Nasal ciliary beating controlled by carbonic anhydrase IV and Na+/HCO3- co-transport under an extremely low CO2 condition (air)

doi:10.21203/rs.3.rs-3309265/v1

Download PDF

Research Article

Nasal ciliary beating controlled by carbonic anhydrase IV and Na+/HCO3- co-transport under an extremely low CO2 condition (air)

https://doi.org/10.21203/rs.3.rs-3309265/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Ciliated human nasal epithelial cells (c-hNECs) express the bicarbonate transport metabolon (BTM) consisting of carbonic anhydrase (CA) IV, Na⁺/HCO₃^- cotransporter (NBC) and CAII. This study demonstrated that the BTM rapidly and selectively transports HCO₃^- into c-hNECs resulting in a high intracellular pH (pH_i) in c-hNECs. Applying a CO₂/HCO₃^--free solution decreased ciliary beat frequency (CBF) at a high pH_i, at which the CA-mediated reaction synthesized H⁺ from CO₂ produced by the metabolism. An NH₄⁺ pulse also gradually decreased CBF and pH_i following to immediate their increases in c-hNECs. Inhibition of NBC by S0859 decreased CBF and pH_i, and the effects of the CO₂/HCO₃^--free solution on CBF were reversed in c-hNECs pretreated with S0859 (i.e. it transiently increased CBF). Ciliated human bronchial epithelial cells (c-hBECs), pH_i in which was lower than that in c-hNECs, expressed CAII and NBC but not CAIV. In c-hBECs, the CO₂/HCO₃^--free solution transiently increased CBF and pH_i and the NH₄⁺ pulse increased and plateaued CBF and pH_i. Inhibition of NBC by S0859 did not decrease CBF and pH_i in c-hBECs. Based on these observations, in c-hNECs, the interactions between CAIV and NBC play a key role to accelerate the HCO₃^- influx, acceleration of which increase pH_i to an extremely high value. This novel mechanism keeping a high pH_i maintains an adequate CBF in c-hNECs in the air (0.04% CO₂).

nasal ciliated epithelia

intracellular pH

carbonic anhydrase II

bicarbonate transport metabolon

human airway epithelium

Ciliated human nasal epithelial cells (c-hNECs) play an essential role in removing small particles, such as chemicals, allergens, bacteria and viruses from nasal cavity. Inhaled particles are trapped by the surface liquid layer of the nasal epithelium [3] and swept away from the nasal cavity by beating cilia [1, 23, 31]. This system is called mucociliary clearance (MC), and is often compared to a belt conveyer for removing inhaled particles from the nasal cavity. The beating cilia are the engine driving the MC [1, 4, 23, 31]. Impairments of beating cilia, such as in primary ciliary dyskinesia, cause sinusitis [1, 31]. Thus, beating cilia play a key role in maintaining a healthy nasal cavity [1, 9–11, 18, 23, 31].

Nasal epithelium is a special tissue directly exposing the fresh air. The c-hNECs have some tools to keep the ciliary beating, such as thermosensitive transient receptor potentials (TRP) A1 and M8 activated by cool temperature [19]. Beating cilia including nasal cilia are activated by many substances including intracellular ions, such as Ca²⁺, H⁺ and Cl⁻ [4, 6–11, 12–14, 21–23, 26, 31]. Among them, H⁺, intracellular pH (pH_i), is an important regulator of airway ciliary beating; an increase enhances the ciliary beat frequency (CBF) and contrary, a decrease suppresses it [7, 10, 26]. The c-hNECs are exposed to the air (an extremely low CO₂ concentration 0.04%), which appears to increase the pH_i and enhance ciliary beating as shown in tracheal and lung airway ciliary cells upon switching to a CO₂/HCO₃⁻-free solution from a CO₂/HCO₃⁻-containing solution [7, 26]. However, a previous study demonstrated that the switch to a CO₂/HCO₃⁻-free solution does not increase CBF and pH_i in the c-hNECs [10]. Moreover, an NH₄⁺ pulse in the CO₂/HCO₃⁻-free solution decreased CBF and pH_i following to an immediate increase [10], suggesting that H⁺ is produced via the reaction catalyzed by carbonic anhydrase (CA):

CO₂ Δ H⁺ + HCO₃⁻ (Eq. 1)

However, the factors, which shift the Eq. 1 to the right in the CO₂/HCO₃⁻-free solution or during the NH₄⁺ pulse, remains unidentified in c-hNECs.

A previous study demonstrated that carbonic anhydrase IV (CAIV) is expressed in nasal epithelia [11, 24]. Although, at present, the roles of CAIV in nasal epithelia are not fully understood, CAIV has been demonstrated to interact with Na⁺/HCO₃⁻ cotransporter (NBC) in HEK293 cells transfected CAIV and NBC [2], renal proximal tubules [28] and retinal epithelium [32]. The interactions between CAIV and NBC, which enhance the rate of HCO₃⁻ influx and, consequently, increase intracellular HCO₃⁻ concentration ([HCO₃⁻]_i), may participate in the regulation of CBF and pH_i in c-hNECs exposed to the air.

The present study aimed to clarify the mechanisms keeping CBF and pH_i constant in c-hNECs exposed to the air. We hypothesised that a high rate of HCO₃⁻ influx enhanced by the interactions between CAIV and NBC increases pH_i and prevents CBF and pH_i to fluctuate in c-hNECs during breathing. We also used ciliated-human bronchial epithelial cells (c-hBECs), which are differentiated from normal human bronchial epithelial cells (NHBE) by the air liquid interface (ALI) culture [20]. We found that CAs except CAIV, NBCs and anion exchangers (AEs) were expressed similarly in c-hBECs and c-hNECs. The c-hBECs appear to be a good model of airway ciliated cells expressing no CAIV. The goal of this study is to clarify the mechanism controlling CBF and pH_i in c-hNECs exposed to the air (an extremely low CO₂ concentration).

Ethical approval

This study has been approved by the ethical committees of the Kyoto Prefectural University of Medicine (RBMR-C-1249-4) and Ritsumeikan University (BKC-HM-2020-090). All experiments were performed according to the ethical principles for medical research outlined in the Declaration of Helsinki (1964) and its subsequent revisions (https://www.wma.net/). Informed consents were obtained from all patients before operation. Human nasal tissue samples (nasal polyp, uncinate process or inferior turbinate) were resected from patients who required surgery for chronic sinusitis and allergic rhinitis. Samples were immediately cooled and stored in cooled control solution (4°C) until cell isolation [9-11, 33].

Solutions and chemicals

The control solution contained (in mM) NaCl 121, KCl 4.5, NaHCO₃ 25, MgCl₂ 1, CaCl₂ 1.5, NaHEPES 5, HHEPES 5 and glucose 5. Its pH was adjusted to 7.4 by HCl (1 M) and the solution was aerated with 95% O₂ and 5% CO₂. The CO₂/HCO₃^--free control solution was prepared by replacing NaHCO₃ in the control solution with NaCl and was aerated with 100% O₂. To apply the NH₄⁺ pulse, NaCl (25 mM) of the control solution or the CO₂/HCO₃^--free control solution were replaced with NH₄Cl (25 mM). DNase I, amphotericin B, 4,4-Diisothiocyanatostilbene-2,2-disulfonic acid disodium salt hydrate (DIDS) and 2-chloro-N-[[2′-[(cyanoamino)sulfonyl][1,1′-biphenyl]-4-yl]methyl]-N- [(4-methylphenyl)methyl]-benzamide (S0859, a specifically selective inhibitor for NBC) were purchased from Sigma-Aldrich (St Louis, MO, USA). Dorzolamide and brinzolamide were purchased from Tokyo Chemical Industry Co., Ltd. (Tokyo, Japan). Can Get Signal® Immunoreaction Enhancer Solution was purchased from TOYOBO (Osaka, Japan).

Cell culture media

Complete PneumaCultTM-Ex Plus medium contained PneumaCultTM-Ex Plus Basal Medium supplemented with PneumaCultTM-Ex supplement (50×, 20 µL/mL), hydrocortisone stock solution (1 µL/mL) and penicillin and streptomycin solution (10 µL/mL). Complete PneumaCultTM-ALI medium contained PneumaCultTM-ALI basal medium supplemented with PneumaCultTM-ALI supplement (10×, 100 µL/mL), PneumaCltTM-ALI maintenance supplement (10 µL/mL), heparin solution (2 µL/mL), hydrocortisone stock solution (2.5 µL/mL) and penicillin/streptomycin solution (10 µL/mL). Solutions and supplements were purchased from STEMCELL Technologies, INC. (Vancouver, BC, Canada). Elastase, bovine serum albumin (BSA) and dimethyl sulfoxide (DMSO) were purchased from FUJIFILM Wako Pure Chemical Corporation. (Osaka, Japan). Penicillin/streptomycin mixed solution (penicillin 10000 units/mL and streptomycin 10000 µg/mL in 0.85% NaCl), trypsin, and the trypsin inhibitor were purchased from Nacalai Tesque, Inc. (Kyoto, Japan).

Antibodies

The anti-CAIV antibody (MAB2186, mouse antibody directed against recombinant human CAIV (rhCA4; aa 19-283)) was purchased from R&D Systems (Minneapolis, MN, USA). The concentration of MAB2186 used was 25 µg/mL. The antigen peptide (2186-CA, recombinant human CAIV) was also purchased from R&D systems. The anti-alphatubulin (acetyl K40) (AC-tubulin) antibody (ab179484) was purchased from Abcam and used at a 100-fold dilution. Alexa Fluor 488 goat anti-mouse IgG (H+L) secondary antibodies (A-11001) and Alexa Fluor 594 donkey anti-rabbit IgG (H+L) secondary antibodies (A-21207) were purchased from Thermo Fischer Scientific (Waltham, MA, USA).

Cell preparation

We isolated c-hNECs from nasal operation samples as described previously [9-11, 33]. Briefly, resected samples were cut into small pieces and incubated for 40 min at 37°C in control solution containing elastase (0.02 mg/mL), DNase I (0.02 mg/mL) and BSA (3%). Then, the samples were minced in control solution containing DNase I (0.02 mg/mL) and BSA (3%) using fine forceps. Isolated nasal cells were washed with control solution containing BSA (3%) three times with centrifugation at 160 × g for 5 min and then sterilised for 15 min using amphotericin B (0.25 μg/mL) in Ham’s F-12 with L-glutamine. Isolated nasal epithelial cells were cultured in complete PneumaCult-Ex medium in a collagen-coated flask (Corning, 25cm², NY 14831 USA) at 37°C in a humidified 5% CO₂ atmosphere. The medium was changed every second day. Once the cells reached confluency, they were washed with PBS (5 mL) and harvested in Hank’s balanced salt solution (HBSS, 2 mL) containing 0.1 mM EGTA and 0.025% trypsin to remove cells from the flask. Then, a trypsin inhibitor was added into the cell suspension to stop further digestion. After washing with centrifugation, cells were resuspended in complete PneumaCultTM-Ex Plus medium (1–2 × 10⁵ cells, 3mL) and seeded on a filter of Transwell permeable supports insert (Coster 3470, 6.5 mm Transwell with 0.4 μm Pore Polyester Membrane Inserts, Corning) (3.0 ×10⁴ cells/insert, 400 μL). Complete PneumaCultTM-Ex Plus medium was added into the upper and bottom chambers and cells were cultured until confluent. Then, the medium in the bottom chamber was replaced with complete PneumaCultTM-ALI medium (500 μL) and the medium in the upper chamber was removed to expose cells to the air (ALI culture). The medium in the bottom chamber was changed thrice a week. Cells were cultured for 3 weeks under the ALI condition to allow differentiation into ciliated cells (Inui et al., 2019).

NHBE cells were purchased from Lonza (Basel, Switzerland) and cultured in the flask, in which complete PneumaCultTM-Ex Plus medium was added at 37°C in a humidified 5% CO₂ atmosphere. Once the cells had reached confluency, they were washed with PBS (5 mL) and harvested with HBSS (2 mL) containing 0.1 mM EGTA and 0.025% trypsin. Then, a tripsin inhibitor was added. After washing cells with centrifugation, cells were resuspended in complete PneumaCultTM-Ex Plus medium (3 mL). The cells were seeded onto the filter of Transwell permeable supports inserts (3.0 ×10⁴ cells/insert, 400 μL) and cultured into complete PneumaCultTM-Ex Plus medium, which was also added to the upper and bottom chambers. Once the cells reached confluency, the medium in the bottom chamber was replaced with PneumaCultTM-ALI medium (500 μL) and the medium in the upper chamber was removed (ALI culture). The medium in the bottom chamber was changed thrice a week. Cells were cultured for 3 weeks under the ALI condition [20]. There were no differences in the development of cilia between nasal epithelial and NHBE cells.

Measurements of CBF and CBD

The insert membrane filter on which cells had grown was cut into 4–6 pieces. A piece of membrane was placed on a coverslip precoated with neutralised Cell-Tak (Becton Dickinson Labware, Bedford, MA, USA). The coverslip with cells was then set in a perfusion chamber (20 µL), which was mounted on an inverted microscope (T-2000, NIKON, Tokyo, Japan) connected to a high-speed camera (IDP-Express R2000, Photron Ltd., Tokyo) (high-speed video microscope). The cells were perfused at a constant rate (200 µL/min). Since CBF is sensitive to temperature, the experiments were carried out at 37°C [4, 9-11]. Video images were recorded for 2 s at 500 fps. The methods to measure CBF and ciliary bend distance (CBD, an index of ciliary beating amplitude) have been described in detail [9-11, 33]. The ratios of CBF (CBF_t/CBF₀) and CBD (CBD_t/CBD₀) were calculated to make comparisons across the experiments. The subscripts ‘0’ and ‘t’ indicate the time from the start of the experiments.

Measurement of pH_i

The cell sheet was removed from the insert membrane filter using an EGTA treatment (incubation with a Ca²⁺-free control solution containing 1 mM EGTA (pH 7.2)) for 10 min at room temperature. Then, the cell sheet was incubated with 2 µM BCECF-AM (Dojindo Laboratories, Kumamoto, Japan) for 30 min at 37°C. After BCECF loading, the cell sheet was cut into small pieces (4–6 pieces). A piece was set in a perfusion chamber and the fluorescence of BCECF was measured using an image analysis system (MetaFluor, Molecular Device, USA). BCECF was excited at 440 nm and 490 nm and the emission was recorded at 530 nm. The fluorescence ratio (F490/F440) was measured at 37°C using the image analysis system. The calibration curve for pH_i was obtained using BCECF-loaded cells perfused with a calibration solution containing nigericin (15 µM, Sigma-Aldrich, St Louis, MO, USA) and having a pH adjusted to 6.5, 7.0, 7.5, or 8.0. The calibration solutions contained (in mM): KCl 150.5, MgCl₂ 2, CaCl₂ 1, HEPES 10 and glucose 5.

RT-PCR

Total RNA samples from c-hNECs (obtained from operation samples) and c-hBECs (derived from NHBE cells) were prepared using RNeasy Minikit (QIAGEN, Tokyo, Japan). Total RNA was reverse-transcribed to cDNA using an oligo d(T)6 primer and an Omniscript RT kit (QIAGEN). Then, cDNA samples were subjected to Reverse transcription-polimerase chain reaction (RT-PCR) using KOD FX (TOYOBO). The gene-specific primers are listed in Table 1 for human CA and Table 2 for human NBC and anion exchangers (AE). The amplified PCR products were confirmed using agarose.

(Table 1 and Table 2)

Western blot analysis

Cells on the insert membrane filter were washed with PBS and separated from the filter. Then, cells were homogenised using radioimmunoprecipitation assay buffer (50 mM Tris-HCl, 150 mM NaCl, 1% Nonidet-P40, 0.5 % sodium deoxycholate and 0.1 % SDS, pH 7.6) containing a protease inhibitor cocktail and incubated at 4°C for 20 min. Cells were then centrifuged at 16,000 × g for 20 min at 4°C. The supernatant was used as cell lysate. Proteins were separated using Laemmli’s SDS-polyacrylamide gel electrophoresis (8%–12.5%) and then transferred onto a polyvinylidene difluoride membrane. The membrane was blocked with milk (2.5%) in Tris-buffered saline (10 mM Tris-HCl and 150 mM NaCl, pH 8.5) containing 0.1% Tween 20 (TBST) for 1 h and then incubated with a primary antibody (MAB2186, R&D System) diluted in solution 1 (Can Get Signal Immunoreaction Enhancer Solution, TOYOBO) overnight at 4°C. After washing with TBST, the membrane was incubated with a secondary antibody (AP124P, anti-mouse IgG) diluted in solution 2 (Can Get Signal Immunoreaction Enhancer Solution, TOYOBO) for 1 h at room temperature. After washing, antigen–antibody complexes on the membrane were visualised using a chemiluminescence system (ECL plus; GE Healthcare, Waukesha, WI, USA).

Immunofluorescence examination

Immunofluorescence examinations were performed in c-hNECs and c-hBECs [21]. Cells on the Transwell insert membrane filter were removed using a cell scraper and suspended in PBS (2 mL). The cell suspension (0.5 mL) was dropped and dried on the cover slip, to which cells attached. Then, cells were fixed in 4% paraformaldehyde for 30 min and washed three times with PBS containing 10 mM glycine. Cells were permeabilised with 0.1% Triton X-100 for 15 min at room temperature. After 60 min pre-incubation with PBS containing 3% BSA at room temperature, cells were incubated with the anti-CAIV (MAB2186) and anti- AC-tubulin (ab179484, Abcam) antibodies overnight at 4°C. Then, cells were washes with PBS containing 0.1% BSA to remove unbound antibodies. Afterwards, cells were stained with Alexa Fluor 488 goat anti-mouse IgG (H+L) (A-11001, 1:100 dilution) and Alexa Fluor 594 donkey anti-rabbit IgG (H+L) (A-21207, 1:100 dilution) secondary antibodies for 60 min at room temperature. Cells were observed using a confocal microscope (FV10i, Olympus, Tokyo) [21].

Statistical analysis

Statistical significance was assessed using one-way analysis of variance or Student’s t-test (paired or unpaired), as appropriate. Differences were considered significant for p-values < 0.05. The results are expressed as the means ± SD.

Expression of CA

The expressions of CA subtypes (I, II, III, IV and Vb) were examined in c-hNECs and c-hBECs by RT-PCR. CA I, CAII, CAIII, CAIV and CAVb mRNAs were detected in c-hNECs (Fig. 1a), whereas CA I, CAII, CAIII and CAVb mRNAs, but not CAIV mRNA, were detected in c-hBECs, (Fig. 1b).

The protein expression of CAIV was also examined in c-hNECs and c-hBECs using anti-CAIV antibody (MAB2186, R&D System) by western blotting (WB). The CAIV band was detected at 45 kDa in c-hNECs, but not in c-hBECs (Fig. 2a). Many non-specific bands were detected in both cell types. We used a blocking peptide for the anti-CAIV antibody (2186-CA, R&D System). The blocking peptide abolished the CAIV band (45 kDa) (Fig. 2b). It is certain that the antibody (MAB2186) binds with CAIV in c-hNECs.

The localisation of CAIV was examined in c-hNECs (Fig. 3a) and c-hBECs (Fig. 3b) by double immunofluorescence staining of CAIV and AC-tubulin (a cilia marker). In c-hNECs, cilia, apical membrane and cell body were positively stained for CAIV (Fig. 3a-1). Cilia are positive for AC-tubulin (Fig. 3a-2). Fig. 3a-3 shows the merged image, in which cilia are positively stained for CAIV and AC-tubulin. Fig. 3a-4 shows the phase contrast image of c-hNECs. In contrast, no immunofluorescence of CAIV was detected in c-hBECs (Fig. 3b-1 and 3b-3).

Expression of NBC and AE

The expression of NBC subtypes (NCBE (SLC4A10), NBC1 (SLC4A11), NBCe1 (SLC4A4), NBCe2 (SLC4A5), NBCn1 (SLC4A7) and NDCBE1 (SLC4A8)) was examined by RT-PCR in c-hNECs (Fig. 4a) and c-hBECs (Fig. 4b). NBC1, NBCe1, NBCe2, NBCn1 and NDCBE1, but not NCBE, were expressed in c-hNECs and c-hBECs. The expression of AE subtypes (SLC26A4, SLC26A6, SLC26A9, SLC4A2 (AE2) and SLC4A3 (AE3)) was also examined by RT-PCR in c-hNECs (Fig. 4c) and c-hBECs (Fig. 4d). AE2 was expressed in c-hBECs and c-hNECs, whereas SLC26A4, SLC26A6, SLC26A9 and AE3 were not. There was no difference in the expression of NBCs and AEs between c-hNECs and c-hBECs.

CBF and CBD in c-hNECs and c-hBECs

In the control solution, CBF was 8.39 ± 2.44 Hz (n = 47) and CBD was 54.0 ± 27.2 µm (n = 11) in c-hNECs, and CBF was 8.37 ± 1.04 Hz (n = 12) and CBD was 65.3 ± 8.0 µm (n = 12) in c-hBECs. No differences in CBF and CBD were detected between c-hNECs and c-hBECs

Effects of CO₂/HCO₃^- -free solution and NH₄⁺pulse on CBF, CBD and pH_i in c-hNECs

Fig. 5a shows changes in CBF and CBD ratios (i.e. CBF and CBD normalised to the control values) in c-hNECs upon switching to a CO₂/HCO₃^--free solution from the control solution. The switch to the CO₂/HCO₃^--free solution induced small transient increases in CBD and CBD ratios, which then gradually decreased. The ratios of CBF and CBD 1.5 min after the switch were 1.02 (n = 15) and 1.01 (n = 11, p < 0.05), and those 10 min after the switch were 0.91 and 0.88 (p < 0.05), respectively. Thus, the CO₂/HCO₃^--free solution decreased the CBF and CBD ratios in c-hNECs. Changes in the pH_i were also measured by the ratio of BCECF fluorescence (F490/F440) upon switching to the CO₂/HCO₃^--free solution (Fig. 5b). The pH_i of c-hNECs in the control solution was 7.64 ± 0.19 (n = 9). The switch to the CO₂/HCO₃^--free solution gradually decreased pH_i and the pH_i at 1 min after the switch was 7.55 (n = 9) and that at 5 min after the switch was 7.24.

Changes in CBF and CBD ratios were comparable upon switching to the CO₂/HCO₃^--free solution. The ciliary beating was assessed by the CBF in the following experiments.

Inui et al. (2019) demonstrated that an NH₄⁺ pulse in a CO₂/HCO₃^--free solution induces an immediate increase followed by a gradual decrease in CBF and pH_i and these decreases are inhibited by acetazolamide (an inhibitor of CA). We also applied an NH₄⁺ pulse in the CO₂/HCO₃^- -free solution [10]. The NH₄⁺ pulse induced an immediate increase in CBF and then a gradually decrease to the level before the start of the NH₄⁺ pulse. The ratio of CBF at 1 min after the start of the NH₄⁺ pulse was 1.09 (n = 6) and that at 5 min after the start was 1.03 (n = 6, p < 0.05). Cessation of the NH₄⁺ pulse immediately decreased CBF (Fig. 6a). These results suggest that the decrease in CBF during the NH₄⁺ pulse is induced by the production of H⁺ mediated by CA in c-hNECs. The Eq 1 shifts to the right in c-hNECs upon applying the CO₂/HCO₃^- -free solution or the NH₄⁺ pulse. This may be caused by the extremely low [H⁺]_i and [HCO₃^-]_i in the CO₂/HCO₃^--free solution. However, a left shift has been shown to occur in ciliary cells from trachea [26] and lung airways [7]. We also examined the effects of an NH₄⁺ pulse on CBF and pH_i in c-hNECs perfused with the control solution, which contained HCO₃^- and was aerated with 95% O₂ and 5% CO₂. However, the NH₄⁺ pulse immediately increased and then, gradually decreased the CBF ratio and pH_i. Then, cessation of the NH₄⁺ pulse immediately decreased CBF and pH_i (Fig. 6b and 6c). The pH_i was 7.55 in c-hNECs perfused with the control solution, and the pH_is at 1 min and at 7 min from the start of the NH₄⁺ pulse were 8.08 and 7.65, respectively (n = 9, p < 0.05). Thus, in c-hNECs perfused with the control solition (the presence of CO₂/HCO₃), the right shift still occurred in Eq.1, suggesting that a high pH_i causes the right shift in Eq. 1.

Effects of dorzolamide and brinzolamide on CBF and pH_i

The CBF ratio was not affected in c-hNECs by the addition of dorzolamide (1 µM, an inhibitor of CAII and CAIV) and by the subsequent switch to the CO₂/HCO₃^--free solution (Fig. 7a). The CBF ratio was 0.98 (n = 16) at 5 min after addition of dorzolamide and 0.99 at 5 min after the switch to CO₂/HCO₃^--free solution. The effects of brinzolamide (0.1 μM, a CAII inhibitor) were also examined. As observed with dorzolamide, brinzolamide addition and the subsequent switch to the CO₂/HCO₃^--free solution did not change the CBF ratio (Fig. 7b). The CBF ratio was 1.00 (n = 21) at 5 min after the addition of brinzolamide and 0.98 at 5 min after the switch to the CO₂/HCO₃^--free solution. Moreover, in the presence of brinzolamide, the NH₄⁺ pulse induced an immediate increase and then, a gradual increase, without any decrase, in the CBF ratio in c-hNECs. The CBF ratio was 1.07 (n = 7) at 1 min from the start of the NH₄⁺ pulse and 1.17 at 5 min from the start of the NH₄⁺ pulse. Cessation of the NH₄⁺ pulse immediately decreased CBF (Fig. 7c). We also measured changes in pH_i upon applying the NH₄⁺ pulse. Brinzolamide did not affect the pH_i, which was 7.81 (n = 6) before and 7.69 at 5 min after the addition of brinzolamide. The NH₄⁺ pulse increased and plateaued pH_i, and the pH_i was 8.46 (n = 6) at 1 min from the start of the NH₄⁺ pulse and 8.41 at 5 min from the start of the NH₄⁺ pulse. Cessation of the NH₄⁺ pulse decreased pH_i (Fig. 7d).

Effects of S0859 on CBF and pH_i

To inhibit NBC, S0859 (30 μM) was used. The addition of S0859 immediately decreased the CBF ratio (Fig. 8a), and the CBF ratio was 1.00 before and 0.79 (n = 9) at 5 min after the addition of S0859. Removing S0859 immediately increased the CBF ratio to a level before the addition of S0859. The CBF ratio was 0.99 at 1 min and 0.98 at 5 min after removing S0859. Experiments were also carried out using DIDS (200 µM, an inhibitor of NBC) (Fig. 8b). The addition of DIDS, similarly to that of S0859, decreased the CBF ratio. The CBF ratio was 0.99 before and 0.78 at 5 min after the addition of DIDS. However, removing DIDS did not increase the CBF ratio, and the CBF ratio was 0.71 at 5 min after removing DIDS. Thus, preventing HCO₃^- entry by inhibiting NBC appeared to decrease the pH_iin c-hNECs. We measured changes in pH_i in c-hNECs, when S0859 was added. The addition of S0859 decreased the pH_i in c-hNECs, and the pH_i was 7.54 before and 7.45 (n = 10, p < 0.01) at 5 min after the addition of S0859. Removing S0859 immediately increased the pH_i, and the pH_i was 7.59 at 1 min and 7.60 at 3 min after removing S0857 (Fig. 8c). Then, the pH_igradually decreased to the control level within 10 min.

The effects of brinzolamide (0.1 µM) on the decrease in CBF induced by S0857 were examined in c-hNECs (Fig. 9a). In the presence of brinzolamide, S0859 did not decrease the CBF ratio. Thus, the prior treatment with brinzolamide abolished the decrease in CBF induced by S0857, suggesting that CAII, in addition to CAIV and NBC, may function as the bicarbonate transport metabolon in c-hNECs [19]. Moreover, c-hNECs were treated with S0857 for 1 h and then, the CO₂/HCO₃^--free solution was applied. The switch to the CO₂/HCO₃^--free solution increased the CBF ratio transiently (Fig.9b). The CBF ratio was 1.00 (n = 4) before and 1.19 at 3 min after switching to the CO₂/HCO₃^--free solution. This suggests that the CO₂/HCO₃^--free solution induces the left shift in Eq. 1 when the pH_i was decreased by inhibiting HCO₃^- entry in c-hNECs.

These results indicate that a novel mechanism maintains an adequate CBF in c-hNECs under the condition of an extremely low CO₂ concentration (i.e. in the air). A high rate of HCO₃^- entry through NBC is essential to this mechanism. Previous studies demonstrated that CAIV plays a key role for NBC activation in kidney proximal tubules and retinal epithelia [2, 28, 32]. In c-hNECs, CAIV appears to be essential to the novel mechanism.

Similar experiments were carried out using c-hBECs expressing no CAIV, to compare the responses in CBF and pH_i with those observed in c-hNECs.

Effects of the CO₂/HCO₃^--free solution, the NH₄⁺ pulse, brinzolamide and S0859 on CBF and pH_i in c-hBECs

Switching to the CO₂/HCO₃^--free solution transiently increased the CBF and CBD ratios and the CBF and CBD ratios at 2 min after the switch were 1.10 (n = 6) and 1.18 (n = 5) (Fig. 10a). Changes in pH_i were also measured upon switching to the CO₂/HCO₃^--free solution (Fig. 10b). The pH_i was 7.10 (n = 10) in c-hBECs perfused with the control solution. Switching to the CO₂/HCO₃^--free solution transiently increased pH_i and the pH_i was 7.18 at 1.5 min after the switch. Fig. 10c shows changes in the CBF ratio induced by an NH₄⁺ pulse in the CO₂/HCO₃^--free solution. The switch to the CO₂/HCO₃^--free solution from the control solution transiently increased the CBF ratio and then, the NH₄⁺ pulse increased the CBF ratio. Cessation of the NH₄⁺ pulse decreased the CBF ratio. When an NH₄⁺ pulse was applied in the control solution, the CBF ratio increased and plateaued the CBF ratio within 2 min (Fig. 10d). Changes in pH_i during the NH₄⁺ pulse in the control solution were measured. The pH_i before the NH₄⁺ pulse was 6.96 (n = 8). The NH₄⁺ pulse immediately increased pH_i, and the pH_i at 5 min from the start of the NH₄⁺ pulse was 7.26 (n = 10). Thus, in c-hBECs, unlike in c-hNECs, there was no decrease in the CBF ratio or pH_i upon applying the CO₂/HCO₃^--free solution or the NH₄⁺ pulse (Fig. 10).

Brinzolamide (0.1 µM) gradually decreased the CBF ratio in c-hBECs, suggesting that, during the control perfusion, H⁺ produced by the cellular metabolism is converted to CO₂ by CAII. The application of NH₄⁺ pulse increased the CBF ratio. Cessation of the NH₄⁺ pulse immediately decreased the CBF ratio (Fig. 11a). Changes in pH_i were measured. Brinzolamide slightly decreased pH_i (not significant). Applying the NH₄⁺ pulse increased pH_i (Fig. 11b). The pH_i was 7.43 (n = 5) during control perfusion, 7.38 at 5 min after the addition of brinzolamide and 7.77 at 5 min from the start of the NH₄⁺ pulse.The addition of S0859 did not affect the CBF ratio, but removing S0859 immediately increased the CBF ratio, suggesting that HCO₃^- entered cells through NBC during control perfusion (Fig. 11c). NBC appears to function in c-hBECs. The CBF ratio decreased to the control level within 10 min after removing S0859. Changes in pH_i induced by S0859 were measured. S0859 did not affect pH_i, but removing S0859 induced an immediate increase in pH_i (Fig. 11d).

The present study revealed that a high pH_i is the key factor to maintain an adequate level of ciliary beating in c-hNECs under the condition of an extremely low CO₂ concentration. In c-hNECs, H⁺is produced by Eq. 1 mediated mainly by CAII. A high pH_i causes the right shift of Eq. 1 in c-hNECs upon switching to the CO₂/HCO₃^--free solution. When, in c-hNECs reaching an equilibrium in Eq. 1 at a high pH_i (low [H⁺]_i), the [HCO₃^-]_i is decreased by the switch to the CO₂/HCO₃^--free solution, Eq. 1 is shifted to the right leading to a decrease in pH_i, which decreases CBF and CBD. The amount of CO₂ produced by the cellular metabolism appears to be enough to equilibrate Eq. 1 at a high pH_i in the CO₂/HCO₃^--free solution. Thus, the high pH_i, which shifts the Eq. 1 to the right, prevents further increases in CBF and CBD in c-hNECs, upon switching to the CO₂/HCO₃^--free solution.

We also demonstrated that the high pH_i is produced by HCO₃^- entry via NBC in c-hNECs. Blocker studies (S0859 and DIDS) of NBC revealed that an inhibition of NBC decreased CBF and pH_i mediated by CAII in c-hNECs. Moreover, the prior treatment of the NBC inhibitor induced a transient increase in CBF in c-hNECs upon switching to the CO₂/HCO₃^--free solution. A similar increase in CBF was observed in c-hBECs or ciliated airway cells from human trachea and mouse lung airways [7, 26]. These findings suggest that HCO₃^- entered c-hNECs via NBC increases pH_i by consuming H⁺ by CAII. RT-PCR analysis revealed that NBC1, NBCe1, NBCe2, NBCn1 and NDCBE are expressed in c-hNECs. SLC4A2 (AE2) was also expressed in c-hNECs. The contribution of AEs in increasing the pH_i appears to be small because there was no difference in the CBF decrease induced by S0859 or DIDS in c-hNECs. The Na⁺/H⁺ exchange (NHE) is unlikely to extrude H⁺ from c-hNECs, because it is inactive at pH_i higher than 7.4 [30].

Thus, the high pH_i is caused by the activation of NBC in c-hNECs. The present study demonstrated that CAIV is expressed in c-hNECs. CAIV expression has already been reported in human nasal epithelia [11] and canine nasal ciliary cells [24]. A previous study has shown that the physical and functional interactions between CAIV and NBC maximise transmembrane HCO₃^- flux in HEK239 cells transfected with NBC1b and CA4 [2]. The C-terminal tail of CAIV is anchored in the outer surface of the plasma membrane [2] and CAIV colocalises with NBC1 in the basolateral membrane of renal proximal tubules [28]. These findings suggest that CAIV activates NBC in c-hNECs. Here, we used c-hBECs, which express CAs except CAIV and bicarbonate transporters, similarly to c-hNECs. A previous study showed that CAIV expression is lower in the trachea and lower airways than that in the larynx [25]. S0859 and DIDS did not decrease CBF and pH_i in c-hBECs, indicating that the activity of NBC is low. These results suggest that CAIV activates NBC in c-hNECs. Moreover, the pH_i was lower in c-hBECs, which do not express CAIV, than in c-hNECs. Switching to the CO₂/HCO₃^--free solution increased CBF and pH_i, and the NH₄⁺ pulse did not decrease CBF or pH_i. These observations suggest that the activity of NBC is low in c-hBECs, but the NBC functions, in c-hBECs as shown in the increased CBF and pH_i after removing S0859 (Fig. 11c and d). A physical interaction between extracellular CAIV and NBC1 occurs via fourth extracellular loop of NBC1 [2]. Expression of CAIV has been shown to increase NBC1 activity in renal proximal tubules [28] and the R14W mutation of CA, which has been detected in an autosomal dominant form of retinitis pigmentosa, impairs pH balances of photoreceptor cells by affecting HCO₃^- influx [32].

CAII has been shown to interact with NBC1 [5]. CAII and CAIV have similar structures and the acid motif in the NBC1 C-terminal region interacts with the basic N-terminal region of CAII [15, 19]. The production of HCO₃^- by CAIV and removing HCO₃^- by CAII likely potentiate transmembrane HCO₃^- influxes via NBC in c-hNECs [19].

Kim et al. (2008) reported that eleven CA isozymes are expressed in whole tissue of normal human nasal mucosa and CAI, CAII, CAIV, CAVb and CAXIV are more highly expressed than the other CAs [11]. The activity levels of CAIII and CAXIV are known to be low compared with those of CAI, CAII, CAIV and CAVb [29]. The present study demonstrated that CAI, CAII, CAIII, CAIV and CAVb are expressed in c-hNECs, and CAIV, which is a secreted CA isozyme [17, 29], was localised at apical surface including cilia of c-hNECs. Brinzolamide (a CAII inhibitor) abolished the decreases in CBF and pH_i upon switching to the CO₂/HCO₃^- free solution and applying the NH₄⁺ pulse. This suggests that the HCO₃^- transport metabolone composed of CAII and NBC plays an important role in transmembrane HCO₃^- transport.

The present study does not provide the localisation of NBC isoforms in the apical membrane of c-hNECs. However, it has been demonstrated that NBC1 and CAIV have a physical and functional relationship in HEK293 cells transfected with NBC1 and CAIV [2]. CAIV binds to the fourth extracellular loop of NBC1 to form the bicarbonate transport metabolon [2]. Liu et al. (2022) also showed that NBC functionally exists in apical membranes of mice bronchioles, but failed to detect the membrane localisation of the NBC isoforms (apical or basolateral?) [16]. The present study strongly suggests that NBC1 exists in apical membrane of c-hNECs to form the bicarbonate transport metabolon.

In this study, c-hNECs were cultured in a HCO₃^--containing solution aerated with 5% CO₂. This experimental condition appears to enhance HCO₃^- influx. At a pH_i of 7.66 with 5% CO₂ (pCO₂ = 38 mmHg), the [HCO₃^-]_i is calculated to be 41.4 mM using the Hederson–Hasselbalch equation. In the presence of CO₂/HCO₃^-, the [HCO₃^-]_i is approximately four times higher in c-hNECs than that of c-hBECs (11.4 mM at pH_i = 7.1). Although we do not know the exact pCO₂ and [HCO₃^-]_i of nasal ciliary cells exposed to air, it is certain that a high [HCO₃^-]_i is maintained in c-hNECs and the high rate of HCO₃^- entry is essential for pH homeostasis in c-hNECs. This mechanism minimises pH_i changes during breathing to keep an appropriate CBF in c-hNECs. Moreover, CAIV in c-hNECs may prevent a CO₂ leak. Because the CO₂ concentration at the apical surface (0.04%) is much lower than that in the interstitial fluid (5%) of c-hNECs and the CO₂ gradient between apical and basolateral sides of c-hNECs accelerates the leakage of CO₂. CAIV decreases the pH of the nasal mucous fluid and a low pH of the surface liquid is essential for keeping a healthy nasal cavity, such as protecting nasal mucosa from infections caused by inhaled bacteria [27, 34].

In conclusion, we identified a novel mechanism of pH_i regulation in c-hNECs, which keeps the ciliary beating at an adequate level in the air. In ciliated nasal epithelia, CO₂ diffuses to the apical surface according to the CO₂ gradient between interstitial fluid (5%) and air (0.04%). Leaked CO₂ is converted to H⁺ and HCO₃^- by CAIV. HCO₃^- enters cells via NBC and H⁺ keeps the pH of nasal mucous layer low. Once in the c-hNECs, HCO₃^- traps H⁺ to produce CO₂ by CAII, resulting in an elevated pH_i. The bicarbonate transport metabolon (CAIV–NBC–CAII) appears to accelerate the transmembrane influx of HCO₃^- in c-hNECs. Further studies are required to confirm this novel mechanism.

Acknowledgement

We would like to express our thanks to the Faculty of Medicine, Osaka Medical and Pharmaceutical University for allowing us to use the HSVM.

Author contributions

SO, TaI, MY and TN measured ciliary activities and pH_i. SO, KK, SY, YK and SA contributed to RCR, WB and Immunofluorescence examination. MY, SH, ToI and YM contributed to data interpretation and discussion. TN and MY contributed to the experimental design, data analysis and data interpretation and prepared the draft of the manuscript. All authors have read and approved the final version of the manuscript and agree to be accountable for all aspects of the work.

Conflicts of interest

There are no conflicts of interest associated with this publication.

Data availability statement

The data that support the findings of this study are in the paper itself and no shared data are used in the paper.

Funding

This work was supported by the Japan Society for the Promotion of Science (No. JP18H03182, to YM).

Afzelius BA (2004) Cilia-related diseases. J Pathol 204(4):470–477. doi: 10.1002/path.1652.
Alvarez BV, Loiselle FB, Supuran CT, Schwartz GJ, Casey JR (2003) Direct extracellular interaction between carbonic anhydrase IV and the human NBC1 sodium/bicarbonate co-transporter. Biochemistry 42: 12321–12329, 2003. doi: 10.1021/bi0353124.
Button B, Cai LH, Ehre C, Kesimer M, Hill DB, Sheehan JK, Boucher RC, Rubinstein M (2012) A periciliary brush promoted the lung health by separating the mucus layer from airway epithelia. Science 337 (6097), 937–941. doi:10.1126/science.1223012.
Delmotte P, Sanderson MJ (2006) Ciliary beat frequency is maintained at a maximal rate in the small airways of mouse lung slices. Am J Respir Cell Mol Biol 35(1): 110–117. doi: 10.1165/rcmb.2005-0417OC
Gross E, Pushkin, A, Abuladze N, Fedotoff O, Kurtz I (2002) Regulation of sodium bicarbonate cotransporter kNBC1 function: role of Asp986, Asp988 and kNBC1-carbonic anhydrase II binding. J Physiol 544.3: 679–685. doi: 10.1113/jphysiol.2002.029777
Ikeuchi Y, Kogiso H, Hosogi S, Tanaka S, Shimamoto C, Inui T, Nakahari T, Marunaka Y (2018) Measurement of [Cl^–]_i unaffected by the cell volume change using MQAE-based two-photon microscopy in airway ciliary cells of mice. J Physiol Sci 68: 191–199. doi: 10.1007/s12576-018-0591-y
Ikeuchi Y, Kogiso H, Hosogi S, Tanaka S, Shimamoto C, Matsumura H, Inui T, Marunaka Y, Nakahari T (2019) Carbocisteine stimulated an increase in ciliary bend angle via a decrease in [Cl^–]_i in mouse airway cilia. Pflügers Arch Eur J Physiol 471 (2), 365–380. doi: 10.1007/s00424-018-2212-2.
Ikeuchi-Yamamoto Y, Kogiso H, Saito D, Kawaguchi K, Ikeda R, Asano S, Inui T, Marunaka Y, Nakahari T (2022) Hochu-ekki-to enhanced airway ciliary beating by an [Ca²⁺]_i increase via TRPV4 in mice. Phytomed Plus 2: 100243. Doi: 10.1016/j.phyplu.2022.100243.
Inui T, Yasuda M, Hirano S, Ikeuchi Y, Kogiso H, Inui T, Marunaka Y, Nakahari T (2018) Daidzein-stimulated increase in the ciliary beating amplitude via an [Cl^–]_i decrease in ciliated human nasal epithelial cells. Int J Mol Sci 19(12): 3754. doi: 10.3390/ijms19123754
Inui T, Murakami K, Yasuda M, Hirano S, Ikeuchi Y, Kogiso H, Hosogi S, Inui T, Marunaka Y, Nakahari T (2019) Ciliary beating amplitude controlled by intracellular Cl^– and a high rate of CO₂ production in ciliated human nasal epithelial cells. Pflügers Arch Eur J Physiol 471(8): 1127–1142. doi: 10.1007/s00424-019-02280-5.
Inui T, Yasuda M, Hirano S, Ikeuchi Y, Kogiso H, Inui T, Marunaka Y, Nakahari T (2020) Enhancement of ciliary beat amplitude by carbocisteine in ciliated human nasal epithelial cells. Laryngoscope 130 (5): E289-E297. Doi:10.1002/l1ary.28185
Kim TH, Lee HM, Lee SH, Kim HK, Lee JH, Oh KH, Lee SH (2008) Down-regulation of carbonic anhydrase isozymes in nasal polyps. Laryngoscope 118: 1856–1861. doi:10.1097/MLG.0b013e31817f4d0e.
Kogiso H, Hosogi S, Ikeuchi Y, Tanaka S, Shimamoto C, Matsumura H, Nakano T, Sano K, Inui T, Marunaka Y, Nakahari T (2017) A low [Ca²⁺]_i-induced enhancement of cAMP-activated ciliary beating by PDE1A inhibition in mouse airway cilia. Pflügers Arch Eur J Physiol 469:1215–27. doi: 10.1007/s00424-017-1988-9.
Kogiso H, Hosogi S, Ikeuchi Y, Tanaka S, Inui T, Marunaka Y, Nakahri T (2018) [Ca²⁺]_i modulation of cAMP-stimulated ciliary beat frequency via PDE1 in airway ciliary cells of mice. Exp Physiol 103(3):381–390. doi: 10.1113/EP086681
Kogiso H, Ikeuchi Y, Sumiya M, Hosogi S, Tanaka S, Shimamoto C, Inui T, Marunaka Y, Nakahari T (2018) Seihai-to (TJ-90)-Induced activation of airway ciliary beatings of mice: Ca²⁺ modulation of cAMP-stimulated ciliary beatings via PDE1. Int J Mol Sci 19(3): 658. doi: 10.3390/ijms19030658.
Lesburg CA, Huang CC, Christianson DW, Fierke CA (1997) Histidine → carboxamide ligand substitutions in the zinc binding site of carbonic anhydrase II alter metal coordination geometry but retain catalytic activity. Biochemistry 36: 15780–15791. doi: 10.1021/bi971296x.
Liu L, Yamamoto A, Yamaguchi M, Taniguchi I, Nomura N, Nakakuki M, Kozawa Y, Furuyasu T, Higuchi M, Niwa E, Tamada T, Ishiguro H (2022) Bicarbonate transport of airway surface epithelia in luminally perfused mice bronchioles. J Physiol Sci 72: 4. doi: 10.1186/s12576-022-00828-2.
Murakami H, Sly WS (1987) Purification and characterization of human salivary carbonic anhydrase. J Biol Chem 262: 1382–1388.
Nguyen TN, Koga Y, Wakasugi T, Kitamura T, Suzuki H (2023) TRPA1/M8 agonists upregulate ciliary beating through the pannexin-1 channel in the human nasal mucosa. Mol Biol Rep 50(3): 2085–2093. doi: 10.1007/s11033-022-08201-7
McMurtrie HL, Cleary HJ, Alvarez BV, Loiselle FB, Sterling D, Morgan PE, Johnson DE, Casey JR (2004) The bicarbonate transport metabolon. J Enzyme Inhib Med Chem 19(3): 231–236. doi: 10.1080/14756360410001704443.
Rayner RE, Makena P, Prasad GL, Cormet-Boyaka E (2019) Optimization of normal human bronchial epithelia (NHBE) cell 3D cultures for in vitro lung model study. Sci Rep 9(1): 500. doi:10.1038/s41598-018-36735-z.
Saito D, Kawaguchi K, Asano S, Inui T, Marunaka Y, Nakahari T (2022) Enhancement of airway ciliary beating mediated via voltage-gated Ca²⁺ channels/α7-nicotinic receptors in mice Pflügers Arch Eur J Physiol. 474: 1091–1106. doi: 10.1007/s00424-022-02724-5
Saito D, Suzuki C, Tanaka S, Hosogi S, Kawaguchi K, Asano S, Okamoto S, Yasuda M, Hirano S, Inui T, Marunaka Y, Nakahari T (2023) Ambroxol-enhanced ciliary beating via voltage-gated Ca²⁺ channels in mouse airway ciliated cells. Eur J Pharmacol 941: 175496. doi: 10.1016/j.ejphar.2023.175496.
Salathe M (2007) Regulation of mammalian ciliary beating. Annu Rev Physiol 69: 401–422 doi: 10.1146/annurev.physiol.69.040705.141253
Sugiura Y, Ichihara N, Nishita T, Murakami M, Amasaki H, Asari M (2008) Immunohistolocalization and gene expression of secretory carbonic anhydrase isoenzyme CA-IV in canine nasal cavity. J Vet Med Sci 70(10): 1037–1041.
Sugiura Y, Oishi M, Amasaki T, Soeta S, Ichihara N, Nishita T, Murakami M, Amasaki H, Asari M (2009) Immunohistochemical localization and gene expression of carbonic anhydrase isozyme CA-II and CA-VI in canine lower airways and lung. J Vet Med Sci 71(11): 1525–1528. doi: 10.1292/jvms.001525.
Sutto Z, Conner GE, Salathe M (2004) Regulation of human airway ciliary beat frequency by intracellular pH. J Physiol 560:519–532. doi: 10.1113/jphysiol.2004.068171.
Thornell IM, Li X, Tang XX, Brommel CM, Karp PH, Welsh Mj, Zabner J (2018) Nominal carbonic anhydrase activity minimize surface liquid pH chandes during breathing. Physiol Rep 6 (2): e13569. doi: 10.14814/phy2.13569.
Tsuruoka S, Swenson ER, Petrovic S, Fujimura A, Schwartz GJ (2001) Role of basolateral carbonic anhydrase in proximal tubular fluid and bicarbonate absorption. Am J Physiol Renal Physiol 280: F146-F154. doi: 10.1152/ajprenal.2001.280.1.F146
Uchida K, Okazaki K, Nishi T, Uose S, Nakase H, Ohana M, Matsushima Y, Omori K, Chiba T (2002) Experimental Immune-mediated pancreatitis in neonatally thymectomized mice immunized with carbonic anhydrase II and lactoferrin. Lab Invest 82 (4): 411–424. doi: 10.1038/labinvest.3780435.
Wakabayashi S, Hisamitsu T, Pang T, Shigekawa M (2003) Kinetic dissection of two distinct binding sites in Na⁺/H⁺ exchangers by measurement of reverse mode reaction. J Biol Chem 278 (44): 43580–43585. doi: 10.1074/jbc.M306690200
Wanner A, Salathe M, O'Riordan TG (1996) Mucociliary clearance in the airways. Am J Respir Crit Care Med 154(6):1868–902. doi: 10.1164/ajrccm.154.6.8970383.
Yang Z, Alvarez BV, Chakarova C, Jiang L, Karen G, Frederick JM, Zhao Y, Sauve Y, Li X, Zrenner E, Wissinger B, Den Hollander AI, Katz B, Baehr W, Cremers FP, Casey JR, Bhattacharya SS, Zhang K. (2005) Mutant carbonic anhydrase 4 impairs pH regulation and causes retinal photoreceptor degeneration. Hum Mol Genet 14: 255–265. Doi: 10.1093/hmg/ddi023.
Yasuda M, Inui T, Hirano S, Asano S, Okazaki T, Inui T, Marunaka Y, Nakahari T (2020) Intracellular Cl^– regulation of ciliary beating in ciliated human nasal epithelial cells: frequency and distance of ciliary beating observed by high speed video microscopy. Int J Mol Sci 21, 4052. doi: 10.3390/ijms21114052.
Zajac M, Dreano E, Edwards A, Planelles G, Sermet-Gaudelus (2021) Airway surface liquid pH regulation in airway epithelium current understandings and gaps in knowledge. Int J Mol Sci 22: 3384. doi: 10.3390/ijms22073384.

Table 1

Primers used to amplify CA
Transcript	Direction	Sequence	Size (bp)
CA1	Sense	AGCTGCCTCAAAGGCTGATG	181
CA1	Antisense	GGTCCAGAAATCCAGGGATGAA	181
CA2	Sense	TTACTGGACCTACCCAGGCTCAC	167
CA2	Antisense	GCCAGTTGTCCACCATCAGTTC	167
CA3	Sense	CATGAGAATGGCGACTTCCAGA	141
CA3	Antisense	GAATGAGCCCTGGTAGGTCCAGTA	141
CA4	Sense	TCCCTAGAAACCTAGGGTCATTTCA	156
CA4	Antisense	TGGAGCTAGATCACGTTTCACAA	156
CA5b	Sense	TGTTCTGAAGTGAAAGTCTGGTCTG	172
CA5b	Antisense	CCAAACTAGAGTGCCCTGGATG	172

Table 2

Primers used to amplify NBCs and AEs
NBC
Transcript	Direction	Sequence	Size (bp)
NCBE (SLC4A10)	Sense	GCAGGTCAGGTTGTTTCTCCTC	498
NCBE (SLC4A10)	Antisense	TCTTCCTCTTCTCCTGGGAAGG	498
NBC1 (SLC4A11)	Sense	GGCCTGTGGAACAGTTTCTTCC	690
NBC1 (SLC4A11)	Antisense	TGCCCTTCACCAGCCTGTTCTC	690
NBCe1 (SLC4A4)	Sense	GGTGTGCAGTTCATGGATCGTC	336
NBCe1 (SLC4A4)	Antisense	GTCACTGTCCAGACTTCCCTTC	336
NBCe2 (SLC4A5)	Sense	ATCTTCATGGACCAGCAGATCAC	468
NBCe2 (SLC4A5)	Antisense	TGCTTGGCTGGCATCAGGAGG	468
NBCn1 (SLC4A7)	Sense	CAGATGCAAGCAGCCTTGTGTG	328
NBCn1 (SLC4A7)	Antisense	GGTCCATGATGACCACAAGCTG	328
NDCBE1 (SLC4A8)	Sense	GCTCAAGAAAGGCTGTGGCTAC	243
NDCBE1 (SLC4A8)	Antisense	CATGAAGACTGAGCAGCCCATC	243
AE
AE2	Sense	GAAGATTCCTGAGAATGCCT	181
AE2	Antisense	GTCCATGTTGGCAGTAGTCG	181
AE3	Sense	ATCTGAGGCAGAACCTGTGG	418
AE3	Antisense	TTTCACTAAGTGTCGCCGC	418
SLC26A4	Sense	GTTTACTAGCTGGCCTTATATTTGGACTGT	484
SLC26A4	Antisense	AGGCTATGGATTGGCACTTTGGGAACG	484
SLC26A6	Sense	TAGGGGAGGTTGGGCCAGGGATGC	456
SLC26A6	Antisense	TGCCGGGAAGTGCCAAACAGGAAGAAGTAGAT	456
SLC26A9	Sense	TCCAGGTCTTCAACAATGCCAC	400
SLC26A9	Antisense	CGAGTCTTGTGCATGTAGCGAG	400

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Nasal ciliary beating controlled by carbonic anhydrase IV and Na+/HCO3- co-transport under an extremely low CO2 condition (air)

Status:

Version 1

Abstract

Figures

Introduction

Materials and methods

Results

Discussion

Declarations

References

Tables

Additional Declarations

Status:

Version 1