2.1 Reagents
Antibodies MMP1, MMP13, CollageII, IL-Iβ were obtained from Immunoway, IL-6, COX-2 from Hua'an, trypsin, radioimmunoprecipitation lysis (RIPA) buffer, Nuclear protein and cytoplasmic protein extraction kit,BCA kit, 5×SDS-PAGE sample loading buffer, BeyoECL Plus and penicillin streptomycin were purchased from Beyotime (Shanghai, China).Collagenase II was obtained from Sigma (St. Louis, MO, USA). DMEM/F12 was purchased from HyClone (South Logan, UT, USA). Fetal bovine serum was from Vicente. TRIzol reagent was purchased from Invitrogen (Carlsbad, CA, USA).5× HiScript II qRT SuperMix II was purchased from Vazyme (Nanjing, China). PI3K, p-PI3K antibodies or AKT, p-AKT antibodies were purchased from Immunoway. Goat anti-rabbit IgG and goat anti-mouse IgG were purchased from ZSGB-BIO (Beijing, China). Recombinant human IL-1β was obtained from Peprotech (Rocky Mount, NJ, USA). Cucurbitacin E was obtained from MCE China (Shanghai, China).Cell Counting Kit-8 was purchased from 7Sea Biotechnology (Shanghai, China). All gene primers were synthesized by Jereh Biotechnology (Shanghai, China).The reagents for saffron dyeing, Zangred O solid green dyeing, Alcian blue dyeing and HE dyeing are all from Servicebio
2.2 Cell culture and Animal feed
C28/I2 cells were obtained from Beijing Beina Chuanglian Institute of Biotechnology (Beijing, China) and cultured at 37°C in 5% CO2 humidified air in DMEM/F12 containing 10% fetal bovine serum (FBS), 1% L-glutamine and 1% mixture of penicillin, streptomycin and streptomycin antibiotics.Human cartilage was obtained from OA patients who underwent total knee arthroplasty (TKA) at the First Affiliated Hospital of Anhui Medical University. The cartilage pieces were minced in a sterile environment and digested with trypsin in a 37°C incubator for 30 minutes.After discarding the trypsin, the cartilage was soaked with medium containing 0.1% collagenase II for 24 h. We obtained the supernatant from the digested tissue after centrifugation at low speed (500 r/min × 5 min), and the supernatant was centrifuged again (1200 r/min × 5 min) to obtain the chondrocyte precipitate.Extracted chondrocytes were resuspended with DMEM/F-12 (an antibiotic mixture containing 10% FBS plus, 1% L-glutamine, 1% penicillin and streptomycin) and incubated with 5% CO2 at 37°C.The experimental mouse were C57/L6 mouse from Beijing Spelford Biotechnology Co., Ltd. After one week of adaptation time in the cage environment of SPF-grade mouse, the knee joints of the mouse were opened after anesthesia, the medial collateral ligament and anterior cruciate ligament were cut, and the mouse were allowed to limp for one month to simulate into a knee arthritis model. This study was conducted in accordance with the recommendations of the ethics committee of the First Affiliated Hospital of Anhui Medical University.The protocol was approved by the Ethics Committee of the First Affiliated Hospital of Anhui Medical University. All subjects provided written informed consent in accordance with the Declaration of Helsinki.
2.3 Cell viability assay (CCK8)
Cytotoxicity of CuE on chondrocytes was detected by Cell Counting Kit 8 (CCK-8). Chondrocytes were spread evenly in 96-well plates and 5000 cells/well were counted per well, incubated in a warm oven for 24 hours, and then treated with different concentrations of CuE for 24 hours.Subsequently,10µl of CCK-8 solution was added to each well and incubated for 2 h at 37°C. The absorbance at 450 nm was measured.
2.4 Morphology and saffron staining of chondrocytes cells in light microscope field with toluidine blue staining
The chondrocytes were inoculated in 12-well plates and incubated for 48 hours. The chondrocytes were then washed 3 times with PBS solution and fixed in 4% paraformaldehyde solution for 10 minutes.Paraformaldehyde was washed away with PBS and observed directly under the electron microscope for photographs; toluidine blue staining was performed after paraformaldehyde fixation, followed by treatment with 1% toluidine blue solution for 30 min at room temperature, and then the excess toluidine blue dye was washed away from the surface with PBS, and the chondrocytes were observed under the microscope and photographed.
2.5 Drug preparation and incubation
Cucurbitacin E in powder form was dissolved with certain DMSO and prepared to different reserve concentrations of the desired drug concentration (1 mM, 5 mM, 10 mM);IL-1β was equipped to 20ug/ml with exclusive diluent.Chondrocytes were inoculated in six-well plates and incubated for 48 h. Pre-stocked different concentrations of Cucurbitacin E were diluted with DMEM/F12 to the desired concentrations (1nM, 5nM, 10nM), and then chondrocytes were incubated at various concentrations of Cucurbitacin E. After a 2 h pretreatment, IL-1β was added at a diluted concentration of 20 ng/ml, used to mimic osteoarthritic cells in vitro, and then incubated for 24 h. The chondrocytes were incubated at various concentrations of Cucurbitacin E.
2.6 Western blotting
Protein expression of target genes was measured by protein blotting.For protein blotting, cells were lysed with a mixture of RIPA buffer and PMSF (100:1), and protein concentration was measured using the BCA kit after purification of total protein by high-speed cryogenic centrifugation (12,000 g/min × 15 min, 4°C).Then, we mixed the supernatant with 5 × sdds-PAGE sample loading buffer.Equal amounts of proteins were separated by sdd-page using a 10% acrylamide gradient. The proteins were then transferred onto PVDF membranes and placed in TBST-5% skim milk for 2 h at room temperature.After washing, the membranes were incubated in IL-1β antibody, COX-2 antibody,MMP-13 antibody, CollageII antibody, PI3K antibody, p-PI3K antibody, AKT antibody, p-AKT antibody, GAPDH antibody at 4°C overnight.The membranes are then washed at room temperature and incubated in TBST-5% skimmed milk containing goat anti-rabbit igg or goat anti-mouse IgG for 2 hours. The membranes were washed again with TBST solution and the signal was detected using BeyoECL Plus.
2.7 RT-Qpcr
Total cellular RNA containing mRNA was extracted from chondrocytes using TRIzol reagent.Synthesize cDNA from equal amounts of RNA in a PTC-100 programmable thermal controller using 5 × hiscript II qRT Super Mixture II.Gene expression was measured by rt-qpcr on an Agilent Mx3000p.The amplification procedure was as follows: pre-denaturation at 95°C for 5 min, followed by pre-denaturation at 95°C for 10 s and 60°C for 30 s, 40 cycles of bad, followed by lysis at 95°C for 15 s, lysis profile at 60°C for 34 s, and lysis at 95°C for 15 s. The amplification procedure was as follows: pre-denaturation at 95°C for 5 min, followed by pre-denaturation at 95°C for 10 s and 60°C for 30 s.Relative gene expression was analyzed by the 2-ΔΔct method.The primers were designed with the help of NCBI primer Blast tool. The list is as follows: MMP1(F)5’ATGAAGCAGCCCAGATGTGGAG3’(R)5’TGGTCCACATCTGCTCTTGGCA3’ MMP13(F)5’CCTTGATGCCATTACCAGTCTCC3’(R)5’AAACAGCTCCGCATCAACCTGC3’;CollageII(F)5’CCTGGCAAAGATGGTGAGACAG3’(R)5’CCTGGTTTTCCACCTTCACCTG3’; GAPDH(F)5’ACCCAGAAGACTGTGGATGG3’(R)5’TTCAGCTCAGGGATGACCTT3’
2.8 Fluorescence microscope
Cells were inoculated in 12-well plates with coverslips for culture, co-treated with IL-1β or IL-1β with 10uM CuE, and incubated with serum-free medium for 24 hours.Next, remove the coverslips.After being washed three times with PBS, they were fixed with 4% paraformaldehyde for 30 minutes at room temperature, washed three times with PBS, and permeabilized with 0.5% TritonX-100 for 20 minutes at room temperature.Then, cells were blocked with 5% BSA at 37°C, washed with PBS and incubated with primary antibody: p65 (1:200) for 24 hours at 4°C.Next, the secondary antibody (1:400) was washed three times with PBS and incubated at room temperature for 2 h. The nuclei were labeled with DAPI for 10 min. The slides were blocked after PBS washing and imaged with a fluorescence microscope.
2.9 Bioinformatics analysis and screening
Open the National center for Biotechnology Information web site (https://www.ncbi.nlm.nih.gov), downloaded from the comprehensive database (GEO) gene expression data sets: GSE114007 and GSE117999 used R software to screen out differential genes in the GSE114007 and GSE117999 data set, and used KEGG enrichment analysis to screen genes with significant changes in expression.
2.10 Cellular thermal shift assay (CETSA)
In the same way as the above cell culture method, human primary chondrocytes were cultured in a 10cm large dish, added into RIPA containing protease inhibitor, cleaved on ice for 20 minutes, transferred to 1.5EP tubes, centrifuged at 4℃ for 15 minutes at 12000r/min, and then fully shaken and divided into 2 tubes. CuE of working concentration was added to 1 tube, DMSO solution of equal volume was added to the other tube, shook well and left for incubation at room temperature for 2 hours. Then, the two tubes of solution were evenly divided into 5 small EP tubes, and each tube was incubated at different temperature gradients set for 5 minutes. Finally, the supernatant was centrifuged and mixed with SDS solution, and heated on a metal bath at 95℃ for 10 minutes. Westen blot analysis was performed after the solution was completed.
2.11 Molecular docking model
The 3D molecular structure of compound Cucurbitacin E(ID:5281319) was downloaded from PubChem website(https://pubchem.ncbi.nlm.nih.gov/) in sdf format. Then, under Amber10-EHT force field, Wash function was used to judge 3D conformation and hydrogen atom was added. The energy of rigid water molecules as solvent was minimized in 3D conformation and local charge was calculated. The optimized structure was searched for the molecular conformation of cucurbitine E by the conformation search module of MOE software, and the LowModeMD algorithm was used to generate conformation for molecular docking. The Dock module of MOE software is used to study the interaction between PI3K complex structure and the conformation search csear. sdf of cucurbit E. Triangle Matcher is used as the search engine for molecular docking. The scoring function London δG WAS used to evaluate the conformation of the butt butt for preliminary evaluation, 1000 optimal conformations were reserved for the Induced Fit method for flexible butt butt, the optimization results were evaluated by GBVI/WAS scoring function, and 100 optimal butt butt modes were finally reserved for subsequent analysis. By combining the pattern visualization check, the final butt conformation is selected and the structure pattern diagram is generated.
2.12 Histological analysis
Specimens were fixed in 4% paraformaldehyde for 24 hours and decalcified with 10% ethylenediaminetetraacetic acid for 4 weeks.The tissues were embedded in paraffin, cut perpendicular to the articular cartilage surface into 5-µm-thick sections, and stained with saffron O/solid green, HE staining, and Alisin blue staining, respectively.The extent of cartilage degeneration was assessed using the Osteoarthritis Research Society International (OARSI) cartilage histopathology assessment system.
2.13 Statistical analysis
All data are expressed as mean ± standard deviation.One-way analysis of variance (ANOVA) SPSS V.23.0 (SPSS Inc., Chicago, USA) was used to analyze the differences between groups.P < 0.05 was considered statistically significant.