2-1. Animals
The experiments were performed on adult male Wistar rats weighing 250-200 g (Pasteur Institute, Tehran, Iran). Animals were kept in groups of four in cages with food and water ad libitum. The room had a 12-hour light/dark cycle and a controlled temperature (23 ± 2 °C). The rats were randomly assigned to experimental groups of 8.
2-2. drugs
Aβ fragment 25-35 and AM251, an antagonist of the cannabinoid 1 receptor, were purchased from Sigma.
Note: The cannabinoid receptor agonist drug Win55 was purchased from corporations, but due to the sanctions imposed on Iran, it was not permitted to enter the country.
Due to the lack of an ideal agonist, in lieu of one dosage, three different doses of AM 251 were selected.
2-3. Experimental Procedure
In this study, rats (n = 40; n=8 in each group) were randomly divided into the following groups: control, treated with distilled water as the solvent of Aβ; DMSO, treated with DMSO as the solvent of AM251; and treatment with AM251 at doses of 5, 25, and 100 ng/ml. into the dentate gyrus of the hippocampus for four days, accompanied by training courses for the Morris test.
For stereotaxic surgery, rats were anesthetized by intraperitoneal injection of chloral hydrate (80 mg/kg) and placed in a stoelting stereotaxic apparatus (USA). The scalp was cleaned with iodine solution and incised at the midline, and a burr hole was drilled through the skull. Animals in the Aβ group were bilaterally injected with a solution containing 10 µg aggregated Aβ (25–35) (5µg/µl, Sigma, USA) in the dentate gyrus of the hippocampus (at coordinates 2.8 mm posterior to bregma, 2 mm lateral to sagittal suture, and 2.8 mm below dura) (Paxinos and Watson, 2006) to induce Alzheimer's disease, and animals in the control group received distilled water of the same volume.
For the formation of neurotoxic Aβ fibrils, Aβ was dissolved in distilled water and the resulting solution was incubated at 37 °C for 3 days. After surgery, each rat was kept individually in a clean and pre-disinfected-with-alcohol cage. In this study, a 5-day protocol for the Morris water maze and tau gene expression was assessed.
2-4. Behavioral testing
The Morris water maze was a black, rounded basin with a diameter of 136 cm and a height of 60 cm, which was filled up to 25 cm with a water temperature of 20 ± 1 °C. The maze is located in a room in which there are signs and symbols (such as a clock, window, poster, shelf, and light) around it and is hypothesized to be divided into four quarter circles with equal intervals. A circular platform made of plexiglass with a diameter of 10 cm was placed in the center of one of the quarter-circles below the surface of the water. A diode emitting infrared light will be connected by rubber tape to the back of the animal, and a video camera—detecting infrared light—will be installed at the top of the basin. Finally, the signals were transmitted to the computer and analyzed using the software system.
The time latency and distance traveled by the animal to find the hidden platform were measured.
2-4-1. Training the animals
In the experiments on the hidden platform, each rat was trained for four days; on each day, one block and each block were trained four times. In each block, the animal was released four times and only once in each direction (north, south, east, and west), randomly determined by the computer. Each time, 90 s will be allocated for the rat to find the location of the platform; otherwise, it will be directed towards the platform, and in all cases, 30 s will be given to stay on the platform and examine the surroundings.
2-4-2. Evaluation of health of the sensory-motor system
On the fifth day of the test, the platform was covered with aluminum paper and placed approximately one centimeter above the water surface until it was fully visible.
Through this experiment, called the visible platform, if the animal was able to find the platform, the health of the visual-motor system of the animal was confirmed. At the end of each experiment, animals were dried and transported to the cage.
The parameters of the distance traveled by the animal to reach the platform and the time lag on reaching the platform are considered indices of learning and spatial memory. Furthermore, swimming speed is an indicator of the health of the sensorimotor system of the animal.
2-5. 2-5. Evaluating tau gene expression using real-time PCR
After anesthesia, the hippocampus of the animals was removed and stored at -80 °C for PCR performance. Then, the total RNA of the hippocampal tissue was extracted using RNX+ extraction solution (Sinagen Company, Iran), based on the chloroform-alcohol protocol. The extracted RNAs was converted to cDNA using a cDNA synthesis kit for the tau gene. The primer sequences are listed in Table 1. qRT-PCR was performed using Taq polymerase and specific forward and reverse primers for the tau protein gene. Finally, the samples were electrophoresed, and gene expression levels were measured using the QIAGEN Real-Time PCR Detection System. Normalization was performed using the mean expression of the B2M gene with the best stability index. The relative quantification of tau was performed using the 2−ΔΔCT method.
Table 1. The stem loop primers sequences for cDNA synthesis and qRT- PCR.
Gene
|
Primers
|
Sequence
|
Tm (ºC)
|
B2M
|
Forward
|
GCTATCCAGAAAACCCCTC
|
60
|
Reverse
|
CCCGTTCTTCAGCATTTG
|
TAU
|
Forward
|
AAGTGTGGCTCATTAGGCAAC
|
60
|
Reverse
|
ACCACTGGCGACTTGTACAC
|
2.6. Statistical analysis
The data were analyzed using SPSS version 22 software and one-way ANOVA. The Tukey post hoc test was used for comparison between the different groups for verification, and p<0.05 was considered significant.