2.1 Patients
Patients who met all of the following criteria were subjected: (1) patients who underwent esophagogastroduodenoscopy (EGD) at our facility, Kenwakai Hospital (Iida, Japan), between November 2010 and September 2021, (2) patients who underwent gastric mucosal biopsy, (3) patients who were diagnosed with NHPH infection by microscopic examination of biopsied specimen based on Giemsa staining, (4) patients who offered another biopsied sample for use in PCR analysis with an additional advance informed consent, (5) patients in whom NHPH bacterial species was identified by PCR analysis, and (6) patients who consented to eradication therapy for NHPH infection after being briefed in detail on the pathogenicity and eradication therapy of NHPH.
2.2 Pathology
A patient was diagnosed with NHPH infection, when Giemsa staining revealed organisms with a helical shape that were obviously larger than Helicobacter pylori (H. pylori) [Fig. 1].
2.3 PCR analysis
DNA isolation, PCR analysis and sequencing of urease A and B genes were as below. Gastric mucosal biopsy samples for PCR analysis from NHPH-positive patients were freshly frozen and stored in a deep freezer until analysis. Then, DNA was isolated from the freshly frozen samples with DNeasy Blood & Tissue Kit (Qiagen). All the extracted DNA was examined by urease PCR assay, and sequencing for identifying gastric NHPH as follows. PCR amplifications and sequencing of urease gene were done according to O’Rourke et al. [7]. Urease genes were amplified using primer pairs U430F and U1735R. PCR products were purified using the Fast Gene Gel/PCR Extraction Kit (Nippon Genetics). The products were directly sequenced with the same primers and other primers (U850F, U1050R) using a BigDye Terminator cycle sequencing ready reaction kit and a 3500 Genetic Analyzer (Thermo Fisher Scientific). The sequences were compared with those in the NCBI GenBank (accession no. AB968247) by using the BLAST search tool (http://blast.ncbi.nlm.nih.gov/Blast.cgi).
All the extracted DNA was examined by urease PCR assay, and sequencing for identifying gastric NHPH using primers listed in Table 1. PCR cycling conditions were as follows; the first-round PCR with primer sets U430F and U1735R consisted of initial denaturation at 95℃ for 2 min; 40 cycles of 94℃ for 30 sec, 55℃ for 30 sec, and 72℃ for 1.5 min; followed by a final extension step of 72℃ for 7 min. For the second reaction with the primer sets U430F and U1050R, or U850F and U1735R, the 100-fold dilution of the first PCR products were used as the template; initial denaturation at 95℃ for 2 min; 35 cycles of 94℃ for 30 sec, 58℃ for 30 sec, and 72℃ for 1.5 min; followed by a final extension step of 72℃ for 7 min.
Table 1
Primers used for urease PCR and sequencing reactions
Primer
|
Target gene
|
Purpose
|
Sequence (5'–3')
|
Reference
|
U430F
|
Urease
|
PCR and sequencing
|
GCKGAWTTGATGCAAGAAGG
|
O’Rourke et al. [7]
|
U850F
|
Urease
|
PCR and sequencing
|
CAGCTGTGCGCTTTGAACCT
|
O’Rourke et al. [7]
|
U1050R
|
Urease
|
PCR and sequencing
|
TCTTCGCCATAAGTGGTGC
|
O’Rourke et al. [7]
|
U1735R
|
Urease
|
PCR and sequencing
|
CTTCGTGRATTTTAARRCCAAT
|
O’Rourke et al. [7]
|
Abbreviations: PCR, polymerase chain reaction.
|
O'Rourke et al. reported very high homology of urease genes within species or groups (> 97%), while homology between different species was low (73–83%) [7]. Although we did not set a clear cutoff for the identification of NHPH, 99–100% homology of the Urease gene in strains identified as Helicobacter suis (H. suis) and 97–98% in strains identified as Helicobacter heilmannii (H. heilmannii)/Helicobacter ailurogastricus (H. ailurogastricus).
2.4 Eradication therapy
Patients in whom NHPH species was identified by urease gene analysis were given a sufficient explanation of NHPH pathogenicity and eradication therapy, and then selected one of the following three options. After obtaining consent of those who selected the option 2) or 3), we started eradication therapy in each of them.
1) Follow-up without positive treatment.
2) Eradication with the first-line treatment regimen for eradication of H. pylori in Japan (the standard triple-drug combination therapy, that is administration of amoxicillin 750 mg twice a day, clarithromycin 200 mg twice a day, and vonoprazan 20 mg twice a day for seven days) at own expense.
3) Eradication with long-term administration of a proton pump inhibitor (PPI) alone at own expense (actually, taking esomeprazole 20 mg once daily on an empty stomach for about 6 months).
We had experienced and reported two cases of NHPH gastritis in which NHPH was unexpectedly eradicated by long-term administration of PPI as treatment for coexisting reflux esophagitis, albeit in a Japanese paper [8]. As this PPI monotherapy was not covered by Japanese health insurance for NHPH eradication, we obtained the approval of the ethics committee of our facility for the option 3) in addition to the option 2).
2.5 Determination of success or failure of eradication
In every case, EGD, microscopic examination, and urease gene analysis were performed 6 months after completion of eradication therapy to determine the success or failure of eradication.
2.6 Re-selection in case of eradication failure
Patients who were not successful in their first-round of eradication therapy were once again asked to select the other of the two aforementioned eradication therapies or follow-up without treatment as the second-round.