The PI4K2A positively regulates the synthesis of milk fat in cows, promotes the proliferation of bovine mammary epithelial cells, and inhibits their apoptosis

doi:10.21203/rs.3.rs-3299960/v1

Download PDF

Research Article

The PI4K2A positively regulates the synthesis of milk fat in cows, promotes the proliferation of bovine mammary epithelial cells, and inhibits their apoptosis

https://doi.org/10.21203/rs.3.rs-3299960/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background: Milk fat is the most important and energy-rich substance in milk. It is crucial to study the theory and pathways of milk fat synthesis and its regulation in dairy cows for the study of lactation biology. However, the current identification of valuable candidate genes affecting milk fat is limited.

Method: This study uses real-time quantitative PCR (qRT-PCR) technology to perform tissue expression profile analysis on 15 candidate differentially expressed genes related to milk fat metabolism obtained from our previous transcriptome sequencing and weighted gene co-expression network analysis (WGCNA), to determine the key candidate genes affecting milk fat synthesis in dairy cows. Investigate the specific regulatory mechanisms of key candidate genes in cow milk fat metabolism using overexpression (adenovirus) and interference techniques (lentivirus).

Results: The results showed that the expression level of PI4K2A gene in milk gland tissue was significantly higher than that in small intestine, liver, kidney, heart, and ovary (P < 0.05). Compared with other genes, the expression of PI4K2A in mammary gland tissue and bovine mammary epithelial cells (BMECs) was also higher and more stable. Ultimately, we identified PI4K2A as the key candidate gene responsible for regulating milk fat synthesis in dairy cows, and it plays a vital role in the cytoplasm of BMECs. Afterwards, we constructed the adenovirus overexpression vector and lentivirus interference vector for the PI4K2A gene, and combined quantitative real-time PCR (qRT-PCR) and western blot (WB) techniques to detect the effects of overexpressing and interfering with the PI4K2A gene on lipid metabolism in BMEC. The results indicate that the PI4K2A gene plays a positive regulatory role in the fatty acid (FA) transport process involved in milk fat synthesis in cows (P < 0.05). Upon further examination of triglycerides (TAG), cholesterol, and lipid droplet content in BMECs, we found that PI4K2A also has a positive regulatory effect on bovine milk fat synthesis (P < 0.05). The results obtained from EdU and apoptosis kit detection indicated that the PI4K2A gene positively regulated BMECs proliferation (P < 0.05) while negatively regulating their apoptosis process (P < 0.05).

Conclusions: This study offers valuable genetic marker information for precise molecular breeding of milk component traits in dairy cows, with potential implications for mammary gland wound healing and treatment of mammary gland-related diseases.

Holstein cattle

milk fat

PI4K2A gene

proliferation

apoptosis

Milk is the sole source of nutrition for newborn calves, providing essential nutrients for humans, such as protein, sugar and fat[1]. Milk quality is closely related to its main composition, milk fat content (3% to 5%) and composition are important reference elements for milk quality evaluation[2]. Some medium and short-chain saturated fatty acids in milk fat can anti-cancer, anti-viral, anti-bacterial, and inhibit tumor growth, such as C4:0, C8:0, and C10:0[3]. In contrast, polyunsaturated fatty acids like conjugated and non-conjugated linoleic acid contribute to lowering blood lipids, inhibiting immune response, and stimulating lipid metabolism[4]. However, high concentrations of saturated fatty acids, including myristic acid, lauric acid, and palmitic acid, increase low density lipoprotein (LDL) levels in the blood and are associated with cardiovascular diseases[5]. Consequently, milk fat content, quality, and fatty acid composition are of particular importance for human health. The weight of milk fat in the Total Performance Index in the United States (TPI) and the Total Performance Index in China (CPI) are 19% and 25%, respectively, highlighting its significance as an essential economic trait in cow breeding. In conclusion, it is crucial to study the theories and methods of milk fat synthesis and regulation for understanding the lactation biology of dairy cows.

Significant advancements in the biology of bovine lactation were made during the 20th century, including the establishment of the structure-function relationship between the mammary epithelium and the mammary gland, the determination of biochemical pathways of bovine milk synthesis, and the elucidation of the role of hormones in the development and functional regulation of the mammary gland[6]. Notably, the mechanisms of milk fat synthesis, milk droplet formation, and secretion are particularly important[7]. Milk fat synthesis in ruminants involves a complex network of molecular regulation, which includes de novo synthesis of fatty acids (FA), uptake of long-chain fatty acids (LCFA) from the blood, LCFA transport and desaturation, triglyceride (TAG) synthesis, and lipid droplet secretion[8]. Generally, milk fat synthesis can be achieved through a combination of genetic improvement and proper management. However, following the discovery of DNA and advancements in molecular biology technology, it has become evident that manipulating DNA transcription and post-transcriptional regulation is a powerful means of influencing phenotypic outcomes. As next-generation sequencing technologies have become more widespread and sequencing costs have decreased dramatically, breeding researchers have identified numerous effective genes and biomarkers involved in milk fat metabolism. Despite this progress, the identification of valuable candidate genes affecting milk fat synthesis remains limited at present[9]. Considering this, our group previously investigated the genome-wide expression of mRNA transcripts in bovine mammary epithelial cells (BMECs) with high and low milk fat percentages by using comparative transcriptomics[10]. We performed a comprehensive analysis of mRNA expression profile data using the weighted gene co-expression network analysis (WGCNA) and identified 15 candidate differential genes potentially regulating milk fat metabolism (Supplementary Table. 1)[11]. To further pinpoint and validate the most critical genes involved in milk fat synthesis in dairy cows, this study conducted tissue expression profiling of the 15 candidate genes by using quantitative real-time PCR (qRT-PCR). We discovered that the mRNA expression level of the PI4K2A (Full names of genes are shown in Supplementary Table. 2) gene was significantly higher in mammary gland tissues compared to small intestine, liver, kidney, heart, and ovary tissues. In comparison to other candidate genes for milk fat metabolism, PI4K2A expression was higher and more stable in both mammary gland tissues and BMECs.

Phosphatidylinositol 4-kinase type 2 (PI4K2A) is an integral membrane protein enriched with a Pro-rich amino-terminal structural domain. It plays a central role in cellular signal transduction (Wnt) and transport and is significantly overexpressed in various human cancers, including malignant melanoma, fibroblastoma, mammary gland cancer, bladder metastatic cell carcinoma, and papillary thyroid cancer[12]. The role of prolactin is to induce mammary epithelial cells to secrete milk and Kučka et al.[13] found that PI4K2A was highly expressed in prolactin-treated BMECs, which suggesting a potential role for it in the lactation process. Interestingly, Palombo et al.[14] genotyped Italian Simmental and Holstein cows at the genomic level using GWAS and single nucleotide polymorphism arrays, identifying PI4K2A as an important candidate gene for milk fat metabolism. By combining our group's previous transcriptomic studies with tissue expression profiling results from this study, we identified PI4K2A as a key candidate gene for regulating milk fat metabolism in dairy cows. In this study, we aimed to clarify the specific mechanism of PI4K2A gene regulation in cow milk fat synthesis. We used primary BMECs cultured in vitro as a model to detect the expression of marker genes and transcription factors related to milk fat synthesis following PI4K2A overexpression/interference. Additionally, we examined TAG synthesis and lipid droplet secretion in BMECs, as well as investigated the effects of the PI4K2A gene on proliferation and apoptosis of BMECs. This study provides potential genetic marker information that can be used for accurate molecular breeding of milk composition traits in dairy cows and holds significant theoretical and practical value for regulating fatty acid composition and content in milk.

Extraction of total RNA

The total RNA extracted was analyzed by using 1% agarose gel electrophoresis, and all three RNA bands (28S, 18S, and 5S) were clearly visible (Supplementary Fig. 1). Spectrophotometric results revealed an OD 260/OD 280 ratio of 2.0-2.1, indicating high purity of the extracted RNA. The total RNA concentration was approximately 800 ng/μL, making it suitable for subsequent experiments.

Tissue expression analysis of candidate differential genes in milk fat metabolism

The qRT-PCR results demonstrated that the relative expression of the ENPP2 gene (2.17±0.76) in mammary gland tissue was significantly higher than that in other tissues (P < 0.05). The expression level of the PI4K2A gene in mammary gland tissue (1.40±0.26) was slightly higher than in the uterus (1.31±0.14) and significantly higher than in other tissues. The CTSH gene exhibited high expression in mammary gland and small intestine tissues, with expression levels of 1.18 ± 0.23 and 1.00 ± 0.03, respectively, which were significantly higher than in other tissues (P < 0.05). Although the relative expression of PTPRR in mammary gland tissue was the highest (3.35±0.67), it was not significantly different from that in the uterus, heart, ovary, but it was significantly higher than in the small intestine, liver, and kidney (P < 0.05). The expression levels of ID1 and PDGFD in mammary gland tissue were lower than in the uterus, but significantly higher than in other tissues (P < 0.05). The ATP8A2 gene was highly expressed in the ovary and ranked second in mammary gland tissue (10.09 ±2.15), which was significantly higher than in other tissues (P < 0.05). In comparison with other tissues, the expression of VEGFD, ZFYVE28, DKK1, APOL3, SLC16A1, and CES4A genes in mammary gland tissue was moderate or low, while the expression of KCNMA1 and BCAT1 was lower in mammary gland tissue (Fig. 1).

Expression of candidate differential genes related to milk fat metabolism in mammary gland tissue and BMECs

As demonstrated in Fig. 2A-B, the expression levels of most candidate differentially genes in mammary gland tissue correspond with those in BMECs. SLC16A1, PI4K2A, CTSH, APOL3, BCAT1, and DKK1 exhibit high expression in mammary gland tissue and BMECs, while ATP8A2, ID1, and ZFYVE28 show low expression in both. Our findings indicate that SLC16A1 has the highest expression levels in both mammary gland tissue and BMECs compared to other genes, suggesting it may play a significant role in regulating milk secretion in cows. However, the expression of the SLC16A1 gene in mammary gland tissue is not dominant across different tissues, which leads us to discard it as a key candidate gene for milk fat metabolism in cows. The expression of the CTSH gene ranks second in both mammary gland tissue and BMECs, and its expression in mammary gland tissue was significantly higher than in other tissues, except for the small intestine (P < 0.05). However, our previous research discovered that the expression of the CTSH gene in the high milk fat group was significantly lower than in the low milk fat group (P < 0.05), and identifying it as a down-regulated differentially expressed gene. Consequently, we will not consider further functional verification.

It is worth noting that PI4K2A gene has the highest expression level in mammary gland tissue compared to other tissue. Among all the differentially expressed candidate genes involved in milk fat metabolism, the expression of PI4K2A is relatively high in both mammary gland tissue and BMECs (ranked third), indicating that PI4K2A gene expression is relatively stable in these tissues. Previous transcriptome sequencing studies have also demonstrated differential expression of the PI4K2A gene in high and low milk fat groups, which is an upregulated differential gene (Supplementary Table. 1). Moreover, prior research has utilized GWAS and single nucleotide polymorphism arrays at the genomic level to genotype Italian Simmental and Holstein cows, determining that PI4K2A is an important candidate gene for milk fat metabolism in cows[14]. Therefore, this study will focus on the functional mechanism of the PI4K2A gene in cow milk fat metabolism.

Subcellular localization of PI4K2A

Subcellular localization is crucial for understanding protein function, as proteins can move within cells and possess one or more subcellular localization signals. In this study, the subcellular localization of the PI4K2A protein was predicted by using three online software tools: Euk-mPLOC 2.0, YLoc, and MultiLoc2. The results indicated that the protein was primarily located in the cytoplasm (86.0% to 87.1%), with a minor presence in the nucleus (12.8% to 13.0%, Table. 1). Although the PSORT II software predicted a lower content of PI4K2A protein in the cytoplasm (34.8%), the overall trend of the results from the four software tools was consistent.

To further confirm the authenticity of the prediction results, we extracted both nuclear and cytoplasmic RNA from BMECs. Fig. 2C shows that the concentration of cytoplasmic RNA was 1004.4 ng/μL, with an OD260/OD280 of 2.12, and the 28S and 18S bands were very clear and bright. In contrast, the nuclear RNA had a lower concentration (88.8 ng/μL) and brightness of bands, with an OD260/OD280 of 1.87, but subsequent experiments could still be carried out normally. Before reverse transcription, we diluted the concentration of cytoplasmic RNA to match that of nuclear RNA. qRT-PCR analysis revealed that U6 accounted for nearly 60% of the nuclear RNA content, while the reference genes GAPDH and β-actin accounted for more than 80% of the cytoplasmic RNA content. This indicates that both nuclear and cytoplasmic RNA were successfully isolated (Fig. 2D). Fig. 2 also demonstrates that the PI4K2A gene is expressed in both nuclear and cytoplasmic fractions, the expression level in the cytoplasm is as high as approximately 80%, while it is only about 20% in the nucleus. This suggests that the PI4K2A gene primarily plays an important role in the cytoplasm.

The effect of overexpression of PI4K2A on the expression of milk fat metabolism-related genes

The infection efficiency of both the overexpression group (Ad-PI4K2A) and the control group (Ad-EGFP) exceeded 70% (Supplementary Fig. 2). Compared to the Ad-EGFP group, the mRNA expression level of the PI4K2A gene in the Ad-PI4K2A group was significantly upregulated (P < 0.01). We use western blot (WB) to detect the expression level of the 3*Flag-tagged protein fused with PI4K2A, the results indicated that the expression level of the tagged protein 3*flag was also significantly higher in the Ad-PI4K2A group (P < 0.01). These findings suggest that the recombinant adenovirus Ad-PI4K2A was successfully constructed.

To investigate the effect of the PI4K2A gene on milk fat metabolism, BMECs were infected with Ad-PI4K2A adenovirus for 48 hours, and the mRNA expression levels of milk fat synthesis-related marker genes were detected by qRT-PCR. The results showed that overexpression of PI4K2A had no significant effect on the mRNA expression of de novo FA synthesis, LCFA uptake from blood, and desaturation marker genes (Fig. 3A-C). However, it significantly upregulated the mRNA expression of the FA transport marker gene FABP3 (Fig. 3C, P < 0.01). In addition, we detected other genes and transcriptional regulatory factors that regulate lactation. We discovered that PI4K2A overexpression upregulated ELOVL6 gene expression (Fig. 3D) and significantly increased mRNA expression levels of PPARG and ACOX1 (P < 0.01/P < 0.05, Fig. 3D), while PPARD displayed the opposite trend (P < 0.05, Fig. 3D). Subsequently, we randomly selected three significantly different genes for WB detection. The results revealed that protein expression levels of PPARG, PPARD, and FABP3 were consistent with their mRNA levels (Fig. 3E-F). These findings suggest that PI4K2A does not significantly affect de novo FA synthesis, LCFA uptake from blood, or desaturation in BMECs. However, it can promote FA transport and LCFA elongation. We hypothesize that PI4K2A can enhance milk fat synthesis in dairy cows because most lipogenic gene expression levels were upregulated after PI4K2A overexpression.

The effect of overexpression of PI4K2A on TAG synthesis and lipid droplet secretion in BMECs

To determine whether the PI4K2A gene affects TAG synthesis in BMECs, we examined the expression levels of TAG synthesis-related marker genes by using qRT-PCR. Our results revealed that the overexpression of PI4K2A significantly increased both mRNA and protein expression levels of DGAT1 (Fig. 3G, I-J, P < 0.05). Furthermore, we investigated marker genes associated with TAG degradation and discovered that mRNA expression of the ATGL gene was significantly reduced following PI4K2A overexpression (Fig. 3H, P < 0.01). In comparison to the Ad-EGFP group, PI4K2A overexpression ultimately resulted in a significant elevation of TAG content within BMECs (Fig. 3K, P < 0.05), while cholesterol content unchanged (Fig. 3L). The expression of lipid droplet secretion-related genes in BMECs was detected by using qRT-PCR, and it was found that the mRNA expression levels of XDH and PLIN2 genes tended to be upregulated after the overexpression of PI4K2A (Fig. 3M). Additionally, Oil Red O staining revealed a significant increase in the lipid droplets secreted by BMECs (Fig. 3N-O). Furthermore, by dissolving lipid droplets bound with Oil Red O in 100% isopropanol and measuring their absorbance values using an enzyme-linked instrument, the results were found to be consistent with the Oil Red O staining results (Fig. 3P). In summary, the overexpression of PI4K2A gene promotes the synthesis of milk fat in cows, more significant effects on fatty acid transport, TAG synthesis, and lipid droplet secretion. Additionally, the overexpression of PI4K2A gene has a notable inhibitory effect on TAG degradation.

The effect of interfering with PI4K2A on the expression of genes related to milk fat metabolism

The infection efficiency for both the control group (NC) and the interference group (siRNA-PI4K2A) exceeded 85% after BMECs were infected for 48 hours (Supplementary Fig. 3). Compared with NC, the mRNA expression level of the PI4K2A gene was significantly downregulated following interference (P < 0.01), achieving an interference efficiency of 59.75%. This demonstrates that the recombinant lentivirus siRNA-PI4K2A was successfully constructed.

The qRT-PCR quantification results demonstrated that PI4K2A could completely inhibit the marker genes related to bovine milk fat synthesis. Among these genes, the mRNA expression of de novo FA synthesis key genes ACSS2 and ACACA, key genes for LCFA uptake in blood (ACSL1 and CD36), and key genes for FA desaturation (SCD) were significantly reduced following PI4K2A interference (P < 0.01/P < 0.05, Fig. 4A-C). After PI4K2A interference, the key genes FASN and FABP3 involved in FA synthesis and transport showed a decreasing trend, but the difference was not significant (P > 0.05). Additionally, we examined the mRNA expression of genes and transcription factors involved in milk fat synthesis regulation and observed a downward trend in the expression of all genes (Fig. 4D). The downregulation of ELOVL6, EGFR, PPARA, and PPARD genes reached a significant level (P < 0.01/P < 0.05). We then randomly selected four genes with reduced expression for WB analysis, and the results revealed that the protein expression levels of PPARG, PPARD, SCD, and FABP3 were consistent with their mRNA levels (Fig. 4E-F). These findings suggest that interfering with the PI4K2A gene can inhibit de novo FA synthesis, LCFA uptake from blood, FA transport, and desaturation processes in BMECs. This interference may also indirectly impact some key transcription factors involved in milk fat synthesis, and leading to a reduction in bovine milk fat synthesis.

The effect of interfering with PI4K2A on TAG synthesis and lipid droplet secretion in BMECs

The detection results of TAG synthesis and decomposition-related marker genes revealed that interference with PI4K2A significantly reduced the mRNA expression of the key gene AGPAT6 for TAG synthesis (Fig. 4G, P < 0.01) and had no effect on TAG decomposition (Fig. 4H). When compared to the NC group, interference with the PI4K2A gene resulted in significant decrease of TAG content in BMECs (Fig. 4I, P < 0.01), and the total cholesterol content also showed a decreasing trend (Fig. 4J, P = 0.058). The detection results of lipid droplet secretion-related marker genes indicated that the mRNA expression levels of XDH, BTN1A1, and PLIN2 genes were significantly downregulated after interfering with PI4K2A (Fig. 4K, P < 0.05). It was observed that the lipid droplet secretion in the siRNA-PI4K2A group was significantly lower than that in the NC group (Fig. 4L-N, P < 0.05) by using Oil Red O to detect lipid droplet secretion in BMECs. In conclusion, interference with the PI4K2A gene can inhibit the synthesis of cow milk fat. Simultaneously, combined with the overexpression results of the PI4K2A gene, we concluded that the PI4K2A gene positively regulates the synthesis of cow milk fat.

The effect of PI4K2A on the proliferation and apoptosis of BMECs

After overexpressing the PI4K2A gene for 48 hours, the number of proliferating cells in the Ad-PI4K2A group was significantly higher than in the Ad-EGFP group. Using ImageJ software for cell counting and calculating the EdU labeling index, it was found that overexpression of the PI4K2A gene could significantly increase the proliferation rate of BMECs (P < 0.05, Fig. 5A-G). Further analysis of the protein expression levels of cell proliferation marker genes revealed that the expression of CCND1 in BMECs treated with Ad-PI4K2A adenovirus was also significantly higher than in the Ad-EGFP group (P < 0.05), which was consistent with the EdU detection results (Fig. 5H-I). In contrast, the experimental results of interfering with the PI4K2A gene showed the opposite effect, indicating that PI4K2A positively regulates the proliferation of BMECs (Fig. 5J-R).

Adenoviruses Ad-EGFP and Ad-PI4K2A were infected respectively in BMECs, and the apoptosis of BMECs was detected after 48 hours by using the Annexin V-mCherry/SYTOX Green kit. The results showed that overexpression of PI4K2A significantly reduced BMEC apoptosis, and the apoptotic index of the Ad-PI4K2A group was also significantly lower than that of the Ad-EGFP group (P < 0.05, Fig. 6A-I). Furthermore, the detection of protein expression levels of apoptotic marker genes showed that the expression level of caspase-3 in the Ad-PI4K2A group were also significantly lower than that in the Ad-EGFP group (P < 0.05), and consistent with the results of the apoptosis kit detection (Fig. 6J-K). In addition, the results after interfering with the PI4K2A gene were opposite (Fig. 7), indicating that PI4K2A negatively regulates the apoptosis of BMEC.

The effects of PI4K2A gene on milk fat synthesis in dairy cows

The PI4K2A is a potential target for mammary gland cancer treatment. When applied at a concentration of 10 µM for 20 minutes in mammary gland epithelial cells, it can lead to the accumulation of prolactin within the cells[13], suggesting that PI4K2A may play a potential regulatory role in the lactation process. Palombo et al.[14]discovered through GWAS analysis that PI4K2A is an important candidate gene for bovine milk fat metabolism. Mu et al.[11] further identified the differential expression of the PI4K2A gene in high and low milk fat groups through transcriptomic analysis of BMECs. In this study, qRT-PCR detection revealed that the expression of the PI4K2A gene in cow mammary tissue was significantly higher than in other tissues, and the expression of the PI4K2A gene in both cow mammary tissue and BMECs was relatively constant. Additionally, researchers have found that PI4K2A plays an important role in intracellular lipid and protein transport[15]. We speculate that the PI4K2A gene may be involved in the synthesis of bovine milk fat based on these results.

Milk fat synthesis is a complex molecular regulatory network that includes de novo FA synthesis, LCFA uptake from blood, LCFA transport and desaturation, TAG synthesis, and lipid droplet secretion[16]. To explore the specific function of the PI4K2A gene in milk fat synthesis in dairy cows, we used in vitro cultured BMECs as a research model and detected the expression of milk fat metabolism-related marker genes and changes in related indicators after overexpression and interference of the PI4K2A gene. The results showed that overexpression of PI4K2A significantly upregulated the mRNA expression levels of FABP3 and PPARG genes, while the results of interfering with the PI4K2A gene were opposite, which was also confirmed at the protein level. Intracellular FABP protein is a conserved family with lipid partner, among which FABP3 is mainly expressed in mature cardiomyocytes, skeletal muscle, and mammary tissue. Among all FABP subtypes, FABP3 is relatively abundant in the mammary glands of dairy cows, and the expression of FABP3 mRNA is upregulated during lactation[17]. LCFAs released from the blood are mainly bound to FABP3 after being activated in the cell and then desaturated by SCD1[18]. Combined with the results of this study, it is confirmed that overexpression of the PI4K2A gene can promote the transport of fatty acids during the milk fat synthesis process in dairy cows. PPARG is a ligand-activated transcription factor belonging to the nuclear receptor superfamily, and it is mainly expressed in fat and liver tissues[19]. Studies have confirmed that ACACA, FASN, and ACSS2 are significantly upregulated during lactation in cows, and de novo FA synthesis in the mammary gland depends on these three key enzymes[20]. In the synthesis of goat milk fat, the overexpression of PPARG can upregulate the expression of lipogenic genes FASN and ACACA[21], which is consistent with the results of studies on cows[22]. A recent study on buffaloes found that overexpression or interference of PPARG significantly upregulates or downregulates the expression of FASN and ACSS2 genes in BMECs, suggesting that PPARG may have a positive regulatory effect on milk fat synthesis in cows[23]. Although the overexpression of PI4K2A in this study did not have a significant effect on the marker genes of de novo FA synthesis, it significantly upregulated the expression of PPARG, thereby indirectly promoting de novo FA synthesis. Moreover, PPARG can also positively regulate key genes ACSL1 and SCD in LCFA uptake and FA desaturation in cows[22], and FABP3 can upregulate the expression of PPARG to increase lipid droplet accumulation in cows[17]. This finding indicates that PI4K2A, FABP3, and PPARG have a close relationship in milk fat synthesis, further indirectly suggesting that PI4K2A may play a role in regulating milk fat synthesis.

The ACOX1 is a key enzyme involved in fatty acid β-oxidation, which promotes fatty acid oxidation in peroxisomes and has many functions, such as reducing serum TAG[24] and preventing lipid esterification[25]. CPT1A is the rate-limiting enzyme that controls the entry of fatty acids into mitochondria for oxidation. Jacometo et al.[26] showed that when calves are fed milk replacers, it leads to overabsorption of fatty acids, which exceeds the body's ability to oxidize fatty acids. The temporary decrease of ACOX1 expression and the increase of CPT1A expression may be the cellular mechanism regulating fatty acid oxidation. In this study, ACOX1 expression was significantly upregulated after overexpress PI4K2A, while CPT1A expression showed a downward trend. After interfering with PI4K2A, the results were reversed, which is consistent with the trend of Jacometo et al.[26] research, suggesting that ACOX1 and CPT1A have an intrinsic functional relationship in fatty acid oxidation. Additionally, this study indicates that PI4K2A has a promoting effect on the fatty acid oxidation process in milk fat metabolism. It is worth noting that although PI4K2A promotes fatty acid oxidation, it may ultimately lead to an increase in TAG synthesis and lipid droplet secretion due to its more significant upregulating effect on milk fat synthesis marker genes. Unlike other marker genes, the expression of PPARD was significantly downregulated after overexpression or interference with the PI4K2A gene in this study, which seems to contradict a possible positive regulation of milk fat synthesis by PI4K2A. Interestingly, when PPARD was inhibited and FASN gene expression was significantly decreased and TAG content was increased, reflecting that PPARD plays an important role in the dynamic balance of ruminant mammary cells[27].

In this study, overexpression of PI4K2A resulted in a significant upregulation of several milk fat synthesis marker genes (FABP3, PPARG and ACOX1). However, following PI4K2A interference, a greater number of adipogenic marker genes were significantly downregulated, including key genes for de novo synthesis of FA (ACSS2 and ACACA), key genes for LCFA uptake in blood (ACSL1 and CD36), and key genes for fatty acid desaturation (SCD)[28]. These findings suggest that the inhibitory effect of PI4K2A interference on milk fat synthesis may be more potent than the promoting effect of PI4K2A overexpression, indirectly indicating that the PI4K2A gene might be an essential regulatory factor in the milk fat synthesis process in cows. Further in-depth research is needed to understand the specific mechanism of action.

Furthermore, interference with PI4K2A significantly downregulated the mRNA levels of ELOVL6 and EGFR. Previous studies have confirmed that ELOVL6 catalyzes the synthesis of C18:0 from C16:0 in lipogenic tissues, such as adipose and liver[29]. The ELOVL6 gene is highly expressed in the mammary tissues of goats and cows[30], and can positively regulate the expression of FASN, SCD1, GPAM, and AGPAT6 in BMECs. It also has a positive regulatory effect on SREBP1 and PPARG[31]. Shi et al.[27] inhibited the ELOVL6 gene by adenovirus transfection, resulting in a significant decrease in GPAM expression and TAG concentration. This indicates that ELOVL6 not only regulates the elongation of fatty acid chains but also plays an active role in the de novo synthesis of FA and TAG. EGFR has a positive regulatory effect on the de novo synthesis of FA in goat mammary epithelial cells (FASN and ACACA), which is mainly mediated by the AKT and PLC-γ-1 signaling pathways[32]. Therefore, after interfering with the PI4K2A gene, the expression of ELOVL6 and EGFR were downregulated, indicates that PI4K2A may indirectly inhibit the synthesis of milk fat in cows. In summary, PI4K2A has a positive regulatory effect on the fatty acid transport process in cow milk fat synthesis and can indirectly promote de novo synthesis of FA, LCFA uptake, and FA desaturation.

The TAG synthesis and lipid droplet secretion are the last two stages of cow milk fat synthesis, involving numerous key marker genes. TAG is formed directly between the two lobes of the endoplasmic reticulum membrane, playing an important role in the formation of lipid droplets[28]. To further confirm whether the PI4K2A gene affects cow milk fat synthesis, we examined TAG synthesis, total cholesterol content, and lipid droplet secretion after overexpression or interference of the PI4K2A gene in BMECs. DGAT1 is a key enzyme responsible for adding the third LCFA to 1,2-diacylglycerol (DAG) to form TAG[6]. In this study, overexpress PI4K2A significantly increased the mRNA and protein expression levels of DGAT1, while TAG content and lipid droplet secretion in BMECs also significantly increased. After interfering with PI4K2A, the expression of DGAT1 showed a decreasing trend, the expression of the TAG synthesis marker gene AGPAT6 mRNA was significantly downregulated, the TAG content and lipid droplet secretion were also significantly decreased. Not only that, the overexpression of PI4K2A also significantly decreased the expression of the rate-limiting enzyme gene ATGL for TAG hydrolysis[33], which leads to the deposition of TAG in cow mammary glands and promotes milk fat synthesis from another aspect.

The research results mentioned above indicate that PI4K2A positively regulates cow milk fat synthesis and can also indirectly control cow milk fat synthesis through related regulatory factors, such as PPARG, PPARD, ACOX1, PPARA, ELOVL6, and EGFR.

The effect of PI4K2A on the proliferation and apoptosis of BMECs

The mammary gland of cows undergoes various structural and functional changes from birth to adulthood. These include cyclical expansion corresponding to hormonal changes caused by the estrous cycle, as well as changes during pregnancy, lactation, and the dry period. In these different stages, mammary gland cells proliferate, differentiate, or undergo apoptosis under stimulation, leading to significant remodeling of the glandular tissue structure[34]. Mohamed et al.[35] demonstrated that PI4K2A plays a role in regulating the balance between proliferation and apoptosis in fibroblasts. In this study, overexpression of PI4K2A significantly promoted the proliferation of BMECs and inhibited cell apoptosis. Conversely, interference with PI4K2A inhibited BMECs proliferation and accelerated apoptosis, suggesting that PI4K2A gene can positively regulate BMECs proliferation and negatively regulate apoptosis. CCND1 is a key regulatory factor in the cell cycle, which binds to cyclin-dependent kinases (CDKs). CDKs subsequently phosphorylate the tumor suppressor protein Rb, allowing the cell cycle to progress from G1 to S phase and thereby promoting cell proliferation[36]. When PI4K2A was overexpressed, the expression of CCND1 protein significantly increased in BMECs, while interference with PI4K2A is the opposite. This suggests that the proliferative effect of the PI4K2A gene on BMECs may occur during the G1 to S phase. This proliferative effect provides a theoretical basis for mammary gland wound healing, tissue regeneration, and pathological tissue repair.

Apoptosis is a form of programmed cell death that plays a crucial role in embryonic development, cell renewal, and externally induced cell death processes[37]. During apoptosis, caspases can directly destroy cell structures, causing cells to degrade into apoptotic bodies, which are subsequently engulfed by macrophages to initiate the apoptotic program[38]. In BMECs, PI4K2A negatively regulates the expression of the caspase-3 protein, further confirming that PI4K2A can inhibit the occurrence of apoptosis in BMECs. The inhibitory effect of PI4K2A on BMECs apoptosis holds significant implications for the treatment of mammary gland-related diseases, becaues the dysregulation of the apoptotic process may be directly or indirectly associated with the onset of numerous diseases[39].

In conclusion, we have identified PI4K2A as a key candidate gene for regulating bovine milk fat synthesis, which plays an important role in the cytoplasm of BMECs. PI4K2A positively regulates both bovine milk fat synthesis and BMECs proliferation, while negatively regulating BMECs apoptosis. These findings provide an important theoretical basis for understanding the complex biology of bovine milk fat synthesis, which can improve Chinese Holstein cattle breeds, promote mammary wound healing and tissue regeneration. Furthermore, this research also holds significant implications for the treatment of mammary-related diseases.

Ethic statement

Animal experiments were conducted in accordance with the Regulations for the Administration of Affairs Concerning Experimental Animals (Ministry of Science and Technology, China, 2004). The cows used in the experiment were electrocuted to death before collecting samples. This work also conformed to the requirements of the American Veterinary Medical Association (AVMA) Guidelines. All animal protocols have been approved by the Animal Ethics Committee of Ningxia University (permit number NXUC20200620).

Experimental materials

The experimental subjects in this study were dairy cows, and the experiments were conducted according to Yan'an University's "Guide to Laboratory Animals." The Holstein cows in this experiment were from Ningxia Nongkeng Helanshan Maosheng Dairy Farm, and all cows were physiologically healthy, without any mammary gland disease. Three cows in their second calving and in the middle to late stages of lactation (150-220 days) were selected. The tissue samples from the small intestine, liver, kidney, heart, ovary, uterus, and mammary gland were collected after slaughtering. These samples were then cut and placed into 1.5 mL freezing tube before being quickly stored in liquid nitrogen. The isolation, culture, and identification of BMECs have been completed in the early stage of our research group [10].

Primer design

The PCR primers for the genes were designed by using Primer Premier 5.0 software, with gene sequences obtained from NCBI (species is bovine). The designed primers were synthesized by Shanghai Bioengineering Technology Service Co. The primer sequences can be found in Supplementary Table. 3.

RNA extraction and cDNA synthesis

Total RNA was extracted from mammary gland tissue and BMECs by using an RNA Extraction Kit (Tiangen Biochemical Technology Co., Ltd.) and RNAiso Plus (TaKaRa), respectively. Nuclear and cytoplasmic RNA from BMECs were extracted by using a Cytoplasmic & Nuclear RNA Purification Kit (NORGREN, UK). RNA integrity, concentration, and purity were assessed by using 1% agarose gel electrophoresis and an ultramicro UV spectrophotometer (Thermo Fisher Scientific Co., Ltd.), respectively. After passing quality control, 1 μg of total RNA was used as a template, and a 20 μ reverse transcription reaction system was prepared according to the HiScript III 1st Strand cDNA Synthesis Kit (+Gdna wiper) instructions to synthesize the first strand of cDNA.

The qRT-PCR and amplification procedure

The qRT-PCR solution system (20 µL): SYBR Green Pro Taq HS qPCR kit 10 µL, 0.4 µL each of upstream and downstream primers, cDNA 1 µL, ddH₂O 8.2 µL. qRT-PCR amplification program: 95 °C for 30 s, 95 °C for 5 s, annealing (Supplementary Table. 3) for 30 s, 40 cycles from the second step, 60 ℃ for 5 s and 95 ℃ for 5 s.

Packaging and vector construction of viruses

The packaging of overexpressed adenovirus and interfering sequence lentivirus of PI4K2A gene was done by Hanheng biotechnology Co. The overexpression vector selected for the experiment was pAdEasy-EF1-MCS-3flag-CMV-EGFP. The pAdEasy-CMV empty vector was digested with restriction endonucleases KpnI and XhoI, and the reaction was carried out in a 37 °C water bath for 1-2 hours, followed by agarose gel electrophoresis and recovery of the target fragment. The bovine PI4K2A gene (NM_001100316) is located on chromosome 26, with a CDS region length of 1440 bp, encoding 479 amino acids. Synthesize the CDS region sequence of the bovine PI4K2A gene and design specific primers for PCR amplification of the target fragment. The upstream primer sequence is Adeasy-c-PI4K2A-K/X-F: CTGTGACCGGCGCCTACTCTGGTACCGCCACCATGGACG AGACGAG, and the downstream primer sequence is Adeasy-c-PI4K2A-K/X-R: TCATCGTCATCCTTGTAGTC CTCGAGCCACCAGGAGAAGAAGGGCT. Using the HB infusionTM one-step cloning and ligation system, the amplified target fragment is ligated with the vector and immediately transformed into DH5a competent cells. After the transformation is completed, the bacterial suspension is identified by PCR. After the successful construction of the shuttle plasmid, an appropriate restriction site is selected for linearization, and the restriction products are recovered. Complete the intracellular recombination of shuttle plasmids and adenovirus skeleton plasmids to obtain high-purity recombinant plasmids. Take the successfully recombined adenovirus vector linearized plasmid and transfect 293A cells with LipofiterTM transfection reagent. Observe the signs of cell virus release daily. Collect the virus when most of the cells show lesions and detach from the bottom. Infect 293A cells with the virus 2-3 times repeatedly to obtain high-titer Ad-PI4K2A adenovirus. Perform quality control afterward, including sterility testing, mycoplasma testing, and virus titer testing. After passing the tests, aliquot it for subsequent experiments.

The sense strand (5'-3') in the interfering RNA sequence of PI4K2A gene: GCUACAAAGAUGCAGACUATT; Antisense strand (5'-3'): UAGUCUGCAUCUUUGU AGCTT; Target sequence: GCUACAAAGA UGCAGACUA. Synthesize primers based on siRNA sequences, anneal single-stranded primers into double-stranded oligo sequences, and ligate them into double-enzyme digested linearized RNA interference vectors. Sequence and verify the correct transformants, and perform high-purity plasmid extraction. Culture 293T cells with vigorous growth, better cell conditions (survival rate above 90%), and low passage numbers in T10 culture dishes. When the cells reach an appropriate density, co-transfect them with the interference vector plasmid, pCMV-dR8.9 packaging plasmid, and pCMV-VSV-G helper plasmid. Take fluorescence photos after 24 hours to check the transfection status. After 2 days of culture, cells will gradually fuse to form multinucleated bodies, with most cells still adhered to the wall. Collect the supernatant and filter it using a 0.22 μm PVDF filtration device. Concentrate and purify the lentivirus by ultracentrifugation precipitation method, and then perform viral titer determination.

Lipid analysis

The TAG and total cholesterol were extracted according to the enzymatic assay kits (Beijing Pulley Gene Technology Co., Ltd.), with values corrected for protein concentration per mg. Lipid droplet content was determined by using the Oil Red O staining kit (Beijing Solaibao Technology Co., Ltd).

Western blot

The BMECs were washed twice with prechilled PBS, digested with 0.25% trypsin (containing EDTA), and collected in 1.5 mL sterile centrifuge tubes. Then, 80 μL of lysis solution (1 mL RIPA: 25 μL of 100 mM PMSF) per well was added to extract the total protein. A quarter volume of 5x protein loading buffer was added to the total protein, and the mixture was denatured in a 100°C metal bath for 5 minutes, quickly cooled on ice, and stored at -80 °C for long-term storage. Protein gel separation (20 μg loading volume, 5 μL protein marker loading volume) was performed by using 4-20% precast gels with 11 spotting wells. After 35 minutes at 160 V, membrane transfer (25 V, 1.0 A, 15 minutes) was performed by using Bio-Rad' semi-dry transfer system. Following the transfer, the membranes were blocked and incubated with antibodies. The PVDF membranes were exposed to ECL for 3 minutes, then imaged in a gel imaging system, and protein abundance was calculated by using Image J software [40].

Detection of cell proliferation and apoptosis

The BMECs were inoculated in 6-well plates and transfected with either overexpression or interfering viruses when the cells reached 50-70% confluency. After 48 hours, BMECs were washed twice with pre-chilled PBS. The proliferation and apoptosis of BMECs were assessed by using the EdU Cell Proliferation Kit and the Apoptosis Kit (Beyoncé Biotechnology), respectively. Images were captured and stored by using a fluorescent inverted microscope (DMI4000B, Weztlar, Germany).

Statistical analysis

Treatments were replicated at least 3 times, and results are expressed as means ± standard error of the means (SEM). Data from qRT-PCR were analyzed using the method and normalized to the respective control (Ad-PI4K2A or siRNA-PI4K2A) [41]. The proportion of genes in nuclear RNA (%) = / ( + ), and the proportion of genes in cytoplasmic RNA (%) =1 - proportion of genes in nuclear RNA (%). Statistical differences were determined with a one-way ANOVA (Tukey) using SAS 9.2 (SAS Institute, Cary, NC, United States). Statistical significance was considered at P < 0.05 or P < 0.01.

TPI: Total Performance Index in the United States; CPI: Total Performance Index in China; FA: Fatty acids; LCFA: Long-chain fatty acids; TAG: Triglyceride; BMECs: Bovine mammary epithelial cells; WGCNA: Weighted gene co-expression network analysis; qRT-PCR: Quantitative real-time PCR; WB: Western blot; LDL: Low density lipoprotein; PI4K2A: Phosphatidylinositol 4-kinase type 2; AVMA: American Veterinary Medical Association.

Ethics approval and consent to participate

We confirm that the study is reported in accordance with ARRIVE guidelines. Animal experiments were conducted in accordance with the Regulations for the Administration of Affairs Concerning Experimental Animals (Ministry of Science and Technology, China, 2004). The cows used in the experiment were electrocuted to death before collecting samples. This work also conformed to the requirements of the American Veterinary Medical Association (AVMA) Guidelines. All animal protocols have been approved by the Animal Ethics Committee of Ningxia University (Permit number NXUC20200620).

Consent for publication

Not applicable.

Data availability statement

The data presented in this study are available in the article.

Competing interests

The authors declare that we have no competing interests.

Financial support statement

This project is supported by the special breeding project of high-quality and high yield dairy cows in the Ningxia Autonomous region (Grant No: 2019NYYZ05).

Authors Contributions

TM and HHH: Data processing and article writing. XFF: Article modification and visualization. JZ and CCW: Sample collection and verified by qRT-PCR. ZHS: Article grammar modification. YLG: Conceptual analysis, writing-review and editing. All authors have read and agreed to the published version of the manuscript.

Acknowledgments

We are grateful to Ningxia Agricultural Reclamation Helan Mountain Dairy Industry Corporation for facilitating the data collection and providing access to production records.

Wu YJ, Fan DM, Hang F, Yan BW, Zhao JX, Zhang H, Chen W. Effect of calcium on absorption properties and thermal stability of milk during microwave heating. Int J Mol Sci. 2018; 19(6):1747.
Lu N, Liu G, Jing Y, Shao W, Yu X, Li SL. Study on the correlation between milk yield, milk composition, serum biochemical indexes and milk calcium content of dairy cows of different breeds. Chinese Journal of Animal Nutrition. 2018; 30(8):3302-3310.
Sun CQ, O'Connor CJ, Roberton AM. The antimicrobial properties of milkfat after partial hydrolysis by calf pregastric lipase. Chem Biol Interact. 2002; 140(2):185-198.
Belury MA. Dietary conjugated linoleic acid in health: physiological effects and mechanisms of action. Annu Rev Nutr. 2002; 22:505-531.
Zhou CH, Shen D, Li C, Cai WT, Liu SL, Yin HW, Shi SL, Cao MY, Zhang SL. Comparative transcriptomic and proteomic analyses identify key genes associated with milk fat traits in Chinese holstein cows. Front Genet. 2019; 10:672.
Mu T, Hu HH., Ma YF, Feng XF, Zhang J, Gu YL. Regulation of key genes for milk fat synthesis in ruminants. Front Nutr. 2021; 8:765147.
Keenan TW, Mather IH. Intracellular origin of milk fat globules and the nature of the milk fat globule membrane. Springer, Boston, MA. 2006; 2:137–171.
Bauman DE, Mather IH, Wall RJ, Lock AL. Major advances associated with the biosynthesis of milk. J Dairy Sci. 2006; 89(4):1235-1243.
Xu B, Isabelle G, Miao HZ, Dang VP, Johnson CN, Xu RC, Chen XW, Cawthorn WP, MacDougald OA, Koenig RJ. Multiple roles for the non-Coding RNA SRA in regulation of adipogenesis and insulin sensitivity. PLoS One. 2010; 5(12):e14199.
Mu T, Hu HH, Feng XF, Ma YF, Wang Y, Liu JM, Yu BJ, Wen W, Zhang J, Gu YL. Screening and conjoint analysis of key lncRNAs for milk fat metabolism in dairy cows. Front Genet. 2022; 13:772115.
Mu T, Hu HH, Ma Y, Wen HY, Yang C, Feng XF, Wen W, Zhang J, Gu YL. Identifying key genes in milk fat metabolism by weighted gene co-expression network analysis. Sci Rep. 2022; 12(1):6836.
Waugh MG. Phosphatidylinositol 4-kinases, phosphatidylinositol 4-phosphate and cancer. Cancer Lett. 2012; 325(2):125-131.
Kučka M, Gonzalez-Iglesias AE, Tomić M, Prévide RM, Smiljanic K, Sokanovic SJ, Fletcher PA, Sherman A, Balla T, Stojilkovic SS. Calcium-prolactin secretion coupling in rat pituitary lactotrophs is controlled by PI4-Kinase alpha. Front Endocrinol (Lausanne). 2021; 12:790441.
Palombo V, Milanesi M, Sgorlon S, Capomaccio S, Mele M, Nicolazzi E, Ajmone-Marsan P, Pilla F, Stefanon B, D'Andrea M. Genome-wide association study of milk fatty acid composition in Italian Simmental and Italian Holstein cows using single nucleotide polymorphism arrays. J Dairy Sci. 2018; 101(12):11004-11019.
Tai AW, Bojjireddy N, Balla T. A homogeneous and nonisotopic assay for phosphatidylinositol 4-kinases. Anal Biochem. 2011; 417(1):97-102.
Osorio JS, Lohakare J, Bionaz M. Biosynthesis of milk fat, protein, and lactose: roles of transcriptional and posttranscriptional regulation. Physiol Genomics. 2016; 48(4):231-256.
Liang MY, Hou XM, Qu B, Zhang N, Li N, Cui YJ, Li QZ, Gao XJ. Functional analysis of FABP3 in the milk fat synthesis signaling pathway of dairy cow mammary epithelial cells. In Vitro Cell Dev Biol Anim. 2014; 50(9):865-873.
Bionaz M, Loor JJ. Gene networks driving bovine milk fat synthesis during the lactation cycle. BMC Genomics. 2008; 9:366.
Bionaz M, Chen S, Khan MJ, Loor JJ. Functional role of PPARs in ruminants: potential targets for fine-tuning metabolism during growth and lactation. PPAR Res. 2013; 2013:684159.
Lee J, Wang Y, Xu Y, Li Y, Tian F, Jiang M. Characterisation of gene expression related to milk fat synthesis in the mammary tissue of lactating yaks. J Dairy Res. 2017; 84(3):283-288.
Shi HB, Zhao WS, Luo J, Yao DW, Sun YT, Li J, Shi HP, Loor JJ. Peroxisome proliferator-activated receptor γ1 and γ2 isoforms alter lipogenic gene networks in goat mammary epithelial cells to different extents. J Dairy Sci. 2014; 97(9):5437-5447.
Liu LL, Lin Y, Liu LX, Wang LN, Bian YJ, Gao XJ, Liu QZ. Regulation of peroxisome proliferator-activated receptor gamma on milk fat synthesis in dairy cow mammary epithelial cells. In Vitro Cell Dev Biol Anim. 2016; 52(10):1044-1059.
Zhou FT, Ouyang YN, Miao YW. Peroxisome proliferator‐activated receptor gamma regulates genes involved in milk fat synthesis in mammary epithelial cells of water buffalo. Anim Sci J. 2021; 92(1):e13537.
Wang Z, Ye P, Zhang X, Wang L. Effects of aging on acyl-CoA oxidase levels in rat liver. Chin J Arteriosclerosis. 2005; 13:10-12.
Aoyama T, Tsushima K, Souri M, Kamijo T, Suzuki Y, Shimozawa N. Molecular cloning and functional expression of a human peroxisomal acyl-coenzyme a oxidase. Biochem Biophys Res Commun. 1994; 198(3):1113-1118.
Jacometo CB, Schmitt E, Pfeifer LFM, Schneider A, Bado F, Rosa FT, Halfen S, Francisco AB, Loor JJ, Corrêa MN, Dionello NJL. Linoleic and alpha-linolenic fatty acid consumption over three generations exert cumulative regulation of hepatic expression of genes related to lipid metabolism. Genes Nutr. 2014; 9(4):405.
Shi HB, Wu M, Zhu JJ, Zhang CH, Yao DW, Luo J, Loor JJ. Fatty acid elongase 6 plays a role in the synthesis of long-chain fatty acids in goat mammary epithelial cells. J Dairy Sci. 2017; 100(6):4987-4995.
Li J, Luo J, Wang H, Shi H, Zhu J, Sun YT, Yu K, Yao DW. Adipose triglyceride lipase regulates lipid metabolism in dairy goat mammary epithelial cells. Gene. 2015; 554(1):125-130.
Green CD, Ozguden-Akkoc CG, Wang Y, Jump DB, Olson LK. Role of fatty acid elongases in determination of de novo synthesized monounsaturated fatty acid species. J Lipid Res. 2010; 51(7):1871.
Shi H, Zhu J, Luo J, Cao W, Shi H, Yao DW, Li J, Sun YT, Xu HF, Yu K, Loor JJ. Genes regulating lipid and protein metabolism are highly expressed in mammary gland of lactating dairy goats. Funct Integr Genomics. 2015; 15(3):309-321.
Fan X, Zhu W, Qiu L, Zhang G, Zhang Y, Miao Y. Elongase of very long chain fatty acids 6 (ELOVL6) promotes lipid synthesis in buffalo mammary epithelial cells. J Anim Physiol Anim Nutr (Berl). 2021; 106(1):1-11.
Huang J, Dai B, Qu H, Zhong Y, Shi H. Epidermal growth factor stimulates fatty acid synthesis mainly via PLC-γ1/Akt signaling pathway in dairy goat mammary epithelial cells. Animals (Basel). 2020; 10(6):930.
Deiuliis J, Shin J, Murphy E, Kronberg SL, Eastridge ML, Suh Y, Yoon JT, Lee K. Bovine adipose triglyceride lipase is not altered and adipocyte fatty acid-binding protein is increased by dietary flaxseed. Lipids. 2010; 45(11):963-973.
Inman JL, Robertson C, Mott JD, Bissell MJ. Mammary gland development: cell fate specification, stem cells and the microenvironment. Development. 2015; 142(6):1028.
Mohamed M, Gardeitchik T, Balasubramaniam S, Astillo SG, Wevers RA. Novel defect in phosphatidylinositol 4-kinase type 2-alpha (PI4K2A) at the membrane-enzyme interface is associated with metabolic cutis laxa. J Inherit Metab Dis. 2020; 43(6):1382-1391.
Long J, Ou C, Xia H, Zhu Y, Liu D. MiR-503 inhibited cell proliferation of human breast cancer cells by suppressing CCND1 expression. Tumour Biol. 2015; 36(11):8697-8702.
Dong Y, Chen H, Gao J, Liu Y, Wang J. Molecular machinery and interplay of apoptosis and autophagy in coronary heart disease. J Mol Cell Cardiol. 2019; 136:27-41.
Schlegel RA, Williamson P. Phosphatidylserine, a death knell. Cell Death Differ. 2001; 8(6):551-563.
Li Q, Li M, Zhang J, Shi X, Yang M, Zheng Y, Cao XY, Yue XQ, Ma SL. Donkey milk inhibits triple-negative breast tumor progression and is associated with increased cleaved-caspase-3 expression. Food Funct. 2020; 11(4):3053-3065.
Rueden CT, Schindelin J, Hiner MC, DeZonia BE, Walter AE, Arena ET. Image J2: ImageJ for the next generation of scientific image data. BMC Bioinformatics. 2017; 18(1):529-629.
Zhang W, Zhang CH, Luo J, Xu HF, Liu JX, Jloor J, Shi HB. The LXRB-SREBP1 network regulates lipogenic homeostasis by controlling the synthesis of polyunsaturated fatty acids in goat mammary epithelial cells. J Anim Sci Biotechno. 2023; 13(1):120.

Table 1. Predicted subcellular localization of PI4K2A

Software	Cytoplasm	Cell nucleus	Mitochondria	Vacuole	Golgi apparatus	Cytoskeleton
Euk-mPLOC 2.0	√	——	——	——	——	——
YLoc	87.1%	12.8%	0.0%	——	——	——
MultiLoc2	86.0%	13.0%	1.0%	——	——	——
PSORT II Prediction	34.8%	26.1%	21.7%	8.7%	4.3%	4.3%

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

The PI4K2A positively regulates the synthesis of milk fat in cows, promotes the proliferation of bovine mammary epithelial cells, and inhibits their apoptosis

Status:

Version 1

Abstract

Figures

Background

Results

Discussion

Materials And Methods

Abbreviations

Declarations

References

Tables

Additional Declarations

Supplementary Files

Status:

Version 1