Unmusking of Protein Phosphatase 2 Regulatory Subunit B as a crucial factor in the development and progression of dilated cardiomyopathy

doi:10.21203/rs.3.rs-3305994/v1

Download PDF

Article

Unmusking of Protein Phosphatase 2 Regulatory Subunit B as a crucial factor in the development and progression of dilated cardiomyopathy

https://doi.org/10.21203/rs.3.rs-3305994/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Dilated cardiomyopathy (DCM) is one of the major causes of heart failure (HF). However, although significant progress was made in elucidating the underlying mechanisms, the actual therapeutic efforts are inefficient. Here we investigated the potential role of Ppp2r5d, a protein phosphatase 2A (PP2A) regulatory subunit for the development of DCM. We observed that the mRNA level of Ppp2r5d mRNA level was decreased and upregulated in the plasma of DCM patients. Knockdown of Ppp2r5d in murine cardiomyocytes increased the intracellular reactive oxygen species (ROS) levels and reduced ATP synthesis. In a mouse experimental DCM model, heart-specific Ppp2r5d knockdown aggravated the pathogenesis of DCM and induced HF. Mechanistically, Ppp2r5d-deficient cardiomyocytes indicated an elevation of the phosphorylation of Stat3 at the Y705 site, leading to the upregulation of hypertrophic genes such as Anp and Bnp and interleukin 6 (IL6). In parallel, Ppp2r5d-deficient cardiomyocytes indicated a decreased phosphorylation level of Stat3 at S727, an impaired mitochondrial electron transport chain, ATP synthesis and impaired ROS levels. Therefore, our results revealed a novel role of Ppp2r5d in regulating the phosphorylation of Stat3 in the heart, Ppp2r5d might be a potential target for preventing DCM.

Ppp2r5d

Stat3

phosphorylation

dilated cardiomyopathy

mitochondrial metabolism

Dilated cardiomyopathy (DCM) is characterized by dilated ventricles and impaired myocardial contractile capacity, leading to cardiac dysfunction, arrhythmias, and finally heart failure. Cardiomyocytes from DCM patients show a progressive increase in apoptosis, which results in compensatory hypertrophy of the healthy remaining cardiomyocytes. Several etiological conventional factors such as genetic mutations, autoimmune diseases, inflammatory and infectious factors, toxins, excessive alcohol consumption and chemotherapeutical drugs have been identified to promote DCM.¹ However, although significant progress has been made in elucidating stereotypic cellular and intracellular mechanisms contributing to the development of DCM there are still several till now unknown factors and mechanisms that should be considered as novel therapeutic targets of DCM. It is hoped that novel underlying mechanisms of DCM may advance the clinical therapeutic intervention of DCM.

We recently have identified the Protein Phosphatase 2 Regulatory Subunit B Delta (Ppp2r5d) mRNA showing higher levels in the plasma of both DCM and ischemic cardiomyopathy (ICM) patients (GEO: GSE138678) as compared to the plasma of healthy individuals.² An abnormally elevated Ppp2r5d mRNA level was also proven in the plasma of DCM mice. These findings suggest that Ppp2r5d may act as a diagnostic biomarker for DCM. The Ppp2r5d encodes for a Protein phosphatase 2A (PP2A), one of the four major Ser/Thr phosphatases negatively controlling cell growth and division. PP2A is consisting of a common heteromeric core enzyme with a catalytic subunit and a B regulatory subunit that might control the substrate selectivity and catalytic activity. PPP2R5D encodes for a delta isoform of the regulatory subunit B56 subfamily (https://www.ncbi.nlm.nih.gov/gene/21770).

Interestingly, it was shown that PPP2R5D is involved in neurodevelopment and tumour growth³ and Ppp2r5d missense mutation leads to abnormal neurodevelopment and mental retardation. ^4–6 On the other hand, stimulation of cardiomyocytes isoproterenol (ISO) induced B56δ phosphorylation at the Ser573 site, which inhibits PP2A activity and enhanced phosphorylation levels of intracellular cTnI Ser22/23 and cMyBP-C Ser282.⁷ The double knockout of Ppp2r5d and ppp2r5c arrested embryonic development at around 12 days, accompanied by apoptosis of heart tissue and by abnormal cardiac vascular development in mice.⁸ These results suggest that Ppp2r5d plays a crucial role in the development of cardiac diseases. To test this hypothesis, we investigated the role of Ppp2r5d in the development and progression of DCM. We demonstrated that Ppp2r5d knockdown in mice cardiomyocytes enhanced the inflammatory response and aggravated mitochondrial energy metabolism, thereby accelerating DCM progression. Our findings demonstrate for the first time that the Ppp2r5d plays a vital role in the pathogenesis of DCM.

Ppp2r5d is associated with DCM progression

Activation of β-adrenergic receptors (β-AR) by ISO can induce progressive left ventricular dilatation, cardiac dysfunction and fibrosis.^{9, 10} S ubcutaneous injections of ISO induced dilated left ventricle, as well as cardiac dysfunction.^{11, 12}. Here, a subcutaneous osmotic mini-pump was used to apply ISO for 2 weeks for DCM induction in mice. As shown in Fig. S1A and B cardiac dysfunction such as an increase in LVEDD and LEVSD, and a decrease in EF and FS was observed after 2 weeks of application of ISO. Meanwhile, some phenotypes, including enlarged heart size, dilated left ventricular, and aggravated myocardial fibrosis were also detected (Fig. S1 C, D, E), suggesting a successful application of the DCM model for proceeding with our animal studies.

We observed that Ppp2r5d mRNA levels were higher in the peripheral plasma of DCM patients than in the healthy controls (GEO: GSE138678) (Fig. 1A). In the peripheral plasma of DCM mice, the Ppp2r5d mRNA level was significantly higher as compared with the sham mice group (Fig. 1B). We also verified the mRNA expression level of Ppp2r5d in the ventricular tissues of the DCM mice. The results showed that the expression of Ppp2r5d was lower in DCM when compared with sham mice; However, no differences were found in myocardial infarction (MI) mice between the two groups (Fig. 1B). These findings gave the first evidence that Ppp2r5d might play a significant role in the development of DCM. To further confirm this novel role, we performed small-interfering RNA (siRNA) knock-down experiments in cultured mouse cardiomyocytes (MCMs) using siRNA-Ppp2r5d-3 (Fig. 1C). We further performed gene expression microarray experiments to identify the differential expressed genes in Ppp2r5d deficiency MCMs. The Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis revealed that the differentially expressed mRNAs in Ppp2r5d deficiency MCMs are highly associated with hypertrophic and DCM (Fig. 1D). A further real-time quantitative PCR (RT-qPCR) confirmed that knockdown of Ppp2r5d mRNA induced upregulation of natriuretic peptide A (Nppa), natriuretic peptide B (Nppb), and myosin heavy chain 7 (Myh7) (Fig. 1E). Collectively, these results indicate that there is an axis between Ppp2r5d and DCM.

Ppp2r5d knockdown increased oxidative stress in cardiomyocytes in vitro

Oxidative stress, characterized by the accumulation of reactive oxygen species (ROS), plays a striking role in the pathogenesis of DCM. Therefore, we measured the ROS level in Ppp2r5d deficient cardiomyocytes, which were stimulated with ISO that normally causes a strong elevation of the total ROS production including also mitochondrial ROS in intact cardiomyocytes.¹³ As shown in Fig. 2A, ISO increased the intracellular ROS, which was more pronounced in the Ppp2r5d deficient MCMs as compared with the control MCMs (Fig. 2A). Hydrogen peroxide (H₂O₂) is one of the major sources of intracellular ROS and is commonly used as a positive control to induce oxidative stress in vitro. As shown in Fig. 2B, H₂O₂ treatment significantly increased ROS levels in the control MCMs. Moreover, H₂O₂ treatment of the Ppp2r5d deficient MCMs significantly increased the intracellular ROS levels as compared to control intact MCMs (Fig. 2B). As expected, increased apoptosis of MCM was observed in H₂O₂-treated Ppp2r5d- deficient MCMs (Fig. S2A). Accordingly, also a significant increase of the cleaved caspase3 was observed (Fig. S2B). Dihydroethidium (DHE) was used to determine intracellular superoxide levels. After ISO stimulation, the DHE staining indicated a significant increase in ROS production between Ppp2r5d deficient MCMs and control MCMs (Fig. 2C). Collectively, our data showed that Ppp2r5d knockdown enhanced ROS generation in MCMs after ISO or H₂O₂ stimulation resulting in apoptosis of MCMs.

Ppp2r5d knockdown aggravates ISO-induced mitochondrial dysfunction in MCMs

Mitochondria are a major source of intracellular reactive oxygen species. There is a close link between excessive ROS production and mitochondrial dysfunction. To further investigate the effect of Ppp2r5d deficiency on mitochondrial energy metabolism and function, we compared the intracellular level of ATP in Ppp2r5d-deficient MCMs with the level in control MCMs. In comparison to the control MCMs, the basal ATP production was significantly reduced and a stronger reduction was observed in ISO-stimulated MCMs (Fig. 3A). ATP is produced by both the mitochondrial-independent process of glycolysis mainly by the mitochondrial-dependent oxidative phosphorylation process, suggesting that the Ppp2r5d deficiency may attenuate mitochondrial biogenesis and/or mitochondrial respiration in MCMs. Bioenergetic profiles of MCMs were determined by the Seahorse XF cell Mito stress test and calculating the oxygen consumption rate (OCR) as an indicator of mitochondrial respiration. The OCR assay data were not statistically different in the groups treated without ISO. In addition, ISO-stimulated Ppp2r5d deficient MCMs showed a more significant decrease in basal respiration, maximal respiration, spare respiratory capacity, proton leak, and ATP production as compared to the control group (Fig. 3B and 3C). These results indicated that Ppp2r5d deficiency aggravated the ISO-induced mitochondrial dysfunction in vitro.

Ppp2r5d knockdown aggravates cardiac dilation and HF in vivo

To evaluate the potential role of Ppp2r5d in DCM progression, adeno-associated virus (AAV) Serotype 9 was used to mediate cardiomyocyte-specific knockdown of Ppp2r5d (Fig. S3A). According to a previous study, mitochondrial dysfunction results in reduced energy metabolism, resulting in the development of DCM.¹⁴ Based on the findings that Ppp2r5d knockdown aggravated the ISO-induced mitochondrial respiratory capacity in cardiomyocytes, we hypothesized that Ppp2r5d deficiency may aggravate the DCM in vivo. For this aim, we injected AAV with sh-Ppp2r5d in situ into the ventricle of the ISO-induced DCM mice. As a negative control experiment, AAV-shNC was injected into the ventricles of the mice. The protocol for the animal experiment is described in Fig. 4A. Six weeks after ISO infusion the cardiac function of both the AAV-sh-Ppp2r5d&ISO mice and the control AAV-shNC&ISO mice was evaluated using echocardiography. In comparison to the sham group, the ISO-treated mice indicated an increase in left ventricular diameter and volume associated with a decreased left ventricular fractional shortening (FS) and ejection fraction (EF).

Notably, the differences were more prominent in the AAV-sh-Ppp2r5d&ISO group than those in the control AAV-shNC&ISO group (Fig. 4B, 4C). Consistent with the echocardiography results, the heart size (Fig. 4D), the heart weight to body weight ratio (HW/BW) (Fig. 4E), and the heart weight to tibia length ratio (HW/TL) (Fig. 4F) were markedly higher in the ISO infusion groups. Furthermore, the heart size (Fig. 4D), the HW/BW (Fig. 4E), and the HW/TL (Fig. 4F) were also notably increased in AAV-sh-Ppp2r5d&ISO mice. We further examined the mRNA levels of Nppa, Nppb, and Myh7 in the left ventricle. The data revealed that the ISO treatment increased the mRNA expression of the genes, in particular in the Ppp2r5d deficient group in comparison to the vehicle group (Fig. 4G). Consistently, Masson staining of heart tissue in the AAV-sh-Ppp2r5d&ISO group revealed that Ppp2r5d deficiency aggravated the ISO-induced cardiac fibrosis (Fig. 4H).

Previous studies have demonstrated a positive correlation between compromised mitochondrial bioenergetics and reduced oxidative phosphorylation, which can be caused by mitochondrial abnormal function.^{15, 16} Based on the observation that Ppp2r5d deficiency aggravated the ISO-induced mitochondrial dysfunction in vitro (Figs. 2 and 3), we further investigated how Ppp2r5d deficiency affects mitochondria morphology in vivo. Alterations in the ultrastructures were observed by TEM. In the sham group, the mitochondria were intact and the myofilaments were neatly distributed. The mitochondria of left ventricular tissues in AAV-shNC&ISO mice displayed some ultrastructural abnormalities such as swelling, vacuolization, and even ruptured membranes (Fig. 4I). Nevertheless, the right ventricular tissue of the AAV-shNC&ISO mice showed no obvious abnormalities. In contrast to the empty vehicle control DCM mice, the Ppp2r5d deficient DCM mice indicated abnormalities in both the left and right ventricles. The left ventricular tissues contained aberrant mitochondria and dissociated myofilaments. Similarly, the right ventricular tissues contain numerous abnormal mitochondria along with well-organized myofilaments (Fig. 4I). We further quantified the size of mitochondria, the number of mitochondria, and the ratio of abnormal mitochondria in each field as shown in Fig. 4J. The results indicated mitochondrial dysfunction in the hearts of AAV-shNC&ISO mice due to ISO treatment and Ppp2r5d deficiency aggravating cardiac dilation and heart failure in vivo.

Ppp2r5d knockdown Impaired ETC complex activity

Normally, electron transport along the mitochondrial electron transport chain (ETC) complex I, II, III, and IV creates an electrochemical proton gradient, which is utilized by ATP synthase to generate ATP. Based on the observation that Ppp2r5d deficiency decreased ATP production (Fig. 3) and increased ROS generation (Fig. 2) in MCMs after ISO stimulation, we assumed that the impaired ETC capacity may be the major mitochondrial event contributing to the development of the MCMs observed by a Ppp2r5d deficiency. Therefore, the expression of the ETC Complexes participating genes was investigated. After ISO treatment, Ppp2r5d deficiency triggered a significant decrease in some mitochondrial genes related to ETC complexes I, II, III, and V, including Ndufv1, Sdhb, Eyc1, Uqcrc2, and Atp5a1 (Fig. 5A). Also, ISO-stimulated Ppp2r5d deficient MCMs showed low protein levels of Ndufb8 and Sdhb, both participating to ETC complex I and II in MCMs (Fig. 5B). We also examined the activity of the ETC complexes considering the differential expression of genes, observed in Ppp2r5d deficient MCMs after ISO stimulation. Consistently, the activity of ETC Complexes I was significantly decreased in Ppp2r5d deficiency with ISO stimulation (Fig. 5C). In contrast to ETC Complexes I, no differences in the ETC Complex II activity were observed (data not shown). Taken together, these data revealed that Ppp2r5d deficiency impaired the activity of the ETC Complexes I, thereby aggravating the ISO-induced cardiac dysfunctions.

Ppp2r5d knockdown induces Stat3 bidirectional phosphorylation after ISO stimulation

As a regulatory subunit of PP2A (serine/threonine protein phosphatase 2A), Ppp2r5d regulates signal transduction pathways by dephosphorylation of phosphorylated targets. To identify the mechanisms underlying mitochondrial dysfunction in Ppp2r5d deficient&ISO cardiomyocytes, we performed western blotting to detect phosphorylated proteins associated with cardiac hypertrophy.

As a member of the signal transducer and activator of transcription (STAT) proteins family, Stat3 is localized primarily in the cytoplasm. Once phosphorylated, Stat3 altered its intracellular localization.¹⁷ Apart from tyrosine residue 705, the serine residue 727 of Stat3 can also be phosphorylated.¹⁸ Emerging evidence indicates that the functions of phosphorylation at these two sites are quite different. Wegrzyn et al. reported that the Ser727-phosphorylated Stat3 (mtStat3) is constitutively located in the mitochondria and modulates cellular respiration and metabolism in mouse liver and pro-B cells ¹⁸. Another study demonstrated that mt Stat3 functions in mitochondria to reduce ROS production mediated by the ETC complex and acts protectively for cardiac tissues against ischemia/reperfusion injury.¹⁹ Since heart tissues require a large amount of ATP which is produced by mitochondria to maintain physiological function²⁰, mitochondrial dysfunction contributes to cardiac dysfunction in DCM.²¹ As previously demonstrated, a loss of mtStat3 in cardiomyocytes increased the risk of chronic pathological injury and worsens the metabolic function of cardiomyocytes.²² Also, mtStat3 interacts with GRIM-19, a component of the ETC Complex I, and subsequently enhances the activity of Complex I and Complex II.^18,23 Western blotting revealed that the phosphorylated level of mtStat3 (Ser727) was decreased in Ppp2r5d deficient MCMs as compared to the vehicle-treated group while the total Stat3 proteins remained unchanged after ISO treatment. In parallel, the phosphorylation of Stat3 (Tyr705) was increased in Ppp2r5d deficient group compared with the vehicle group (Fig. 6). Thus, mtStat3 downregulation caused by Ppp2r5d deficiency after ISO treatment could regulate the ETC complex activity, which exacerbates the ISO-induced mitochondrial dysfunction.

Ppp2r5d knockdown increases the expression of IL6 after ISO stimulation in vitro

By phosphorylating Stat3 at the Y705 site, Stat3 forms dimers,^{24, 25} translocating into the nucleus, thus mediating the transcription of downstream genes including IL6.²⁴ Our data showed that Ppp2r5d deficiency increased the phosphorylation of Stat3 (Tyr705) in cardiomyocytes after ISO treatment (Fig. 6). To investigate whether Ppp2r5d regulates IL6 expression through Stat3, we evaluated the expression of IL6 in cardiomyocytes by RT-qPCR and quantify the IL6 level by ELISA. Stimulation of the cardiomyocytes with ISO increased the mRNA expression of Anp, Bnp, and IL6 in both in Ppp2r5d deficient MCMs and control cells (Fig. 7A). As expected, the IL6 mRNA level was significantly increased in Ppp2r5d deficient cells as compared to the control cells after the ISO stimulation (Fig. 7A). Moreover, the protein level of IL6 in Ppp2r5d deficient MCMs was also significantly higher than in the control cells (Fig. 7B). Finally, the IL6 mRNA and protein were also upregulated in Ppp2r5d deficient primary neonatal mouse cardiomyocytes (NMVM) after ISO stimulation (Fig. 7C, 7D). To further investigate the association between the IL6 expression and Stat3 phosphorylation (Tyr705) in Ppp2r5d deficient MCMs, we used an inhibitor (S3I-201) to inhibit Tyr705 phosphorylation of Stat3.²⁶ The addition of S3I-201 could reverse the upregulation of IL6 expression which is caused by the Ppp2r5d deficiency after ISO stimulation (Fig. 7E, 7F). Thus, we may conclude that loss of Ppp2r5d in cardiomyocytes leads to IL6 upregulation via an increase in Stat3 Y705 phosphorylation.

In summary, the knockdown of Ppp2r5d in combination with ISO treatment of cardiomyocytes, increased phosphorylation of Stat3 at the Y705 site, leading to the upregulation of ANP, BNP, and IL6 expression. In parallel the phosphorylation level of Stat3 at the S727 site was decreased, which impairs the efficacy of the electron transport chain, thus leading to massive ROS production. Furthermore, our in vivo, experiments showed that Ppp2r5d could exacerbate ISO-induced ventricular dilation and HF. Overall our findings unmask Ppp2r5d as a crucial factor in the development and progression of DCM and offered a novel therapeutic target for the treatment of clinical DCM.

In the current study, we investigate the role of Ppp2r5d in the pathogenesis of DCM. We demonstrated that Ppp2r5d knockdown in cardiomyocytes and stimulation of cardiomyocytes with β-adrenoreceptor agonist ISO reduced mtStat3 levels, decreased the ETC complex activity, reduced the production, elevated the intracellular ROS levels, and exacerbated myocardial apoptosis. Moreover, Ppp2r5d knockdown in cardiomyocytes impaired the expression of hypertrophic markers and IL6 in response to ISO stimulation. Interestingly, myocardial-specific Ppp2r5d deficient mice exhibited an abnormal DCM-related phenotype showing enlarged ventricles, abnormal cardiac dysfunction, and accelerated ventricular remodelling. In addition, exacerbated mitochondrial damage in the DCM mouse model was observed. The present findings provide evidence that Ppp2r5d plays an important role in the pathogenesis of DCM.

Several processes such as inflammation, viral infection, and chemotherapeutic agents contribute to the development of DCM that ultimately leads to ventricular enlargement and HF. DCM is manifested by enlarged ventricles and impaired cardiac contractility in response to different causal stressors. Recently, we found elevated levels of the Ppp2r5d mRNA in the peripheral plasma of patients with DCM.² This abnormal expression of Ppp2r5d mRNA was also observed in the heart tissue of DCM mice, which motivated us to further explore the potential role of Ppp2r5d in DCM. It has been reported that the B56δ protein, encoded by Ppp2r5d, regulates numerous critical biological processes such as DNA replication, and mitosis via distinct signal transduction pathways.^{27, 28} The primary form of PP2A is a heterodimeric trimeric complex consisting of a catalytic C subunit, a scaffold A subunit, and a regulatory B subunit. The regulatory B subunits comprise a large group of genetically and structurally diverse proteins that fall into four categories, B/B55, B′/B56, B′′/PR72, and B′′′/striatins. In mammals, B′/B56 contains five spliceosomes: B56α, B56β, B56γ B56δ, B56ε. Previous studies of B56δ were focused on developmental disorder syndromes such as mental retardation, epilepsy, macrocephaly, and developmental delay.^{4, 29}Ppp2r5d knockdown promotes tumorigenesis and malignant development by enhancing phosphorylation at the Ser9 site of GSK-3β and the Ser62 site of the proto-oncogene C-myc.³ A recent study reported that the B56δ E420K mutation led to an overactive AKT-mTOR signalling pathway by regulating AKT, GSK3α, and S6 hyperphosphorylation, resulting in an uncoordinated cell proliferation.²⁹ Another study also revealed that inhibition of tumorigenesis can be achieved through the PP2A/GSK3β/MCL-1 pathway. Under hypoglycemia/metformin treatment, upregulated Ppp2r5d dephosphorylated GSK-3β, leading to a decline in MCL-1 and cell death.³⁰ ISO stimulation enhanced PP2A activity by upregulating B56δ Ser573 phosphorylation and subsequently by elevated intracellular phosphorylation of cTnI at Ser22/23 and cMyBP-C at Ser282 in cardiomyocytes.⁷ These findings give strong evidence for a potential function of Ppp2r5d in cardiomyopathy, although the mechanism remains unclear.

As we mentioned previously, our microarray data showed that the Ppp2r5d mRNA level is significantly altered in the peripheral blood of DCM patients. Moreover, our results revealed that the Ppp2r5d mRNA level is significantly downregulated in the cardiac tissue of DCM mice, but not in MI mice. Surprisingly, the microarray results showed that Ppp2r5d deficiency resulted in highly enriched differential expressed genes participating in pathways associated with hypertrophic and DCM. These results gave further evidence that Ppp2r5d is associated with DCM.

Next, we found that Ppp2r5d deficient MCMs are more sensitive to the detrimental cellular effects of the ISO- and H₂O₂-induced ROS. Intracellular ROS levels were significantly upregulated in the Ppp2r5d knockdown group as compared to the control group. Indeed, an excess of ROS is associated with mitochondrial dysfunctions and DCM is associated with oxidative stress and inflammation.³¹ Our results also demonstrated that the Ppp2r5d deficiency contributes to the reduction of intracellular ATP levels in non-stimulated and ISO-stimulated cells. We further revealed that the baseline mitochondrial respiration, ATP production, and maximal oxygen consumption were considerably reduced in the Ppp2r5d deficient MCMs as compared with the control cells under ISO stimulation. In vivo experiments, DCM mice which were treated with AAV-shRNA‐Ppp2r5d displayed severe cardiac dysfunction, ventricular fibrosis, a ventricular dilatation in comparison to the vehicle control group. Additionally, the ventricles of the Ppp2r5d deficient DCM mice indicated significantly more myofilaments and mitochondrial damages than those of the ventricles of the vehicle-treated DCM mice. Based on these results, we postulated that Ppp2r5d deficiency aggravates cardiac injury by promoting mitochondrial dysfunction. Therefore, we tested the expression levels of genes associated with ETC and ATP synthesis. During ISO treatment, the mRNA levels of Ndufv1, Sdhb, Cyc1, Uqcrc2, and Atp5a1, as well as the NdufB8 and Sdhb protein levels, were down-regulated in the Ppp2r5d knockdown MCMs. Moreover, the activity of the ETC complex I was impaired in the Ppp2r5d deficient MCMs after ISO stimulation.

Stat3 belongs to the STAT protein family and can be phosphorylated at two sites. For instance, the S727 site phosphorylation drives Stat3 into mitochondria (mtStat3) and is strictly related to mitochondrial electron transport chain activity.^32–34 In this context, it was reported that mtStat3 increases the activity of ETC complexes I and II.¹⁸ Moreover, phosphorylation of the Y705 site drives Stat3 into the nucleus in which it acts as a transcriptional activator, which may be involved in the pathophysiology of cardiomyopathy. This hypothesis is strongly supported by the observation that inhibiting Stat3 Y705 site phosphorylation in a rat model of stress-induced cardiac hypertrophy significantly improved cardiac function.³⁵ We also found that Stat3 phosphorylation levels were altered. Our data confirmed an increase in STAT3 Tyr705 phosphorylation and a decrease in Stat3 Ser727 phosphorylation in the Ppp2r5d deficient group, treated with ISO. The phosphorylation of Stat3 might induce mitochondrial dysfunctions and increase the expression of IL6 in cardiomyocytes. IL-6 contributes to the development of interstitial fibrosis in DCM.

Collectively, these data suggest that Ppp2r5d is involved in the development of DCM and may represent a turning point in the elucidation of the DCM pathogenesis. A possible mechanism is presented in Fig. S4. We hypothesize that Ppp2r5d regulates the Stat3 phosphorylation to maintain mitochondria depending on energy homeostasis in normal functional myocardial tissue. Ppp2r5d is downregulated in cardiomyocytes during DCM development, which promotes mitochondrial dysfunction, and apoptosis in cardiomyocytes as well as aggravates myocardial fibrosis and ventricular remodelling.

However, although we identified the Ppp2r5d-dependent axis controlling the intact function of cardiomyocytes which is dysbalanced by the DCM pathogenesis, there are still open questions that should be answered in the future. It is not clear whether Ppp2r5d alone or via interactions with other cellular compounds modulates the Stat3 phosphorylation level. Finally, rescue experiments are needed to restore the function of Ppp2r5d in deficient pp2r5d cardiomyocytes thereby delaying the progression of DCM.

Animals studies

Four to 6 weeks-old male C57BL/6J mice, (16-20g), were purchased from Vital River (Beijing, China). All animal experiments were approved by the Animal Care and Use Committee of Tongji University (Permit Number: TJAA00222101). The procedures followed the National Institutes of Health guidelines for the care and use of experimental animals. The DCM in the animals was induced by ISO treatment. Briefly, the mice were implanted subcutaneously with osmotic mini-pumps (RWD Life Science; 2002W), circulating ISO (Med Chem Express; 80 mg/kg/day in saline physiological solution) for two weeks. In parallel, the four animals of the sham group were treated only with the saline physiological solution for the same period.

The myocardial-specific Ppp2r5d knockdown was induced by adeno-associated virus 9 (AAV9) carrying shRNA against Ppp2r5d (AAV9-shRNA-Ppp2r5d-GFP) driven with a cTnT promoter via

tail vain injection (shRNA-Ppp2r5d group, n = 4, 5 × 10¹¹ viral particles per animal in 100 µL, Hanheng Biotechnology). Mice who received the same amount of AAV9-shRNA-NC (shRNA-NC group, n = 4, 5 × 10¹¹ viral particles per animal in 100 µL, Hanheng Biotechnology) served as the control group. After 4 weeks, the Ppp2r5d knockdown efficiency was assessed by RT-qPCR and Western blotting (WB). Then, the mice of shRNA-Ppp2r5d and the control shRNA-NC group were implanted subcutaneously with osmotic mini-pumps circulating ISO to induce DCM as described above. After additional six weeks, echocardiography was performed, and cardiac tissues were collected for histological and biochemical analysis. A flow diagram of the animal experiment was summarized in Fig. 4A.

Cell culture

MCM were purchased from ScienCell research laboratories. Cells were cultured in DMEM (Hyclone) supplemented with 2% fetal bovine serum (FBS) at 37°C in a humidified 5% CO₂ – 95% air atmosphere. Primary neonatal mouse cardiomyocytes Cells were cultured in DMEM (Hyclone) supplemented with 10% fetal bovine serum (FBS) at 37°C in a humidified 5% CO₂ – 95% air atmosphere.

The neonatal mouse cardiomyocytes were isolated according to the kit instructions (AC-1002016, Applied cell, China). In brief, the ventricles of the hearts from P1 or P2 neonatal mice were rinsed with washout buffer and minced into 1 ~ 3 mm tissue fragments. The initial digestion with mouse cell dissociation solution I was carried out overnight at 4℃, followed by repeated treatment with dissociation solution II at 37℃ until full dissociation of the cells. The resulting cell suspension encompassed both myocyte and non-myocyte cells were pooled and then purified by differential adhesions. The purified cardiomyocytes were transfected with siRNA for subsequent experiments.

RNA interference

To knockdown Ppp2r5d, the interfering RNA (siRNA) against Ppp2r5d or the negative control (NC) siRNA were transfected into MCMs with Lipofectamine™ RNAiMAX transfection reagent (13778030, Thermo Fisher, USA) according to the manufacturer’s instructions. The siRNA sequences were as as follows: siRNA-Ppp2r5d-1: 5’-GCCTTGAAAGACTCACCAA-3’; siRNA-Ppp2r5d-2: 5’-CTCCAGATTTCCAGCCAAA-3’; siRNA-Ppp2r5d-3: 5’-AGATCAACCACATCTTCTA-3’. The knockdown efficiency was evaluated at 48 h after transfection by real-time quantitative (RT-qPCR) and Western blotting. Then the cells were used for further experiments.

Flow cytometry analysis

MCMs were treated with hydrogen peroxide (H₂O₂) at different concentrations for 16 h. Apoptosis was detected by Annexin V-APC/PI apoptosis detection kit (3801660, Sony Biotechnology, San Jose, CA, USA) according to the manufacturer’s instructions. For ROS) measurements, cells were treated with ISO (50 µM) or H₂O₂ (600 µM) for 6 h and stained by applying the Reactive Oxygen Species Assay Kit (S0033S, Beyotime) according to the manufacturer’s instructions.

Microarray gene expression studies

The Agilent SurePrint G3 Mouse Gene Expression v2 Microarrays (8x60K, DesignID:074809) were used and data analysis was conducted by OE Biotechnology Co., Ltd., (Shanghai, China).

Total RNA was quantified by the NanoDrop ND-2000 (Thermo Scientific) and the RNA integrity was assessed using Agilent Bioanalyzer 2100 (Agilent Technologies). Sample labelling, microarray hybridization, and washing steps were performed based on the manufacturer’s standard protocols. Briefly, total RNA was reversely transcribed to double-strand cDNA and then synthesized cRNA was labelled with Cyanine-3-CTP for hybridizing onto the microarray. After washing, the arrays were scanned by the Agilent Scanner G2505C (Agilent Technologies). Feature Extraction software (version 10.7.1.1, Agilent Technologies) was used to acquire raw data. The Genespring software (version 14.8, Agilent Technologies) was applied for the basic analysis. The statistically significant differentially expressed genes were then identified (fold ≥ 2.0 and P value ≤ 0.05 by t-test). GO and KEGG enrichment analysis of differentially expressed genes were conducted using the R statistical software based on the hypergeometric distribution. Hierarchical Clustering was performed to display the distinguishable gene expression pattern between the different samples.

ATP concentration assessments

MCMs were initially transfected with siRNA-Ppp2r5d and control siRNA-NC. The ISO treatment began 48 h after siRNA transfection. Cells were harvested 18 h later for in vitro adenosine triphosphate (ATP) concentration analysis. The levels of ATP were detected with an ATP assay kit (S0027, Beyotime, China) according to the manufacturer’s instructions.

Dihydroethidium (DHE) Staining

DHE staining (S0063, Beyotime, China) was performed to assess the superoxide generation. MCMs were trypsinized and seeded onto coverslips 2 days after transfecting with siRNA- Ppp2r5d and siRNA- NC. The coverslips were exposed to ISO for 18 h before being treated with DHE (2 µM) for 1 h at 37°C and then inspected by fluorescence microscope.

Real-time quantitative PCR

RNA was extracted with TRNzol (DP424, TIANGEN, China). The cDNA was synthesized using a PrimerScript™ RT Master Mix (RR036, Takara, China). Quantitative reverse transcription polymerase chain reaction (RT-qPCR)analysis was conducted with SYBR™ green master mix according to the manufacturer’s protocol (4385617, ThermoFisher, USA). The expression of target genes was normalized to the expression level of β-actin using the 2 − ΔΔCt cycle threshold method. The sequence of primers was listed in Table 1.

Table 1

Primer sequence
Gene	Sequence
Mouse Nppa forward	TACAGTGCGGTGTCCAACACAG
Mouse Nppa reverse	TGCTTCCTCAGTCTGCTCACTC
Mouse Nppb forward	TCCTAGCCAGTCTCCAGAGCAA
Mouse Nppb reverse	GGTCCTTCAAGAGCTGTCTCTG
Mouse IL6 forward	TACCACTTCACAAGTCGGAGGC
Mouse IL6 reverse	CTGCAAGTGCATCATCGTTGTTC
Mouse Myh7 forward	GCTGGAAGATGAGTGCTCAGAG
Mouse Myh7 reverse	TCCAAACCAGCCATCTCCTCTG
Mouse Ppp2r5d forward	GAACACAAGGTGTTTCTCGTCCG
Mouse Ppp2r5d reverse	TCCTTCTCCAGGAACTGCACCA
Mouse β-actin forward	CATTGCTGACAGGATGCAGAAGG
Mouse β-actin reverse	TGCTGGAAGGTGGACAGTGAGG

Enzyme-linked immunosorbent assay (ELISA)

The supernatant of cell cultures after 3 days of transfection was collected and centrifuged to remove cell debris. The Interleukin 6 (IL6) concentration was determined by a commercial ELISA kit according to the manufacturer's instructions, (EK206/3–96, MultiScience, China).

Mitochondrial respiration assay

The Seahorse XFe96 assay (Agilent Technologies) was used to measure the oxygen consumption rate (OCR) of MCM. MCM were transfected with Ppp2r5d-siRNA and NC-siRNA. For this aim, 1.5× 10⁴ cells were seeded in customized Seahorse 96-well plates and treated with ISO (50 µM) for 18 h. Then, the medium was replaced with DMEM Medium (Seahorse Bioscience), supplemented with 1 mM pyruvate, 2 mM glutamine, and 10 mM D-glucose. The OCR was calculated using the Seahorse Bioscience XF96 Extracellular Flux Analyzer (Seahorse Bioscience). Measurements were made as the cells were incubated sequentially under four conditions: (1), basal levels were measured in the absence of additives; (2), oligomycin (1.5 µM) was added to reversibly inhibit OXPHOS and thus ATP synthase to measure the glycolytic ATP synthesis; (3), FCCP (1 µM), a mitochondrial uncoupler, was added to induce the inhibition of the OXPHOS depending ATP generation and (4), Antimycin A (10 µM), a Complex I inhibitor and mitochondrial poison was added to stop the OXPHOS depending ATP synthesis. The ATP production under the fourth different conditions was calculated using Wave Software according to the manufacturer (Agilent Technologies). OCR was normalized to cell numbers per well.

Assay of intracellular reactive oxygen species

To measure intracellular ROS levels, the 2',7'-dichlorofluorescein diacetate (DCFH-DA) dye was used as described by the manufacturer's instructions (S0033, Beyotime, China). In brief, MCM cells from control, siRNA-NC, and siRNA-Ppp2r5d groups were incubated with DCFH-DA (10 µM) for 1 h at 37°C, following three times washing with serum-free Dulbecco's modified Eagle’s medium (DMEM). The DCF fluorescence was immediately determined with flow cytometry (BD LSRII flow cytometer, excitation/ emission: 495/525 nm).

Mitochondria isolation, ETC activity assay

Mitochondria from MCM were isolated using a mitochondrial isolation kit (MM-038, Invent Biotechnologies, USA). and then the activity of electron Transport Chain (ETC) complex I in the purified mitochondria was determined according to the manufacturer’s protocol (BC0515, Solarbio, China). Briefly, the activity was quantified by measuring the oxidation of NADH at 340 nm according to the manufacturer’s instructions. Protein content was determined by the Bicinchoninic Acid (BCA) method, and values were expressed as activities in nanomoles substrate consumed per minute per milligram of protein.

Immunofluorescence staining

Immunostaining was performed as previously described.³⁶ Briefly, MCMs on coverslips were fixed with 4% paraformaldehyde (P0099, Beyotime, China) for 30 min and then permeabilized with 0.1% TrionX-100. After twice washing with PBS, the cells were blocked with 10% BSA and then incubated with anti-α-actinin (ab68194, Abcam) overnight at 4°C. Subsequently, the cells were washed and incubated with fluorescent secondary antibodies (1:1,000). Finally, the cover slides were counterstained with DAPI.

Tissue histopathology

After the echocardiography assessment, the heart tissues were fixed, embedded in paraffin and sectioned. Masson’s trichrome staining was used to assess fibrosis in the heart sections. Images were captured by fluorescence microscopy (Leica Microsystems, Wetzlar, Germany).

Echocardiography

Cardiac performance was evaluated 6 weeks post&ISO infusion by echocardiography. Mice were anaesthetized with isoflurane (2% isoflurane for induction and 1% for maintenance). The left ventricular images were obtained in the parasternal long-axis view using a Vevo 2100 Imaging System (Fujifilm VisualSonics) with a 30-Mhz MicroScan transducer (model MS-400). As previously described, LV mass and functional parameters were calculated, as EF percentage and fractional shortening.³⁷

Transmission electron microscopy (TEM) analysis

Heart tissues were rapidly fixed with 2.5% glutaraldehyde for 2 h and then trimmed to 1 ~ 3 mm in size. After three times washing with 0.1M phosphate buffer, the tissues were fixed with 1% osmic acid at 4°C for 2 h, then, were rinsed and gradient-dehydrated through graded ethyl alcohols. After being embedded in Epon-Araldite resin, the resulting masses were polymerized in the copper. The semi-thin sections were first used for positioning and the ultrathin sections were then made for microstructure analysis. Following the counterstaining with 3% uranyl acetate and 2.7% lead citrate, the specimens were checked under an HT7800 transmission electron microscope. The images were finally analyzed using ImageJ to quantify the mitochondria surface area (µm²) and perimeter (µm).

Western blotting

The total protein was extracted from MCMs with RIPA lysis buffer containing phosphatase and protease inhibitors (P0013B, Beyotime, China) and the protein concentrations were quantified using the BCA Protein Assay Kit (P0010, Beyotime, China). The protein samples were separated by SDS-PAGE and then transferred to the hydrophobic PVDF membrane. The blotted membranes were incubated with primary antibodies at 4 ℃ overnight and then incubated with specific secondary antibodies at room temperature for 1 h. The targeted proteins were visualized by enhanced chemiluminescence (34094, ThermoFisher, USA) using Tanon 1600 apparatus (Tanon, China) according to the manufacturer’s instructions. The optical intensity of the blotted bands was quantified using the ImageJ software. The following primary antibodies were used: anti-Phospho-Stat3 (Y705) (9145, CST, USA); anti-Phospho-Stat3 (S727) (9136, CST, USA); anti- Stat3 (4904; CST, USA); anti-Ppp2r5d (B56δ) (12068-1-AP, Proteintech, China); anti-GADPH-HRP (Pab001H, ESscience, China); anti-VDAC1/2 (10866-1-AP, Proteintech, China); anti-Total OXPHOS Rodent WB antibody Cocktail (ab110413, Abcam, UK).

Statistical analysis

All data were presented as mean ± SEM. Statistical analyses were performed using GraphPad Prism 5.04 software. Comparisons between two groups were analyzed by unpaired Student's t-test, and comparisons between more than two groups were analyzed by one-way ANOVA followed by the Bonferroni test. A value of p < 0.05 was considered statistically significant. Data were analyzed as defined in the figures using the Wilcoxon signed-rank test, Mann-Whitney U test, or 1-way ANOVA with Fisher’s LSD test as appropriate.

DATA AVAILABILITY

Microarray data have been deposited to the NCBI Gene Expression Omnibus under the accession number GEO: GSE238141. The data that support the findings of this study are available from the corresponding author upon reasonable request

ACKNOWLEDGEMENTS

Funding

This research was supported by the National Natural Science Foundation of China (32071109,82070270, M-0048), the Shanghai Committee of Science and Technology (22ZR1463800, 21ZR1467000) and CAMS Innovation Fund for Medical Sciences (2019‐I2M‐5‐053); Li Li is a fellow at the Collaborative Innovation Center for Cardiovascular Disease Translational Medicine, Nanjing Medical University.

AUTHOR CONTRIBUTIONS

Luying Peng, Huimin Fan, Li Li: conception and project design, manuscript revision, project supervision; Fang Lin: performed the experiments, data analysis, and manuscript writing; XiaoTing Liang: provided suggestions on data analysis, manuscript revision; Yuping Zhu, Yilei Meng, Na Yi: provided assistance on the construction of the plasmid; Luying Peng, Agapios Sachinidis: final approval of manuscript; Jie Sheng: provided assistance on the culture of neonatal mouse cardiomyocytes; Xiaohui Zhou, Qin Lin, Siyu He, Sangyu Hu: provided assistants on data analysis; All authors: discussion of the manuscript.

Competing interests

The authors declare no conflict of interest.

Schultheiss, H.P. et al. Dilated cardiomyopathy. Nat Rev Dis Primers 5, 32 (2019).
Lin, F. et al. Distinct Circulating Expression Profiles of Long Noncoding RNAs in Heart Failure Patients With Ischemic and Nonischemic Dilated Cardiomyopathy. Frontiers in Genetics 10 (2019).
Lambrecht, C. et al. Loss of protein phosphatase 2A regulatory subunit B56delta promotes spontaneous tumorigenesis in vivo. Oncogene 37, 544-552 (2018).
Biswas, D., Cary, W. & Nolta, J.A. PPP2R5D-Related Intellectual Disability and Neurodevelopmental Delay: A Review of the Current Understanding of the Genetics and Biochemical Basis of the Disorder. Int J Mol SciArch Biochem BiophysBasic Res CardiolFront Cell Dev BiolPLoS One 21 (2020).
Shang, L. et al. De novo missense variants in PPP2R5D are associated with intellectual disability, macrocephaly, hypotonia, and autism. Neurogenetics 17, 43-49 (2016).
Yan, L. et al. A Novel Missense Variant in the Gene PPP2R5D Causes a Rare Neurodevelopmental Disorder with Increased Phenotype. Biomed Res Int 2021, 6661860 (2021).
Ranieri, A., Kemp, E., Burgoyne, J.R. & Avkiran, M. beta-Adrenergic regulation of cardiac type 2A protein phosphatase through phosphorylation of regulatory subunit B56delta at S573. J Mol Cell Cardiol 115, 20-31 (2018).
Dyson, J.J., Abbasi, F., Varadkar, P. & McCright, B. Growth arrest of PPP2R5C and PPP2R5D double knockout mice indicates a genetic interaction and conserved function for these PP2A B subunits. FASEB Bioadv 4, 273-282 (2022).
Brooks, W.W. & Conrad, C.H. Isoproterenol-induced myocardial injury and diastolic dysfunction in mice: structural and functional correlates. Comp. Med. 59, 339-343 (2009).
Wong, Z.W., Thanikachalam, P.V. & Ramamurthy, S. Molecular understanding of the protective role of natural products on isoproterenol-induced myocardial infarction: A review. Biomed Pharmacother 94, 1145-1166 (2017).
Grant, M.K.O., Abdelgawad, I.Y., Lewis, C.A., Seelig, D. & Zordoky, B.N. Lack of sexual dimorphism in a mouse model of isoproterenol-induced cardiac dysfunction. PLoS One 15, e0232507 (2020).
Walsh-Wilkinson, E., Arsenault, M. & Couet, J. Segmental analysis by speckle-tracking echocardiography of the left ventricle response to isoproterenol in male and female mice. PeerJ 9, e11085 (2021).
Zhang, J., Xiao, H., Shen, J., Wang, N. & Zhang, Y. Different roles of beta-arrestin and the PKA pathway in mitochondrial ROS production induced by acute beta-adrenergic receptor stimulation in neonatal mouse cardiomyocytes. Biochem Biophys Res Commun 489, 393-398 (2017).
Ramaccini, D. et al. Mitochondrial Function and Dysfunction in Dilated Cardiomyopathy. Front Cell Dev Biol 8, 624216 (2020).
Zhuang, L. et al. DYRK1B-STAT3 Drives Cardiac Hypertrophy and Heart Failure by Impairing Mitochondrial Bioenergetics. Circulation 145, 829-846 (2022).
Xiong, W. et al. Mitofusin 2 Participates in Mitophagy and Mitochondrial Fusion Against Angiotensin II-Induced Cardiomyocyte Injury. Front Physiol 10, 411 (2019).
You, L. et al. The role of STAT3 in autophagy. Autophagy 11, 729-739 (2015).
Wegrzyn, J. et al. Function of mitochondrial Stat3 in cellular respiration. Science 323, 793-797 (2009).
Wu, L., Tan, J.L., Chen, Z.Y. & Huang, G. Cardioprotection of post-ischemic moderate ROS against ischemia/reperfusion via STAT3-induced the inhibition of MCU opening. Basic Res Cardiol 114, 39 (2019).
Cao, Y.P. & Zheng, M. Mitochondrial dynamics and inter-mitochondrial communication in the heart. Arch Biochem Biophys 663, 214-219 (2019).
Hernandez-Resendiz, S. et al. Targeting mitochondrial fusion and fission proteins for cardioprotection. J Cell Mol Med 24, 6571-6585 (2020).
Kurdi, M., Zgheib, C. & Booz, G.W. Recent Developments on the Crosstalk Between STAT3 and Inflammation in Heart Function and Disease. Front Immunol 9, 3029 (2018).
Mohammed, F., Gorla, M., Bisoyi, V., Tammineni, P. & Sepuri, N.B.V. Rotenone-induced reactive oxygen species signal the recruitment of STAT3 to mitochondria. FEBS Lett 594, 1403-1412 (2020).
Chang, Q. et al. The IL-6/JAK/Stat3 feed-forward loop drives tumorigenesis and metastasis. Neoplasia 15, 848-862 (2013).
Interleukin-6 autocrine signaling mediates melatonin MT1/2 receptor-induced STAT3 Tyr705 phosphorylation. (2011).
Bao, Q. et al. Intermittent hypoxia mediated by TSP1 dependent on STAT3 induces cardiac fibroblast activation and cardiac fibrosis. Elife 9 (2020).
Margolis, S.S. et al. Role for the PP2A/B56delta phosphatase in regulating 14-3-3 release from Cdc25 to control mitosis. Cell 127, 759-773 (2006).
Fujimitsu, K. & Yamano, H. PP2A-B56 binds to Apc1 and promotes Cdc20 association with the APC/C ubiquitin ligase in mitosis. EMBO Rep 21, e48503 (2020).
Papke, C.M. et al. A disorder-related variant (E420K) of a PP2A-regulatory subunit (PPP2R5D) causes constitutively active AKT-mTOR signaling and uncoordinated cell growth. J Biol Chem 296, 100313 (2021).
Elgendy, M. et al. Combination of Hypoglycemia and Metformin Impairs Tumor Metabolic Plasticity and Growth by Modulating the PP2A-GSK3beta-MCL-1 Axis. Cancer Cell 35, 798-815 e795 (2019).
Wojciechowska, C. et al. Oxidative stress markers and C-reactive protein are related to severity of heart failure in patients with dilated cardiomyopathy. Mediators Inflamm 2014, 147040 (2014).
Yang, R. & Rincon, M. Mitochondrial Stat3, the Need for Design Thinking. Int J Biol Sci 12, 532-544 (2016).
Zhang, Q. et al. Mitochondrial localized Stat3 promotes breast cancer growth via phosphorylation of serine 727. J Biol Chem 288, 31280-31288 (2013).
Macias, E., Rao, D., Carbajal, S., Kiguchi, K. & DiGiovanni, J. Stat3 binds to mtDNA and regulates mitochondrial gene expression in keratinocytes. J Invest Dermatol 134, 1971-1980 (2014).
Zhao, L. et al. Deletion of Interleukin-6 Attenuates Pressure Overload-Induced Left Ventricular Hypertrophy and Dysfunction. Circ Res 118, 1918-1929 (2016).
Liang, X. et al. Overexpression of ERBB4 rejuvenates aged mesenchymal stem cells and enhances angiogenesis via PI3K/AKT and MAPK/ERK pathways. FASEB J 33, 4559-4570 (2019).
Liu, J.J. et al. miR-218 Involvement in Cardiomyocyte Hypertrophy Is Likely through Targeting REST. Int J Mol Sci 17 (2016).

(Not answered)

Figures1.png
Fig. S1. ISO-induced DCM. aRepresentative echocardiographic images of each group. b Quantitative analysis of echo parameters of left ventricular of each group. LVEF: left ventricular ejection fraction, LVFS: left ventricular fraction shortening, LVEDV: LV end-diastolic volume, LVESV: LV end-systolic volume, LEVDD: left ventricular end-diastolic dimension, LEVSD: left ventricular end-systolic dimension (sham: n=3; ISO (Low): n=3; ISO (High): n=3. Values are presented as means ± SEM, *P<0.05 **P<0.01 ***P<0.001, ISO (Low) vs sham; or ISO (High) vs sham. ISO (Low): 30 mg/kg/day; ISO (High): 60 mg/kg/day; ISO stimulation for 2 weeks. c representative anatomical images of mice hearts after 6 weeks of ISO infusion. Scale bar: 5 mm. d Masson stain of the short-axis section of hearts. Scale bar: 1000 μM. e Masson stain of the long-axis section of hearts. Scale bar: 1000 μM.
FigureS2.png
Fig. S2. Ppp2r5d deficient promoted MCMs apoptosis. Flow cytometry with Annexin V-FITC/PI staining was performed to detect the apoptosis of each group with or without H₂O₂ treatment. Annexin V⁺/PI⁺: dead cells; Annexin V⁻/PI⁺: late-stage apoptosis cells; Annexin V⁺/PI⁻: early-stage apoptosis cells; Annexin V⁻ PI⁻: live cells. b WB detected the expression of Ppp2r5d (B56δ) and Cleaved Caspase 3. siRNA-P: siRNA-Ppp2r5d.
Figures3.png
Fig. S3. AAV-mediated cardiomyocyte-specific infection. Immunofluorescence staining was performed to evaluate the specific infection. The primary murine neonatal cells were isolated from heart tissue which contained not only cardiomyocytes but also fibroblasts. Representative immunofluorescent staining for α-actinin (red, cardiomyocytes), GFP (green, AAV-infected cells), and DAPI (blue, nucleus) in murine neonatal cells with AAV-shRNA-Ppp2r5d infection. Scale bar: 200 μM.
Figures4.png
Fig. S4. Proposed mechanism. Ppp2r5d bidirectionally regulated phosphorylation of Stat3 S727 and Y705 sites in cardiomyocytes under ISO treatment. Once Ppp2r5d deficiency with ISO stimulation, the phosphorylation of Stat3Y705 was strengthened while the phosphorylation of Stat3 S727 was weakened. The downregulated Stat3 pS727 decreases ATP production, increases intracellular ROS levels, impairs the mitochondrial electron transport chain and exacerbates cardiomyocytes apoptosis; The upregulated Stat3 pY705 boosts the expression of IL6. Collectively, Ppp2r5d knockdown in cardiomyocytes aggravated mitochondrial dysfunction and cardiac damage in the presence of adverse stimuli, and eventually accelerated progression to DCM. This figure was made with Figdraw software.

Download PDF

Version 1

posted

You are reading this latest preprint version

Unmusking of Protein Phosphatase 2 Regulatory Subunit B as a crucial factor in the development and progression of dilated cardiomyopathy

Status:

Version 1

Abstract

Figures

Introduction

Results

Ppp2r5d is associated with DCM progression

Ppp2r5d knockdown increased oxidative stress in cardiomyocytes in vitro

Ppp2r5d knockdown aggravates ISO-induced mitochondrial dysfunction in MCMs

Ppp2r5d knockdown aggravates cardiac dilation and HF in vivo

Ppp2r5d knockdown Impaired ETC complex activity

Ppp2r5d knockdown induces Stat3 bidirectional phosphorylation after ISO stimulation

Ppp2r5d knockdown increases the expression of IL6 after ISO stimulation in vitro

Discussion

Materials and methods

Animals studies

Cell culture

RNA interference

Flow cytometry analysis

Microarray gene expression studies

ATP concentration assessments

Dihydroethidium (DHE) Staining

Real-time quantitative PCR

Enzyme-linked immunosorbent assay (ELISA)

Mitochondrial respiration assay

Assay of intracellular reactive oxygen species

Mitochondria isolation, ETC activity assay

Immunofluorescence staining

Tissue histopathology

Echocardiography

Transmission electron microscopy (TEM) analysis

Western blotting

Statistical analysis

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1