Mice
C57BL/6J mice were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China). NOD-PrkdcscidIL2rγtm1 (NSG) mice were purchased from Shanghai Model Organisms Center, Inc. (Shanghai, China). All mice were maintained under specific pathogen-free conditions. Animal care and use were in accordance with institutional and NIH protocols and guidelines, and all studies were approved by the Animal Care and Use Committee of Shanghai Jiao Tong University. Cell lines and reagents
Lenti-X 293 was purchased from Clontech. A549 cell line was obtained from the American Type Culture Collection. Raji cells were kindly provided by Stem Cell Bank, Chinese Academy of Sciences (Shanghai, China). TF–1 cells were kindly provided by the Cell Resource Center, Peking Union Medical College (Beijing, China). Human NK cells were kindly provided by Shanghai Longyao Biotechnology Co., Ltd. (Shanghai, China). Plasmids encoding SARS-CoV–2 spike and ACE2 were obtained from MolecularCloud (Nanjing, China) and sub-cloned to pCDH-EF (System Biosciences) lentiviral vector plasmid with puromycin resistance marker. To establish SARS-CoV–2 spike or ACE2 expressing cell lines, Lenti-X 293, A549 or Raji were infected with SARS-CoV–2 spike or ACE2- expressing lentivirus. After selection with puromycin, pooled resistant cells were identified by flow cytometry analysis. Cell culture medium were supplemented with 10% heat-inactivated fetal bovine serum, 2 mmol/L L- glutamine, 100 units/mL penicillin, and 100 μg/mL streptomycin. Lenti-X 293, A549 and their derivatives were cultured with complete DMEM medium. Raji and its derivatives were cultured with complete RPMI medium. Human AB serum were purchased from Gemini Bio-products (West Sacramento, CA).
Production of ACE2 and spike fusion protein
For hACE21–740-hFc hACE21–615-hFc, mACE21–740-hFc, S1-mFc and RBD-mFc fusion protein, DNA sequences encoding the indicated protein (supplemental figure 1) were cloned into pCDH-EF vector (System Biosciences, Mountain View, CA). The plasmids containing indicated fusion protein were transfected into Lenti-X 293 cells and supernatants were collected and purified by Diamond Protein A column according to the manufacturer’s protocol (Bestchrom, Shanghai, China).
Neutralization assay with pseudotyped SARS-CoV–2 virus
Lenti-X 293 cells were transfected with lentivirus package component plasmids, Gap/pol (Addgene #12251, RSV-Rev (Addgene #12253), pCDH-EF-IRFP-luc and pcDNA3.1(+)–2019-nCoV-spike-P2A-eGFP (MolecularCloud, #MC_0101087). Supernatants containing lentivirus particles were collected 48 and 72 h post- transfection for direct usage or concentration by ultracentrifugation. Viral titer in TU/mL was determined by flow cytometry analysis of transduced Lenti-X 293-ACE2 cells. In the viral neutralization assay, hACE21–740-hFc and hACE21–615-hFc were serially diluted at indicated concentration in complete DMEM medium. Diluted hACE21–740-hFc and hACE21–615-hFc were incubated with pseudotyped lentiviral particles for 15 minutes at room temperature, inoculated on 293-ACE2 or A549-ACE2 monolayers in 96-well plate in the presence of 10ug/ml of polybrene, and further incubated at 37 °C for 48hours. For infecting A549 -ACE2, a 60-minutes spinning at 2500RPM at 32℃ was used to improve the infection efficiency. IRFP reporter activity was measured on a Cytoflex S (Beckman Coulter). The percentage of infectivity was calculated as ratio of IRFP readout in the presence of fusion protein normalized to IRFP readout in the absence of fusion protein. The half maximal inhibitory concentrations (IC50) were determined using 4-parameter logistic regression (GraphPad Prism version 8).
ELISA and Flow cytometry analysis of hACE21–740-hFc and hACE21–615-hFc
ELISA plates (Jet Biofil, Guangzhou, China) were coated with 2μg/ml of RBD-mFc at 4 °C overnight. Plates were washed three times with PBS c ontaining 0.05% Tween–20 and blocked with 2% fetal bovine serum in PBS at room temperature for 1 hour. Indicated diluted hACE21–740-hFc and hACE21–615-hFc containing samples were added and plates were incubated for 1 hour at room temperature. Plates were washed three times and incubated with alkaline phosphatase (AP)-conjugated goat anti-human Fc secondary antibody (Jackson Immuno. Research) diluted 1:2000 in blocking buffer for 1 hour at room temperature. AP activity was measured at 405 nanometer using p- Nitrophenyl Phosphate (Guangzhou Howei Pharmaceutical Technology Co. Ltd ,Guangzhou, China) by an ELISA plate reader (Molecular Devices).Half-maximum effective concentration (EC50) binding values were calculated by GraphPad Prism (version 8).
293-spike cells were incubated with indicated ACE21–740-hFc and ACE21–615-hFc containing samples at 4 °C for 30 minutes, washed for three times with 2% FBS in PBS, incubated with 1:200 diluted Alexa Fluor 647 conjugated goat anti-human Fc antibodies (Jackson Immuno. Research). Samples were analyzed on a Cytoflex S (Beckman Coulter), and data were analyzed with FlowJo software (TreeStar, Inc.).
Lentivirus production
Lentivirus was produced by transient transfection of Lenti-X 293 with a four plasmid system. Supernatants containing lentivirus particles were collected 48 and 72 h post- transfection and used for establishing stable cell lines.
In vitro ADCC and CDC assay
Raji and Raji-spike cells were labeled with 5 or 50 μM of CFSE, respectively according to manufacturer’s protocol (MedChemExpress, Shanghai, China). Approximately 2x104 CFSE labeled Raji and Raji-spike cells were co-cultured with 4x105 primary NK cells or supplemented with human AB serum in the presence of various concentration of hACE21–740-hFc. Forty-eight hours later, cell were analyzed by flow cytometry. The ratio of CFSEhigh/CFSElow was used to indicate the relative killing to Raji-spike than Raji.
In vivo characterization of hACE21–740-hFc
Pharmacokinetics were determined in C57BL/6 mice after a single injection of 100 μg of ACE21–740-hFc. Serum concentrations at indicated time points were determined by ELISA with immobilized RBD-mFc. C57BL/6 mice received a single injection of 100 μg ACE21–740-hFc. Seven days later, the hematology, body weight, and H&E staining of indicated organ were analyzed. H&E staining was performed by Servicebio (Wuhan, China).
Bio-distribution of MSC-ACE2-Fc
NSG mice were injected with 5–7.5x105 MSC-ACE2-Fc intravenously through retro orbital sinus. Twenty-four hours later, heart, liver, spleen, lung and kidney organs were collected. Genomic DNA was isolated from these organs using an E. Z. N. A.® Tissue DNA Kit I (Omega Bio-tek). The relative distribution of human MSC was quantified by real-time PCR with primers (5’-aagtcataagtcggttgaggggagat–3’ and 5’- ccagattctgcagttttagcatctgtgt–3’) against human IL2RG gene, which was deficient in NSG mice.
TF–1 proliferation assay
TF–1 cells were plated in flat bottomed 96-well plates at 10,000 cells/well in the presence of 1, 10 or 50ng/ml of IL–6 (Sino Biological, Beijing, China). Then 0.1, 1 or 10 μg/ml of scFv-IL6R-Fc or Tocilizumab (Roche) were added to the cell culture. Forty eight hours later, Cell proliferation was measured by CCK–8 assay (Dojindo Molecular Technologies, Shanghai, China) according to manufacturer’s protocol.
Statistical analysis
Data are expressed as means ± standard deviation (SD) or standard error of the mean (SEM). The data were compared using two-tailed unpaired Student’s t-test compared with two groups. Statistically significant differences p<0.05, p<0.01, and p<0.001 are noted with *, **, and *** respectively.