Biological sciences/Biological techniques/Gene expression analysis

Biological sciences/Molecular biology/Non coding rnas/Mirnas

Lilium henryi Baker

Reference genes

miRNA

qRT-PCR

The present study aimed to identify the appropriate reference genes for normalization of miRNA expression in Lilium henryi Baker. Dynamic miRNA detection using the qRT-PCR technique is common, although the latter requires appropriate reference genes to ensure data reliability. Previous studies have screened plant internal reference genes under conditions such as embryonic development and stress treatment, involving relatively few tissues and organs. There is limited research on the optimal miRNA reference genes in lilies under normal growth conditions, while there is no relevant miRNA study in Lilium henryi Baker. Therefore, this study screened and validated internal reference genes in various flower development stages and tissue parts of Lilium henryi Baker. under normal growth conditions, filling the gap in previous research. And more precise validation was conducted on the selected internal reference genes in the petals, avoiding interference from specific parts on the results of selecting the best internal reference genes. Twelve genes were selected as candidate reference genes, and their expression stability was analyzed in petals at different developmental stages and also in different tissues of Lilium henryi Baker using various algorithms, such as geNorm, Normfinder, Bestkeeper, and Delta CT. The analyses and validation process revealed that the optimal combination of reference genes in the Lilium henryi Baker petals at different developmental stages was osa-miR166m and osa-miR166a-3p, while that in the different tissues of Lilium henryi Baker was osa-miR166g-3p and osa-miR166a-3p.Four important genes related to growth and development regulation, namely, osa-miR156a, osa-miR395b, osa-miR396a-3p, and osa-miR396a-5p, were selected for validation. The findings of the present study would contribute to future investigations on the miRNA expression and the related functions in Lilium henryi Baker while providing important references for the normalization of the miRNA expression in other varieties of lily.

Lilies (Lilium spp.) are considered among the most important floral crops worldwide^[^][^]. Lilies are recognized for their diverse flower colors and forms and are, therefore, used widely in garden beautification and cut flower markets^[^][^][^]. The growth and development of lilies involve a series of biochemical processes in which miRNAs (microRNAs) play important roles, for instance, in cell proliferation, cell differentiation, growth, development, and response to external environmental stimuli^[^][^][^]. Plant miRNAs were identified in Arabidopsis and rice in 2002^[^], and since then, hundreds of similar small RNA molecules have been identified in several model organisms and cells, which are now collectively referred to as miRNAs. The above studies have revealed the complexity of gene regulatory networks in plants, due to which miRNAs have become a research hotspot in recent years.

An unstable expression of a reference gene could lead to biased outcomes^[^]. Among the various detection methods available, qRT-PCR is the preferred method for gene detection owing to its high sensitivity, strong specificity, and convenient operation^[^][^][^]. Currently, qRT-PCR based on stem-loop and poly(A) methods, which use primers designed specifically for the purpose, is commonly used for miRNA detection. The stem-loop method^[^] offers greater specificity and sensitivity compared to the poly(A) method^[^][^][^]. The selection of the miRNA-related reference genes varies among different cultivars, and lilies encompass multiple varieties. For instance, in a study on Lilium pumilum DC. Fisch. somatic embryos, the reference genes selected were lpu-miR159a and the F-box family protein (FP)^[^]. In Lilium × formolongi, 5S RNA and EF were selected as reference genes^[^]. In the OT (Oriental × Trumpet) hybrid ‘Robina’, U4 was reported as the reference gene^[^]. In the bicolor cultivars of Asiatic hybrid lily, namely, Lollypop, Cancún, Vermeer, Sugar Love, and Enjoys, as well as in three full-color cultivars of the species, namely, Côte d’Azur, Vivaldi, and Montreux, U6 was identified as the reference gene^[^]. In Lilium leichtlinii var. maximowiczii, 18S rRNA was reported as the reference gene^[^]. Lilium henryi Baker is a species endemic to China, where it is located primarily in regions such as Hubei and Guizhou. The species has characteristic orange flowers, which confer it a high ornamental value. The bulbs of Lilium henryi Baker are used for human consumption and also in traditional medicine^[^]. The species exhibits strong adaptability^[^] and excellent overall resistance. It is the only wild species in the Lilium genus with a vining growth habit, owing to which it is considered an important breeding material in horticulture. The species is, however, listed in the IUCN Red List of Threatened Species (http://www.iplant.cn/rep/). Owing to the above reasons, a detailed investigation of Lilium henryi Baker is of paramount importance. In the same context, the selection of miRNA reference genes and the establishment of a qRT-PCR detection system for Lilium henryi Baker are imperative.

Our research group pioneered the miRNA omics studies related to flower color traits in Lilium henryi Baker (yet to be published). In a previous study by our research group, small RNA sequencing of Lilium henryi Baker was conducted, which revealed numerous miRNA sequences. Among those sequences, ten miRNAs with relatively stable expression were screened out and used as candidate reference genes. In addition, two commonly used reference genes were also selected. The stability of the candidate reference genes was analyzed using different software tools, such as geNorm^[^], Normfinder^[^], and Bestkeeper^[^]. The objective was to select suitable miRNA reference genes for different growth and development stages and various tissues to provide appropriate internal reference choices for the accurate quantification of the miRNA gene expression levels during the growth and development of Lilium henryi Baker.

Experimental materials

Lilium henryi Baker was used as the experimental material in the present study (Fig. 1). The plants of this species were cultivated in a greenhouse at the Beijing Academy of Agriculture and Forestry Sciences. Samples were collected at different stages of flower development (S1: green bud stage, S2: bud stage, S3: coloring stage, S4: early blooming stage, and S5: full blooming stage) and also from the various tissues (petals at the full blooming stage, stem-root, stem, and leaves). Each group of samples had three biological replicates. After collection, the samples were rapidly frozen in liquid nitrogen and stored at − 80°C until use.

Experimental methods

Extraction and reverse transcription of the miRNA

The required miRNAs (from the petals of Lilium henryi Baker at the five stages of development and also from the stem-root, stem, and leaf tissues of the species) were extracted using the miRcute miRNA Isolation Kit (Tiangen Biotech Co.). The integrity of the extracted mRNA was assessed using agarose gel electrophoresis, and the purity and concentration of the mRNA were determined using NanoDrop 2000. After the quality control analysis, the mRNAs were reverse transcribed using the miRNA 1st Strand cDNA Synthesis Kit (using the stem-loop method) from Nanjing Vazyme Biotech Co. Ltd., following the manufacturer’s instructions. This first-strand cDNA synthesis was performed in a reaction volume of 20 µL, which contained 0.5 µg of the miRNA to be reverse transcribed in an RNase-free centrifuge tube. In this process, the genomic DNA was first removed from the mRNA sample by heating at 42°C for 2 min. Afterward, the first-strand cDNA synthesis reaction was conducted using the following temperature program: 25°C for 5 min, then 50°C for 15 min, and finally, 85°C for 5 min.

Screening of the candidate reference genes and primer designing

Using our research group’s published small RNA sequencing data for Lilium henryi Baker (PRJNA1014586), ten miRNAs with relatively stable expression were selected as candidate reference genes. In addition, commonly used reference genes for plant miRNA qPCR were also selected, along with four miRNAs for validation. The primer sequences of all of the above are provided in Table 1. These sequences were synthesized at Beijing Tsingke Biotech Co. Ltd.

Table 1

Primer information for the 12 candidate reference genes and 4 validation genes.
Gene symbol	Gene name	Primer sequence(5'-3')	Length(nt)
U6	Small nuclear RNA	F:CGGGGACATCCGATAAAATTGGAACG	26
U6	Small nuclear RNA	R:CGATTTGTGCGTGTCATCCTTGC	23
18S	18S rRNA	F:CCTGAGAAACGGCTACCACAT	21
18S	18S rRNA	R:CACCAGACTTGCCCTCCA	18
novel_1	microRNA	F:GCGTTCCACGGCTTTCTT	18
novel_1	microRNA	R:GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCAGTTC	50
novel_20	microRNA	F:CGCGTTTTCTGTCCGGTCTT	20
novel_20	microRNA	R:GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAGTAGA	50
novel_69	microRNA	F:GCGTTTTTGGGCCAACTG	18
novel_69	microRNA	R:GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACACAT	50
novel_77	microRNA	F:CGCGTTTGGATTGAAGGGA	19
novel_77	microRNA	R:GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTAGAGC	50
osa-miR159f	microRNA	F:GCGCTTGGATTGAAGGGA	18
osa-miR159f	microRNA	R:GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTAGAGC	50
osa-miR160a-5p	microRNA	F:CGTGCCTGGCTCCCTGT	17
osa-miR160a-5p	microRNA	R:GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTGGCAT	50
osa-miR166a-3p	microRNA	F:GCGTCGGACCAGGCTTCA	18
osa-miR166a-3p	microRNA	R:GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGGGGAA	50
osa-miR166g-3p	microRNA	F:GCGTCGGACCAGGCTTCA	18
osa-miR166g-3p	microRNA	R:GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGAGGAA	50
osa-miR166m	microRNA	F:GCGTCGGACCAGGCTTCA	18
osa-miR166m	microRNA	R:GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAGGGAA	50
osa-miR167d-5p	microRNA	F:GCGTGAAGCTGCCAGCAT	18
osa-miR167d-5p	microRNA	R:GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCAGATC	50
Target genes
osa-miR156a	microRNA	F:CGCGCGTGACAGAAGAGAGT	20
osa-miR156a	microRNA	R:GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGTGCTC	50
osa-miR395b	microRNA	F:GCGGTGAAGTGTTTGGGG	18
osa-miR395b	microRNA	R:GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGAGTTC	50
osa-miR396a-3p	microRNA	F:GCGCGGTTCAATAAAGCTG	19
osa-miR396a-3p	microRNA	R:GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTTCCCA	50
osa-miR396a-5p	microRNA	F:CGCGTTCCACAGCTTTCTT	19
osa-miR396a-5p	microRNA	R:GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCAGTTC	50

The qRT-PCR analysis of the candidate reference genes

A 50 µL reaction system, which contained 5 µL of the cDNA template, 2 µL each (10 µM) of forward and reverse primers, 25 µL of the 2x miRNA Universal SYBR qPCR Master Mix, and 16 µL of ddH₂O, was prepared according to the instructions of Vazyme’s miRNA Universal SYBR qPCR Master Mix kit. Each reaction was performed in triplicate. The PCR was conducted using the following program: initial denaturation at 95°C for 5 min, followed by 40 cycles of denaturation at 95°C for 10 s, followed by annealing at 60°C for 30 s, and a final extension step at 72°C for 15 s. A melting curve analysis was conducted using the following temperature program: 95°C for 15 s, 60°C for 60 s, and 95°C for 15 s. Each reaction system was run in triplicate.

The amplification efficiency of the primers was determined by generating a standard curve using a five-fold dilution series of the cDNA template in water (v:v) – 1:4, 1:24, 1:124, 1:624, and 1:3124. After each dilution, qRT-PCR was performed for each primer pair to obtain the Cq values and generate the standard curve. The amplification efficiency (E) and the R² value were calculated, and the correction equation was determined to be: E = (5–1^/slope – 1) × 100% (Dong et al. 2022; Tong et al. 2009).

Data processing and analysis

The obtained result data were processed and analyzed using geNorm, Normfinder, and BestKeeper software programs, the Delta CT method^[^], and the RefFinder online tool^[^]. These algorithms were utilized to analyze the expression stability of the candidate reference genes during the five different stages of petal growth and development and in the various tissues of the species, including petals at the full blooming stage, stem-root, stem, and leaves.

Analysis of the specificity and amplification efficiency of primers

A qRT-PCR analysis was performed using the first-strand cDNA synthesized from the petal, stem-root, stem, and leaf samples collected at the five different stages of growth and development. The resulting melting curves of all 12 candidate reference genes and those of the 4 validation genes presented a single distinct peak (Fig. 2), indicating the specificity of the primers. The replicates of each sample exhibited good consistency, further confirming the specificity of the primers. The amplification efficiency of each primer was determined based on the standard curves (Table 2). All primers exhibited good specificity and amplification efficiency and met the experimental standards for qRT-PCR. Therefore, these primers were used in the subsequent experiments.

Table 2

Description of the amplicon characteristics for each candidate reference gene.
Gene symbol	PCR Efficiency (E%)	Regression coefficient (R²)
U6	1.187	0.882
18S	1.149	0.913
novel_1	0.946	0.991
novel_20	1.196	0.892
novel_69	1.723	0.912
novel_77	1.124	0.979
osa-miR159f	1.207	0.882
osa-miR160a-5p	0.984	0.987
osa-miR166a-3p	1.075	0.994
osa-miR166g-3p	1.041	0.993
osa-miR166 m	0.965	0.994
osa-miR167d-5p	1.143	0.981
osa-miR156a	1.223	0.964
osa-miR395b	1.162	0.978
osa-miR396a-3p	1.051	0.988
osa-miR396a-5p	1.184	0.992

Expression abundance of the candidate reference genes

The Cq values of the 12 candidate reference genes in different flowering stages and various tissues of Lilium henryi Baker were summarized to evaluate the stability of their expression abundance at the transcriptional level (Fig. 2). Specifically, 18S in the petals of Lilium henryi Baker at different developmental stages presented the lowest Cq value of 3.27, while novel_20 presented the highest Cq value of 31.73 (Fig. 3a). In the different tissues of Lilium henryi Baker, the lowest Cq value of 2.87 was again obtained for 18S, while novel_69 presented the highest Cq value of 36.34 (Fig. 3b).

Stability analysis of the candidate reference genes

The geNorm analysis

The geNorm software calculates the pairwise variation and the average expression stability value (M value) among all candidate genes. In each iteration, the gene with the highest M value is excluded until the most stable gene combination is obtained.The results of the geNorm analysis revealed osa-miR166a-3p and osa-miR166m as the most stable miRNA reference genes in the petals at different developmental stages of Lilium henryi Baker as well as in the different tissues of Lilium henryi Baker (Fig. 4).

In the petals at different developmental stages in Lilium henryi Baker, all having M-values significantly lower than 1.5, indicating relatively stable expression levels. The three most stable miRNA internal references were osa-miR166a-3p, osa-miR166m, and novel_69 (Fig. 4a). In the different tissues of Lilium henryi Baker, the stability of the candidate miRNA internal reference gene expression indicating relatively stable expression levels. The three most stable miRNA internal references were osa-miR166a-3p, osa-miR166m, and osa-miR166g-3p. However, the expression stability of U6 and 18S was the lowest among the 12 genes (Fig. 4b).

Paolacci et al. suggested using multiple internal reference genes for data correction and thereby obtaining accurate results^[^]. Therefore, it is considered necessary to combine pairwise variation to predict the optimal number of internal reference genes by calculating the value of Vn/n + 1. Accordingly, when Vn/Vn + 1 < 0.15, the optimal number of reference genes is n. When Vn/Vn + 1 > 0.15, the optimal number of reference genes is n + 1^[^]. In the present study, all obtained Vn/Vn + 1 values were below 0.15 (Fig. 5), based on which 2 was the optimal number of internal reference genes for this experiment. Accordingly, by considering both M and V values, the suitable internal reference genes for the petals at the different developmental stages of Lilium henryi Baker and also for the various tissues of the species were osa-miR166a-3p and osa-miR166m.

NormFinder analysis

NormFinder ranks the stability of the genes based on their expression stability values, with smaller stability values indicating a further stable gene expression^[44] .The results of the NormFinder analysis revealed that in the petals at the different developmental stages of Lilium henryi Baker(Fig. 6a). The most stable miRNA reference gene with a stability value of 0.1 was osa-miR166m, and osa-miR166a-3p was also relatively stable with a stability value of 0.14. The least stable reference genes, according to this analysis, were U6 and osa-miR159f. In the different tissues of Lilium henryi Baker,(Fig. 6b). The most stable miRNA reference gene with a stability value of 0.13 was osa-miR166g-3p, and osa-miR166m was also relatively stable with a stability value of 0.2. The highest expression stability values were obtained for U6 and novel_69, indicating that their expression stability was the poorest among all candidate genes and, therefore, these genes were not suitable for use as reference genes.

BestKeeper analysis

BestKeeper software primarily evaluates the stability of candidate reference genes by comparing the standard deviation (SD) and the coefficient of variation (CV) of their CT values. Smaller CV and SD values indicate greater stability of the candidate reference gene and their suitability as an internal reference.

In general, an SD value of less than 1 is considered indicative of a stable gene expression. The BestKeeper analysis results for the petals at different developmental stages revealed 7 genes with SD < 1, while 5 genes had an SD above 1.The 3 most stable miRNAs were osa-miR166a-3p, osa-miR166 m, and novel_1, with osa-miR166a-3p presenting the smallest standard deviation and coefficient of variation values, which indicated that it was the most stable internal reference gene. U6 exhibited the lowest stability, with the largest standard deviation and coefficient of variation values (Fig. 7a). The BestKeeper analysis results for various tissues revealed 7 genes with SD < 1,The smallest SD value of 0.26 was obtained for 18S. Only 5 genes had an SD value above 1. The stability of the miRNA reference gene expression followed the order 18S > novel_20 > osa-miR167d-5p > osa-miR166g-3p > osa-miR160a-5p > osa-miR166m > osa-miR166a-3p > osa-miR159f > novel_1 > novel_77 > novel_69 > U6. The smallest sum of standard deviation and coefficient of variation values was obtained for novel_20, while U6 exhibited the lowest stability (Fig. 7b).

Delta CT analysis

Delta CT method selects the optimal candidate internal reference gene based on the mean standard deviation (mean SD) value^[45]. A lower mean SD value obtained for an internal reference gene indicates a higher expression stability

The Delta CT analysis conducted for the petals at different developmental stages. The mean SD values of osa-miR166a-3p, osa-miR166 m, and novel_1 were relatively small, indicating their good expression stability across all samples. The most stable internal reference gene was osa-miR166a-3p, while U6 presented the largest mean SD value, indicating that U6 has the poorest stability (Fig. 8a). In the different tissues of Lilium henryi Baker, with 18S, novel_20, and osa-miR167d-5p presenting relatively small mean SD values, indicating their good expression stability across all samples. U6 presented the largest mean SD value, indicating that it had the poorest stability (Fig. 8b).

RefFinder analysis

According to the ranks assigned to the genes based on each of the four programs, RefFinder assigns an appropriate weight to each gene and calculates the geometric mean of these weights. A resultant lower value indicates higher stability of the candidate internal reference gene under given experimental conditions. Figure 9 depicts the Venn diagram of the 5 most stable internal reference genes identified based on the geNorm, NormFinder, BestKeeper, and Delta CT analyses.

The results of the comprehensive analysis conducted using RefFinder revealed that in petals at different developmental stages of Lilium henryi Baker (Fig. 10a). According to the results of the analysis based on the five evaluation methods, osa-miR166m, and osa-miR166a-3p exhibited relatively stable expressions, with the corresponding stability values of 1.19 and 1.41, respectively. U6 exhibited the least stable expression. According to these results of the geNorm analysis, the optimal number of internal reference genes to be introduced in the experiment was 2. which were osa-miR166m and osa-miR166a-3p. In the different tissues of Lilium henryi Baker (Fig. 10b). According to the results of the analysis based on the five evaluation methods, osa-miR166g-3p and osa-miR166a-3p exhibited relatively stable expressions, with the corresponding stability values of 1.41 and 2.74, respectively. U6 exhibited the least stable expression. According to the results of geNorm analysis, the optimal number of internal reference genes to be introduced in the experiment was again 2 which were osa-miR166g-3p and osa-miR166a-3p. According to all the algorithms used in the present study, in Lilium henryi Baker, the miR166 family members, including osa-miR166a-3p, osa-miR166g-3p, and osa-miR166m, consistently ranked high in stability. Therefore, it was inferred that the miR166 family genes would serve as suitable candidates for use as internal reference genes in both petals at the different developmental stages of Lilium henryi Baker and the different tissues of the species.

Validation of genes

According to previous studies, miR156 plays an important role in regulating flowering time, lateral root development, and Anthocyanidin synthesis^[^][^][^]. miR396 is also widely involved in the growth and development regulation of plant petals, leaves, and other parts^[^][^].Therefore, the expression levels of miR156 and miR396 were verified. In the petals at the different developmental stages of the species, when using the most stable reference genes, osa-miR166m and osa-miR166a-3p, the expression pattern of the target gene osa-miR156a remained consistent (Fig. 11a). This gene exhibited the lowest expression level during the green bud stage, reached its maximum expression level during the coloring stage as the petals developed, then again exhibited a decreased expression level during the initial opening stage, and finally, a slight increase. However, in the case of the least stable reference gene, U6, the expression level of osa-miR156a was quite low during the coloring, initial opening, and full bloom stages.

Similarly, the expression pattern of the target gene osa-miR396a-3p remained consistent (Fig. 11b) in the different developmental stages of petals, with slight decreases during the bud stage, increases during the coloring stage, sharp decreases during the initial opening stage, and maximum expression level during the full bloom stage. However, when using U6, the least stable one, as the reference gene, the expression pattern of osa-miR396a-3p varied and was opposite to that observed when using osa-miR166m and osa-miR166a-3p as reference genes. The expression pattern of the target gene osa-miR396a-5p remained consistent (Fig. 11c) in the different developmental stages of petals, with the maximum expression level reached during the full bloom stage. Therefore, it is believed that osa-miR156a and osa-miR396a may have a certain regulatory effect on the growth and development of petals, especially during the blooming stage.

Due to the gradual formation of spots in the lower part of the petals during their development, and the main component of the spots being anthocyanins, some studies suggest that osa-miR395b is a key gene related to anthocyanin synthesis^[^]. Therefore, it is necessary to use osa-miR166m and osa-miR166a-3p as reference genes during the five stages of petal development to detect the expression of osa-miR395b in the lower and upper parts of the petals, in order to further verify the reliability of osa-miR166m and osa-miR166a-3p as internal reference genes. It was found that the expression trend of osa-miR395b was consistent when osa-miR166m and osa-miR166a-3p were used as internal reference genes. The expression level of osa-miR395b was extremely low in the lower part of the bud stage of the petals (Fig. 11d), and then significantly increased in the coloring stage. However, in the upper part of the petals (Fig. 11e), the expression level of osa-miR395b gradually increased in the green bud stage, bud stage, coloring stage, and early blooming stage, while the expression level was extremely low in the full blooming stage. This further proves the accuracy of osa-miR166m and osa-miR166a-3p as internal reference genes, whether in the entire petal or at different parts of the petal.

In the different tissues, when using the most stable reference genes osa-miR166g-3p and osa-miR166a-3p, the expression pattern of the target gene osa-miR156a remained consistent (Fig. 11f), with the lowest expression level in the petals observed during the full bloom stage and the highest expression level observed in the stem. Therefore, it is believed that osa-miR156a may be involved in the regulation process of stem growth.However, when using the least stable reference gene U6, the expression pattern was different, with the highest expression level observed in the stem and the lowest expression level observed in the petals on full blooming stage. Similarly, the expression pattern of the target gene osa-miR396a-3p (Fig. 11g) in the petals and the stem is consistent, with relatively higher expression levels observed, while lower expression levels of this gene were observed in the stem and leaves. However, when using the least stable reference gene U6, the expression level of osa-miR396a-3p was extremely high in the stem. The expression pattern of the target gene osa-miR396a-5p (Fig. 11h) also remained consistent, with the highest expression level observed in the stem, while relatively lower expression levels were observed in the stem, leaves, and petals at the full bloom stage. Therefore, it is believed that osa-miR396a-3p and osa-miR396a-5p may be involved in the growth and development process of stem rooting. However, when using the least stable reference gene U6, significant differences in the expression of osa-miR396a-5p were observed among different tissues, with the expression level in the stem approaching 0.

The application of qRT-PCR for the quantitative analysis of the expression profiles of key genes is a fundamental and widely employed strategy to decipher the mechanisms of plant growth and development. The selection of reference genes, particularly the internal control genes, has a crucial influence on the accuracy of gene expression profiles^[^][^]. The screening and validation of miRNA reference genes are reported for several plants, including Brassica napus^[^], grapevine (Vitis vinifera L.cv. Muscat Hamburg)^[^], and rice (Oryza sativa)^[^]. In poplar, U6 was identified as the most suitable reference gene for miRNA qRT-PCR experiments^[^]. In sugarcane buds, miR171 and 18S rRNA were revealed as the most suitable reference genes for individual use^[^]. In Chinese cedar (Cryptomeria fortunei), the most stable reference genes for miRNA expression were identified to be novel16, cln-miR6725, novel1, and U6^[^].

The expression levels of reference genes vary significantly among different plant varieties, tissues, organs, or physiological states. For instance, in a study by Yu et al., the reference gene used in the salt stress response experiment in the soybean variety ‘Williams 82’ was gma-miR1520d^[^]. However, Liu et al. suggested that in Soybean seeds (‘Williams 82’) under different abiotic stress conditions, the most suitable combination of reference miRNAs was miR166a and miR167d in the leaf samples and miR171a and miR156a or miR167a and miR171a in the root samples^[^].

However, information on such suitable reference genes in lilies is limited. In Lilium, only 5S, U4, U6, and 18S genes have been identified as potential reference genes. Therefore, it was considered necessary to conduct a study on the screening of miRNA reference genes in Lilium henryi Baker. In this context, the present study was conducted to determine the suitable reference genes in Lilium henryi Baker. A total of 12 candidate genes were selected, and their performance was evaluated in different samples (flower petals at different development stages, stems, stem-roots, and leaves) of Lilium henryi Baker. Four commonly used algorithms (geNorm, Normfinder, Bestkeeper, and Delta CT) were applied to analyze the expression stability of these 12 candidate reference genes in the petals at different developmental stages and also in the various tissues of the species. The objective was to evaluate and determine the stable reference genes. While the top five genes selected based on the results of different algorithms were similar in general, slight differences were observed in their stability levels, which were attributable to the different calculation methods employed by each software. However, despite these differences, the results obtained using these different algorithms were significantly consistent in terms of the selected best reference genes. In the Normfinder analysis, osa-miR166m presented a stability value of 0.1, and osa-miR166a-3p presented a stability value of 0.14, indicating that osa-miR166m and osa-miR166a-3p exhibited the best stability (Fig. 6a). In order to further analyze the results obtained using the four algorithms, an online analysis tool referred to as RefFinder was used. The results obtained using geNorm, Normfinder, Bestkeeper, and Delta CT methods were consistent with the results obtained using RefFinder, indicating the accuracy of the software analysis. In the case of different tissues, the results obtained using geNorm and Normfinder were consistent in general, while those obtained using Bestkeeper and Delta CT presented certain differences. Similar findings were reported in previous studies and, therefore, these differences are acceptable from a comprehensive perspective^[^][^][^].

Further analysis using RefFinder revealed consistent results with those of geNorm and Normfinder analyses. The best combination of reference genes was determined based on the comprehensive analysis conducted using RefFinder. The results indicated that suitable reference genes should be selected for different experimental samples, as not all commonly used reference genes are applicable to different tissue samples or experimental conditions. This finding was similar to that reported for Euscaphis konishii Hayata^[^]. In order to further validate the accuracy of the selected reference genes, osa-miR156a, osa-miR396a-3p, and osa-miR396a-5p were selected as validation genes, owing to their important regulatory roles in plant growth and development. At the same time, considering that during the development of lily petals, spots gradually form in the lower tissue. To investigate whether the selected internal reference genes are suitable for miRNA transcription level analysis involved in petal spot formation, the expression level of the gene osa-miR395b related to anthocyanin synthesis was detected. The results confirmed the accuracy of the screened reference genes once again, indicating that the optimal internal reference genes osa-miR166m and osa-miR166a-3p can be used for analyzing miRNA transcription levels in different tissue parts of petals at different developmental stages.

Previous studies have demonstrated that U6 is highly conserved across different plant species, implying that its sequence is relatively stable among different plants. Consequently, the small nuclear RNA of U6 is used widely as an internal reference gene for miRNA studies on various plants, including the tea plant^[^], rice^[^], and tomato^[^]. It is, however, noteworthy that, while U6 is commonly used as a reference gene in several plant species, differences in the plant genomic structures and regulatory mechanisms may lead to variations in the expression of U6 under certain conditions. For instance, in Lilium species (Lilium pumilum DC. Fisch. and Lilium davidii var. unicolor)^[^], U6 reportedly exhibited relatively lower stability ranks, while in sweet potato (Ipomoea batatas. L.)^[^], U6 expression was relatively unstable. The present study revealed that the commonly used reference gene U6 exhibited unstable expression during the growth and development process of Lilium henryi Baker. Certain miRNAs from the miR166 family, on the other hand, exhibited relatively stable expressions and were more suitable as reference genes. When miR166 is used as a reference gene, it typically includes the members of its subfamily, such as miR166a, miR166b, miR166c, and miR166m. The miR166 family is a group of similar miRNAs that share the same miRNA precursor sequence or have highly conserved mature miRNA sequences. These subfamily members frequently exhibit similar expression patterns and functions. Therefore, when selecting reference genes, the entire miR166 family or its multiple subfamilies may be considered for detection. This approach would allow for a further comprehensive and accurate assessment of the expression levels of the miR166 family used as reference genes. Similarly, in tamarillo (Solanum betaceum) callus tissue samples, miR166a was reportedly the most stable miRNA^[^].

Previous studies have screened plant internal reference genes under conditions such as embryonic development and stress treatment, involving relatively few tissues and organs. There is limited research on the optimal miRNA reference genes in lilies under normal growth conditions, while there is no relevant miRNA study in Lilium henryi Baker. Therefore, this study screened and validated internal reference genes in various flower development stages and tissue parts of Lilium henryi Baker. under normal growth conditions, filling the gap in previous research. And more precise validation was conducted on the selected internal reference genes in the petals, avoiding interference from specific parts on the results of selecting the best internal reference genes. Therefore,The present study provided important references for studying the miRNAs active during the growth and development processes of lilies and offered a strategy and method for screening the miRNA reference genes in other plants. However, further research is warranted to validate and optimize the results obtained in the present study. Future studies could consider expanding the sample size and including samples from different developmental stages to further validate the stability and applicability of the miR166 family. Further investigations based on reference gene screening could reveal the differential expression and functions of miRNAs during the growth and development of lilies, providing a solid foundation and theoretical support for unraveling the mechanisms underlying the formation of important traits and the process of molecular breeding in lilies.

Acknowledgments: Not applicable.

Author Contributions : All authors contributed to the study conception and design. Material preparation was performed by G.J, S.Y. and Y.D. Data collection and analysis were performed by G.J. and M.Z. The first draft of the manuscript was written by J.G. and M.Z. The reviewing and editing were performed by X.Z, M.W. and C.Z. The funding acquisition was performed by M.Z. All authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.

Funding: This research was funded by the China National Natural Science Foundation Projects for Youth (grant number 32201606), Key research and development projects of the National Forestry and Grassland Administration (grant number GLM [2021] No. 72), Special projects for capacity building in scientific and technological innovation of the Beijing Academy of Agriculture and Forestry (grant number KJCX20230106),Beijing Innovation Consortium of Agriculture Research Sysem (grant number BAIC09-2023).

Data Availability: The datasets generated during and/or analysed during the current study are available from the corresponding author on reasonable request.

Additional information:

The plant materials have been uploaded to Public Herbarium, Chinese Virtual Herbarium, with ID number 15052034. And the plant material identification is Ge Jin. Plants are collected on private land and have obtained permission from the landowner. The materials involved in this study are the propagation of plant explants, and their cultivation and preservation in greenhouses do not affect their survival. The relevant research conducted not only did not directly or indirectly harm the survival of threatened species, but also preserved and expanded the germplasm resources of the species, and the materials used were not obtained from museums or other institutions; The number of specimens collected shall not exceed the required research data; All experiments comply with relevant institutions, national and international standards and regulations. Our research aims to improve the conservation status of the studied species.

Competing Interests: The authors have no relevant financial or non-financial interests to disclose.

Alappat, B. & Alappat, J. Anthocyanin Pigments: Beyond Aesthetics. MOLECULES. 25, (2020).
Yamagishi, M. How Genes Paint Lily Flowers: Regulation of Colouration and Pigmentation Patterning. SCI HORTIC-AMSTERDAM. 163, 27-36 (2013).
Al-Ajlouni, M. G., Othman, Y. A., A'Saf, T. S. & Ayad, J. Y. Lilium Morphology, Physiology, Anatomy and Postharvest Flower Quality in Response to Plant Growth Regulators. S AFR J BOT. 156, 43-53 (2023).
Bakhshaie, M., Khosravi, S., Azadi, P., Bagheri, H. & van Tuyl, J. M. Biotechnological Advances in Lilium. PLANT CELL REP. 35, 1799-1826 (2016).
Wang, Z., Li, X., Chen, M. M., Yang, L. Y. & Zhang, Y. C. Molecular and Metabolic Insights Into Anthocyanin Biosynthesis for Spot Formation On Lilium Leichtlinii Var. Maximowiczii Flower Petals. INTERNATIONAL JOURNAL OF MOLECULAR SCIENCES. 24, (2023).
Bajczyk, M. et al. Recent Insights Into Plant Mirna Biogenesis: Multiple Layers of Mirna Level Regulation. PLANTS-BASEL. 12, (2023).
Wang, J. W., Czech, B. & Weigel, D. Mir156-Regulated Spl Transcription Factors Define an Endogenous Flowering Pathway in Arabidopsis Thaliana. CELL. 138, 738-749 (2009).
Willmann, M. R. & Poethig, R. S. Conservation and Evolution of Mirna Regulatory Programs in Plant Development. CURR OPIN PLANT BIOL. 10, 503-511 (2007).
Reinhart, B. J., Weinstein, E. G., Rhoades, M. W., Bartel, B. & Bartel, D. P. Micrornas in Plants. GENE DEV. 16, 1616-1626 (2002).
Liang, W. X. et al. Selection and Evaluation of Reference Genes for Qrt-Pcr Analysis in Euscaphis Konishii Hayata Based On Transcriptome Data. PLANT METHODS. 14, (2018).
Gachon, C., Mingam, A. & Charrier, B. Real-Time Pcr: What Relevance to Plant Studies? J EXP BOT. 55, 1445-1454 (2004).
Kou, S. et al. Selection and Validation of Suitable Reference Genes for Mirna Expression Normalization by Quantitative Rt-Pcr in Citrus Somatic Embryogenic and Adult Tissues. PLANT CELL REP. 31, 2151-2163 (2012).
Kozera, B. & Rapacz, M. Reference Genes in Real-Time Pcr. J APPL GENET. 54, 391-406 (2013).
Chen, C. F. et al. Real-Time Quantification of Micrornas by Stem-Loop Rt-Pcr. NUCLEIC ACIDS RES. 33, (2005).
Shi, R. & Chiang, V. L. Facile Means for Quantifying Microrna Expression by Real-Time Pcr. BIOTECHNIQUES. 39, 519-525 (2005).
Yang, Y. et al. Selection of Reference Genes for Normalization of Microrna Expression by Rt-Qpcr in Sugarcane Buds Under Cold Stress. FRONT PLANT SCI. 7, (2016).
Tashiro, R. M., Philips, J. G. & Winefield, C. S. Identification of Suitable Grapevine Reference Genes for Qrt-Pcr Derived From Heterologous Species. MOL GENET GENOMICS. 291, 483-492 (2016).
Zhang, J. et al. Small Rna and Transcriptome Sequencing Reveal a Potential Mirna-Mediated Interaction Network that Functions During Somatic Embryogenesis in Lilium Pumilum Dc. Fisch. FRONT PLANT SCI. 8, (2017).
Zhang, Q., Zhao, Y., Gao, X. & Jia, G. Analysis of Mirna-Mediated Regulation of Flowering Induction in Lilium × Formolongi. BMC PLANT BIOL. 21, (2021).
Chen,Y., Zhao, M., Wang, X., Cui, J., Ge, W., Zhang, K. Key MicroRNAs and Target Genes Involved in Regulating Maturation in Lilium. Ornament Plant Res. 2: 1-14.(2022)
Yamagishi, M. & Sakai, M. The Microrna828/Myb12 Module Mediates Bicolor Pattern Development in Asiatic Hybrid Lily (Lilium Spp.) Flowers. FRONT PLANT SCI. 11, (2020).
Wang, Z., Li, X., Chen, M. M., Yang, L. Y. & Zhang, Y. C. Molecular and Metabolic Insights Into Anthocyanin Biosynthesis for Spot Formation On Lilium Leichtlinii Var. Maximowiczii Flower Petals. INTERNATIONAL JOURNAL OF MOLECULAR SCIENCES. 24, (2023).
Yang, C., Shi, L., Lei, X. Fanjingshan research editorial committee, edited by fanjing mountain medicinal plants editorial committee. Guizhou Science and Technology Press. Guizhou.China. (2016)
Xue, J. King of bulb fresh cut flowers - Lily. Zhongyuan Farmers' Publishing House. Henan, China. (2006)
Hellemans, J., Mortier, G., De Paepe, A., Speleman, F. & Vandesompele, J. Qbase Relative Quantification Framework and Software for Management and Automated Analysis of Real-Time Quantitative Pcr Data. GENOME BIOL. 8, (2007).
Andersen, C. L., Jensen, J. L. & Orntoft, T. F. Normalization of Real-Time Quantitative Reverse Transcription-Pcr Data: A Model-Based Variance Estimation Approach to Identify Genes Suited for Normalization, Applied to Bladder and Colon Cancer Data Sets. CANCER RES. 64, 5245-5250 (2004).
Pfaffl, M. W., Tichopad, A., Prgomet, C. & Neuvians, T. P. Determination of Stable Housekeeping Genes, Differentially Regulated Target Genes and Sample Integrity: Bestkeeper--Excel-Based Tool Using Pair-Wise Correlations. BIOTECHNOL LETT. 26, 509-515 (2004).
Xie, F., Xiao, P., Chen, D., Xu, L. & Zhang, B. Mirdeepfinder: A Mirna Analysis Tool for Deep Sequencing of Plant Small Rnas. PLANT MOL BIOL. 80, 75-84 (2012).
Yao, L. et al. [Selection of Q Rt-Pcr Reference Genes for Amomum Tsaoko Seeds During Dormancy Release].China journal of Chinese materia medica. 46, 3832-3837 (2021).
Paolacci, A. R., Tanzarella, O. A., Porceddu, E. & Ciaffi, M. Identification and Validation of Reference Genes for Quantitative Rt-Pcr Normalization in Wheat. BMC MOL BIOL. 10, (2009).
Vandesompele, J. et al. Accurate Normalization of Real-Time Quantitative Rt-Pcr Data by Geometric Averaging of Multiple Internal Control Genes. GENOME BIOL. 3, RESEARCH34 (2002).
Asgari, M., Mirzaie-asl, A., Abdollahi, M. R. & Khodaei, L. Flowering Time Regulation by the Mirna156 in the Beet (Beta Vulgaris Ssp. Maritima). PLANT CELL TISS ORG. 150, 361-370 (2022).
Yu, N., Niu, Q. W., Ng, K. H. & Chua, N. H. The Role of Mir156/Spls Modules in Arabidopsis Lateral Root Development. PLANT J. 83, 673-685 (2015).
Gou, J., Felippes, F. F., Liu, C., Weigel, D. & Wang, J. Negative Regulation of Anthocyanin Biosynthesis in Arabidopsis by a Mir156-Targeted Spl Transcription Factor. PLANT CELL. 23, 1512-1522 (2011).
Cao, D. Y. et al. Regulations On Growth and Development in Tomato Cotyledon, Flower and Fruit Via Destruction of Mir396 with Short Tandem Target Mimic. PLANT SCI. 247, 1-12 (2016).
Yang, F. X. et al. Organ-Specific Gene Expression Reveals the Role of the Cymbidium Ensifolium-Mir396/Growth-Regulating Factors Module in Flower Development of the Orchid Plant Cymbidium Ensifolium. FRONT PLANT SCI. 12, (2022).
Li, H. S. et al. Effects of Blue Light On Flavonoid Accumulation Linked to the Expression of Mir393, Mir394 and Mir395 in Longan Embryogenic Calli. PLOS ONE. 13, (2018).
Derveaux, S., Vandesompele, J. & Hellemans, J. How to Do Successful Gene Expression Analysis Using Real-Time Pcr. METHODS. 50, 227-230 (2010).
Heid, C. A., Stevens, J., Livak, K. J. & Williams, P. M. Real Time Quantitative Pcr. GENOME RES. 6, 986-994 (1996).
Machado, R. D. et al. Comprehensive Selection of Reference Genes for Quantitative Gene Expression Analysis During Seed Development in Brassica Napus. PLANT CELL REP. 34, 1139-1149 (2015).
Luo, M. et al. Selection of Reference Genes for Mirna Qrt-Pcr Under Abiotic Stress in Grapevine. SCI REP-UK. 8, (2018).
Verstraeten, B., De Smet, L., Kyndt, T. & De Meyer, T. Selection of Mirna Reference Genes for Plant Defence Studies in Rice (Oryza Sativa). PLANTA. 250, 2101-2110 (2019).
Tang, F. et al. Selection and Validation of Reference Genes for Quantitative Expression Analysis of Mirnas and Mrnas in Poplar. PLANT METHODS. 15, (2019).
Yang, Y. et al. Selection of Reference Genes for Normalization of Microrna Expression by Rt-Qpcr in Sugarcane Buds Under Cold Stress. FRONT PLANT SCI. 7, (2016).
Zhang, Y. T. et al. Selection and Optimization of Reference Genes for Microrna Expression Normalization by Qrt-Pcr in Chinese Cedar (Cryptomeria Fortunei) Under Multiple Stresses. INTERNATIONAL JOURNAL OF MOLECULAR SCIENCES. 22, (2021).
Yu, Y. H., Tang, J., Liu, C. & Ni, Z. Y. Microrna4359B Positively Regulates the Soybean Response to Salt Stress by Targeting the F-Box Protein Gmfbx193. ENVIRON EXP BOT. 206, (2023).
Liu, W. C. et al. Normalization for Relative Quantification of Mrna and Microrna in Soybean Exposed to Various Abiotic Stresses. PLOS ONE. 11, (2016).
Barbosa Amorim, L. L. et al. Cowpea and Abiotic Stresses: Identification of Reference Genes for Transcriptional Profiling by Qpcr. PLANT METHODS. 14, (2018).
Hong, S., Seo, P. J., Yang, M., Xiang, F. & Park, C. Exploring Valid Reference Genes for Gene Expression Studies in Brachypodium Distachyon by Real-Time Pcr. BMC PLANT BIOL. 8, (2008).
Wan, H. et al. Selection of Appropriate Reference Genes for Gene Expression Studies by Quantitative Real-Time Polymerase Chain Reaction in Cucumber. ANAL BIOCHEM. 399, 257-261 (2010).
Liang, W. X. et al. Selection and Evaluation of Reference Genes for Qrt-Pcr Analysis in Euscaphis Konishii Hayata Based On Transcriptome Data. PLANT METHODS. 14, (2018).
Song, H. et al. Selection and Verification of Candidate Reference Genes for Mature Microrna Expression by Quantitative Rt-Pcr in the Tea Plant (Camellia Sinensis). GENES-BASEL. 7, (2016).
Ding, Y., Chen, Z. & Zhu, C. Microarray-Based Analysis of Cadmium-Responsive Micrornas in Rice (Oryza Sativa). J EXP BOT. 62, 3563-3573 (2011).
Koul, A. et al. Carotenoid Profiling, in Silico Analysis and Transcript Profiling of Mirnas Targeting Carotenoid Biosynthetic Pathway Genes in Different Developmental Tissues of Tomato. PLANT PHYSIOL BIOCH. 108, 412-421 (2016).
Zhang, J. et al. The Use of Mirnas as Reference Genes for Mirna Expression Normalization During Lilium Somatic Embryogenesis by Real-Time Reverse Transcription Pcr Analysis. PLANT CELL TISS ORG. 129, 105-118 (2017).
Liu, X. Y. et al. Optimization of Reference Genes for Qrt-Pcr Analysis of Microrna Expression Under Abiotic Stress Conditions in Sweetpotato. PLANT PHYSIOL BIOCH. 154, 379-386 (2020).
Cordeiro, D., Rito, M., Borges, F., Canhoto, J. & Correia, S. Selection and Validation of Reference Genes for Qpcr Analysis of Mirnas and their Targets During Somatic Embryogenesis in Tamarillo (Solanum Betaceumcav.). PLANT CELL TISS ORG. 143, 109-120 (2020).

No competing interests reported.

Download PDF

Journal Publication

published 17 Jan, 2024

Read the published version in Scientific Reports →

Editorial decision: Revision requested
04 Dec, 2023
Reviews received at journal
03 Nov, 2023
Reviewers agreed at journal
02 Nov, 2023
Reviews received at journal
25 Oct, 2023
Reviewers agreed at journal
16 Oct, 2023
Reviewers invited by journal
10 Oct, 2023
Editor assigned by journal
10 Oct, 2023
Editor invited by journal
15 Sep, 2023
Submission checks completed at journal
15 Sep, 2023
First submitted to journal
24 Aug, 2023

You are reading this latest preprint version

Screening and validation of optimal miRNA reference genes in different developing stages and tissues of Lilium henryi Baker

Status:

Journal Publication

Version 1

Abstract

Figures

Key Message

Introduction

Materials and Methods

Experimental materials

Experimental methods

Extraction and reverse transcription of the miRNA

Screening of the candidate reference genes and primer designing

The qRT-PCR analysis of the candidate reference genes

Data processing and analysis

Results

Analysis of the specificity and amplification efficiency of primers

Expression abundance of the candidate reference genes

Stability analysis of the candidate reference genes

The geNorm analysis

NormFinder analysis

BestKeeper analysis

Delta CT analysis

RefFinder analysis

Validation of genes

Discussion

Declarations

References

Additional Declarations

Status:

Journal Publication

Version 1