Stem canker, caused by Phytophthora palmivora, poses a significant challenge for durian farmers in Malaysia. However, limited research has explored the genetic diversity of this pathogen using multiple genes. In this study, we aimed to characterize Phytophthora isolates associated with symptomatic durian tissues from four Malaysian states (Selangor, Perak, Pahang, and Melaka). We employed both morphological and molecular methods, including sequence analysis of the internal transcribed spacer (ITS) rDNA and the cytochrome oxidase c (COX) multi-locus combination of subunit I and subunit II gene regions. A total of 21 Phytophthora palmivora isolates were obtained from diseased durian stem tissues and identified based on phylogeny and morphological characteristics. Molecular identification using BLASTn analysis of the ITS and COX sequences confirmed their identity as P. palmivora showing sequence similarity ranging from 99 to 100% with the ex-type culture of P. palmivora (GenBank accession no. ON834450 for the ITS region and JF771543 for the COX region). Phylogenetic analyses of the ITS rDNA and COX further confirmed that all Phytophthora isolates belonged to P. palmivora, forming a distinct clade with reference P. palmivora isolates, with strong bootstrap values for the ITS (99%) and COX (76%) regions. Pathogenicity tests demonstrated that all isolates were pathogenic to durian leaves, with PMM02 displaying significantly lower virulence compared to other tested isolates. Detached leaf assays conducted with durian leaves from D10, D24 and Mousang King varieties revealed significance differences among durian varieties, with D10 exhibiting higher susceptibility to P. palmivora.
Research Article
Phylogenetic analysis and morphological characterization of Phytophthora palmivora causing stem canker disease of durian in Malaysia
https://doi.org/10.21203/rs.3.rs-3334279/v1
This work is licensed under a CC BY 4.0 License
Version 1
posted
You are reading this latest preprint version
stem canker
oomycete
durian
PCR
phylogeny
Durio zibethinus
Durian (Durio zibethinus) is a highly sought-after fruit, particularly in Asian countries. According to the Trade Map data (United Nations, 2018), Malaysia stands as the largest consumer of durian, boasting a per capita consumption rate of 11 kg. This fruit, valued at Ringgit Malaysia (RM) 7.49 billion (Department of Agriculture, 2020), holds immense economic importance and represents the largest cultivated crop in Malaysia. Consequently, it plays a pivotal role in generating income for both small-scale and commercial farmers alike. However, the persistent threat of stem canker disease, caused by Phytophthora palmivora, remains a pressing concern for durian growers worldwide, as it has the capacity to infect durian plants at all stages of growth. Unfortunately, this disease often goes unnoticed, as its symptoms initially manifest within the inner layers of the bark (Drenth and Sendall, 2001). Only when the damage becomes severe does it become evident on the outer bark surface. Despite various mitigation efforts aimed at reducing losses caused by this disease, the pathogen's diversity continues to be a critical factor in disease management.
A quick and accurate identification of Phytophthora spp. is crucial for disease control, particularly for quarantine purposes and limiting disease transmission in planting materials. Traditional identification of fungi typically involves cultivation and microscopic examination. While the Phytophthora genus is easily recognizable, the morphological distinctions between certain species within this genus are minimal, making precise species classification challenging (Drenth and Sendall, 2001). The traditional identification of the Phytophthora genus is based on the taxonomic keys provided by Waterhouse (1963), which categorize Phytophthora taxa into six morphological groups.
A rapid and accurate identification of Phytophthora species is essential. The utilization of multi-locus phylogenetic analysis, combined with morphological and pathogenicity data, has revolutionized Phytophthora classification. This identification method primarily relies on nucleotide sequence data from the internal transcribed spacer (ITS) region of ribosomal DNA (rDNA) (Cooke et al., 2000; Maizatul-Suriza et al., 2019).
In Malaysia, phylogenetic analysis of Phytophthora species is predominantly conducted using the rDNA ITS region, as studied by Latifah et al. (2018) and Mohamed Azni et al. (2017). Furthermore, other genomic regions and genes are now under extensive exploration. Specific to the Phytophthora genus, primers targeting cytochrome c oxidase subunit I (COXI) and subunit II (COXII) are employed and can be analyzed individually or in combination (Martin and Tooley, 2003; Martin et al., 2004). These Phytophthora genus-specific primers exhibit high specificity and serve as valuable diagnostic markers for verifying Phytophthora species in infected plant samples (Martin et al., 2004).
Analyzing genetic diversity is crucial for comprehending the species' evolutionary processes and developing effective management strategies (Mohamed Azni et al., 2019). Therefore, this study aimed to characterize Phytophthora palmivora isolates collected from symptomatic Durio zibethinus specimens across different geographic regions of Malaysia. This characterization included an assessment of morphological, molecular, and pathogenic characteristics, along with phylogenetic analysis.
Sample collection
Diseased durian stems exhibiting typical canker symptoms, characterized by water-soaking lesions on the bark surface and the exudation of reddish brown, resinous substances were randomly collected from durian farms in four different states of Malaysia: Selangor (GPS coordinates 2.990442, 101.710415), Perak (4.762602, 100.906975), Pahang (3.723923, 102.002405), and Melaka (2.160467, 102.434804), as illustrated in Fig. 1. The samples were gathered using a convenient sampling approach (Bouwmeester et al., 2016) and subsequently transported to the Mycology Laboratory 2 within the Department of Plant Protection, Faculty of Agriculture, Universiti Putra Malaysia for isolation. The disease incidence (DI) was calculated using the following formula (Cooke, 2006):
DI = Number of infected plants/ Total number of plants assessed × 100
Isolation of Phytophthora species from diseased durian tissues
Durian trees displaying symptoms of water-soaked lesions on the main trunk were sampled (Fig. 2a). The outer layer of the bark surface was carefully scraped to obtain samples from the advancing section of the lesion margin (Fig. 2b). Small pieces (1 × 1 cm2) of bark containing the lesion margins were cut using a machete. Subsequently, the cut pieces were surface-sterilised using a 1% sodium hypochlorite solution (NaOCl) for 30 s and rinsed three times with sterile distilled water. After sterilization, the pieces were gently blotted dry using sterile filter paper and then transferred onto P10VP medium (Tsao and Ocana, 1969). This medium contained 17g/L corn meal agar (CMA), 0.4 mL/L pimaricin, 2 mL/L vancomycin, and 100 mg of powdered pentachloronitrobenzene (PCNB). The plates were incubated at 28 ± 1.5°C in the dark for 2 days. The growing hyphae were excised and transferred onto V8 agar plates, which were then incubated for seven days under the same conditions. Hyphal tips from pure cultures were preserved in water (Miyake and Nagai, 2019) by transferring 5-mm agar plugs from the edge of actively growing colonies. These agar plugs were stored in 5 mL sterilized water in universal bottles and maintained at 28 ± 1.5°C.in the dark.
Morphological characterization of the fungal isolates
Agar plugs from P. palmivora isolates stored in sterile water, were transferred to the center of PDA agar plates and incubated at 28 ± 1.5°C in the dark for 7 days. Following this, a single hyphal tip from each pure isolate culture was placed onto PDA agar plates in five replications. These plates were incubated at 28 ± 1.5°C in the dark for 14 days. After the incubation period, colony characteristics were recorded, and measurements of colony diameter were taken at 3-day intervals. Morphological identification and characteristics of the isolates were determined using methods outlined by Waterhouse (1963) and Latifah et al. (2018). This included assessing colony pattern, such as colony color, surface texture, and elevation. Additionally, the radial growth rate per day (mm/day) of the isolates was recorded. To calculate the growth rate, the formula by Reeslev and Kjoller (1995) was employed:
Radial growth rate (Kr) = (R1 – R0)/ (t1 – t0)
R 0 and R1 are the colony radii at time t0 and t1. The significant difference in radial growth of all the isolates was determined using analysis of variance (ANOVA) at p ≤ 0.05.
For microscopic examination, the fungal isolates were inoculated onto 10% V8 agar in five replicates and incubated in the dark at 28 ± 1.5°C for 10 days. Microscopic analysis was conducted using lactophenol blue solution. A drop of the solution was placed onto a clean, grease-free glass slide, and a fragment of the fungus was carefully introduced into the stain. A coverslip was gently positioned on the slide and passed through a flame to eliminate any bubbles before observation under a microscope. The morphological characteristics of the pure fungal cultures were assessed based on descriptions provided in the taxonomic keys by Waterhouse (1963), Martin et al. (2012), and Drenth and Sendall (2001). Morphological characteristics and measurement of P. palmivora were investigated using a compound microscope (Olympus BX41, Japan) equipped with an eyepiece camera (Dino-Eye AM4023X) with DinoCapture 2.0 software. Morphological assessment of sporangial included the examination of sporangia (shape, apical thickening of sporangia or papilla, mean length and breadth, length/breadth ratio, and mean width of the exit pore) and chlamydospores (shape, mean diameter, and size range). For each isolate, these assessments were conducted in 30 replicates, and the resulting data were recorded and analyzed using SAS version 9.4
Molecular characterization
DNA extraction, PCR amplication, and sequencing
Pure culture of each fungal isolates were grown on Potato dextrose agar (PDA) plates at 28 ± 1.5°C in darkness for 10 days. Genomic DNA was extracted from 100 mg of mycelia for each of the 21 Phytophthora isolates using the DNeasy Plant Mini Kit (QIAGEN), with slight modifications. The concentration and purity of the genomic DNA were assessed using a NanoDrop ND-1000 spectrophotometer by measuring the UV absorbance at a ratio of 260/280 nm. For accurate molecular identification at the species level, two gene regions were employed, as detailed in Table 1. All 21 isolates underwent amplification of the ITS ribosomal DNA, including the ITS1, 5.8S rRNA, and ITS2 regions, using the ITS6 forward primer (5’-GAAGGTGAAGTCGTAACAAGG-3’) and ITS4 reverse primer (5’-TCCTCCGCTTATTGATATGC-3’), following the methodology of Cooke et al. (2000). For the Phytophthora genus-specific primer targeting cytochrome c oxidase (COX), a multi-locus combination of cytochrome c oxidase subunit I (COXI) and subunit II (COXII) was employed. The forward primer, FMPh-8b (AAAAGAGAAGGTGTTTTTTATGGA), was derived from mitochondrial sequences of COXII (base 624 to 657), while the reverse primer, FMPh-10b (GCAAAAGCACTAAAAATTAAATATAA), was derived from the COXI (base 73 to 98) gene (Martin et al., 2004). All oligonucleotides were procured from Apical Scientific Sdn. Bhd., Malaysia.
|
Marker |
Oligo-nucleotide |
Sequence 5’-3’ |
Reference |
|---|---|---|---|
|
ITS |
ITS6 |
Forward: GAAGGTGAAGTCGTAACAAGG |
(Cooke et al., 2000) |
|
ITS4 |
Reverse: TCCTCCGCTTATTGATATGC |
||
|
COXII |
FMPh-8b |
Forward: AAAAGAGAAGGTGTTTTTTATGGA |
(Martin et al., 2004) |
|
COXI |
FMPh-10b |
Reverse: GCAAAAGCACTAAAAATTAAATATAA |
PCR amplification reactions were prepared in a total volume of 20 µl containing 5 µl of Taq master mixture 4X (QIAGEN), 1 µl each of forward primer and reverse primer (10 µM), 3 µl of template DNA and 10 µl of nuclease-free water. The PCR amplification was performed in Eppendorf® Mastercycler® PRO S Thermal Cycler Model 6325. PCR conditions for ITS region consisted of initial denaturation step at 94°C for 5 min,, followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 53°C for 45 s, and extension at 72°C for 2 min with a final extension at 72°C for 10 minutes. For COX amplification, thermal cycling comprised of initial denaturation for 3 min at 95°C, followed by 40 cycles of denaturation at 95°C for 1 min, annealing at 49°C for 1 min, extension at 72°C for 1 min and a final extension at 72°C for 5 min. The amplification of ITS and COX PCR products were assessed by electrophoresis on 1% (w/v) agarose gel under 1× TBE buffer at 80 V for 30 min. Gels were stained with MIDORI Green Advance (Nippon Genetics, Japan) at 2 µl per 100 ml and were visualized under ultraviolet light and photographed using a gel documentation system (BioRad Gel DocTM2000). A 1 kb DNA ladder (6 µl) (Promega, Madison USA) was used to determine the size of the PCR products. PCR products of the ITS rDNA and COX gene regions were sequenced with the same forward and reverse primers by Apical Scientific Sdn. Bhd., a commercial sequencing service provider. Sequencing results of each isolate were manually edited using BioEdit sequence alignment editor software (Larkin et al., 2007). Preliminary identification of the fungal isolates was performed using non-redundant BLAST nucleotide tool at the National Centre for Biotechnology Information (http://blast.ncbi.nlm.nih.gov/blast.cgi) and the closest relative species of Phytophthora species were retrieved from the GenBank.
Phylogenetic analysis
Phylogenetic analyses were conducted using the ITS and COX datasets, where Clustal W algorithm was used to align the sequences in BioEdit Sequence Alignment Editor Software (Larkin et al., 2007). The ITS and COX sequences generated in this study were deposited in the GenBank database with accession numbers in Tables 4 and 5. The model with the lowest Bayesian information criteria (BIC) was selected as the best substitution pattern for each gene. The maximum likelihood method was implemented in MEGA v. 7.0 (Kumar et al., 2016) and branch support of the trees was evaluated through bootstrapping with 1,000 replications. For the phylogenetic analysis, the best fit models were selected using the Akaike information criterion, resulting in the Kimura-2-parameter model for the ITS region and Tamura 3-parameter + G distribution model for the COX region. All gaps were treated as missing data.
In the phylogenetic analysis of the ITS region, a total of 21 sequences from this study were included, along with 9 reference isolates of Phytophthora species. Additionally, Pythium aphanidermatum was incorporated as an outgroup. For the COX region, the phylogenetic analysis comprised 21 COX sequences generated from this study, as well as reference isolates of Phytophthora species. The nucleotide sequence of Pythium aphanidermatum was treated as an outgroup in the COX region analysis
Pathogenicity test
The pathogenicity test was conducted using healthy leaves from three commonly grown durian varieties in Malaysia: D10, D24, and Mousang King (United Nations, 2018). Three representative isolates from each state were selected based on uniform colony growth on PDA agar plates for the pathogenicity tests. These isolates originated from the following locations: Pusat Pertanian Universiti (PPU, UPM), Selangor (PSDG07, PSDG08, PSDG09); MARDI Kuala Kangsar, Perak (PKK01, PKK02, PKK03); Sg. Raub, Pahang (PPHG01, PPHG03, PPHG04); and Merlimau, Melaka (PMM01, PMM02, PMM03). Healthy mature leaves of D24 and Mousang King varieties were collected from MARDI Serdang (2.979075, 101.689872), while healthy D10 leaves were carefully harvested from PPU and UPM at coordinates 2.989811 and 101.709915.
This test was conducted following the protocols outlined by Mohamed Azni et al. (2019). For each treatment, four leaves were washed with tap water and then surface-sterilized using 10% NaOCl for 30 seconds, followed by rinsing three times with sterile distilled water. Afterward, the leaves were dried on sterile tissue paper and individually placed in sterile containers. Inoculation was carried out within a laminar flow chamber, using a 5-mm plug of a 14-day-old isolate grown on V8 agar. This plug was carefully positioned over a wound created on the leaf's surface using a sterilized needle. For control treatments, a 5-mm disc of V8 agar served as a substitute. Subsequently, the leaves were placed in sterile containers at room temperature (28 ± 1.5°C) with 100% humidity. The evaluation process commenced on the second day and was conducted at 2-day intervals until the eighth day after inoculation. Lesion lengths were measured using a digital electronic solar caliper meter (Model Mitutoyo CD67-S6")
The leaf disease severity index (DSI) was calculated using the formula given (Latifah et al. 2018):
The disease severity index was assessed on a scale of 1 to 4 using the following criteria: 1 = healthy leaf (no visible symptoms); 2 = initial lesion with a length of less than 5 mm; 3 = lesion measuring 5–10 mm in length; and 4 = lesion covering the entire leaf with discoloration exceeding 10 mm.
The experiment was conducted using a Randomized Complete Block Design (RCBD) with four replications for all treatments. The data collected underwent Analysis of Variance (ANOVA), and mean comparisons were conducted using Tukey’s Studentized Range (HSD) test at a significance level of p ≤ 0.05. Statistical analysis was carried out using the Statistical Analysis System (SAS version 9.4, Cary, NC, USA)
Pathogen Isolation
A total of 21 Phytophthora isolates were collected from four different states in Malaysia; Selangor (n = 10), Perak (n = 4), Pahang (n = 4) and Melaka (n = 3) (Table 2).
| State |
Location |
No. of infected plant units |
Total no. of plant units accessed |
Disease incidence (%) |
No. of isolates |
Isolate code1 |
|---|---|---|---|---|---|---|
| Selangor |
Pusat Pertanian Universiti, UPM |
39 |
211 |
18.5 |
10 |
PSDG 01 |
| PSDG 02 |
||||||
| PSDG 03 |
||||||
| PSDG 04 |
||||||
| PSDG 05 |
||||||
| PSDG 06 |
||||||
| PSDG 07 |
||||||
| PSDG 08 |
||||||
| PSDG 09 |
||||||
| PSDG 10 |
||||||
| Perak |
MARDI Kuala Kangsar |
20 |
162 |
12.3 |
4 |
PKK 01 |
| PKK 02 |
||||||
| PKK 03 |
||||||
| PKK 04 |
||||||
| Pahang |
Sungai Raub |
9 |
100 |
9 |
4 |
PPHG 01 |
| PPHG 02 |
||||||
| PPHG 03 |
||||||
| PPHG 04 |
||||||
| Melaka |
Merlimau |
10 |
144 |
6.9 |
3 |
PMM 01 |
| PMM 02 |
||||||
| PMM 03 |
1The first letter corresponds to the genus Phytophthora, followed by letters representing the originating durian farms for the samples (SDG = Serdang; KK = Kuala Kangsar; PHG = Pahang; MM = Merlimau, Melaka), and finally, the numbers denote the isolate number.
Morphological characterization of Phytophthora isolates
The morphological characteristics of the 21 isolates produced white-coloured stellate colonies with appressed to scanty fluffy mycelia and a sharply defined leading edge on PDA (Fig. 3). The average growth rate of these isolates ranged from 4.02 to 4.99 mm/day as indicated in Table 3. PSDG and PKK isolates exhibited a significantly higher growth rate when compared to the PMM isolates from Melaka.
Sporangial and chlamydospore morphology of P. palmivora was observed after 14 days of incubation on V8 agar plates in darkness at 28 ± 1.5°C. The sporangia in this study exhibited ovoid, obpyriform, and ellipsoid shapes, consistent with the descriptions by Pongpisutta and Sangchote (2004). Specifically, both PSDG and PKK isolates featured distinctly papillate sporangia with an ovoid shape (Figs. 4a and b). Isolate PPHG exhibited papillate sporangia, albeit with an obpyriform shape (Fig. 4c). For PMM isolates, the sporangia displayed an ellipsoid shape and were semi-papillate (Fig. 4d). Furthermore, all isolates featured caducous attachment, as described by Latifah et al. (2018), allowing them to easily detach from the sporangiophore.
As presented in Table 3, isolate PPHG exhibited significantly larger mean length and breadth measurements of 80.49 µm and 44.13 µm, respectively, resulting in a length/breadth ratio ranging from 1.39 to 2.47. Interestingly, the exit pore size of PPHG was similar to that of PKK and PMM, measuring 8.67 µm, 8.36 µm, and 8.19 µm, respectively. In contrast, PSDG displayed a significantly smaller exit pore with a mean width of 6.93 µm.. In this study, the average size of sporangia for PSDG, PKK, and PMM ranged from 51.53 to 56.59 µm in length and 34.25 to 39.27 µm in breadth. These findings align with those reported by Erwin and Ribeiro (1996), which indicated that the average size of P. palmivora sporangia typically ranged from 40 to 60 µm in length and 25 to 40 µm in breadth.
| Morphological characters |
PSDG |
PKK |
PPHG |
PMM |
|---|---|---|---|---|
| Location |
Selangor |
Perak |
Pahang |
Melaka |
| Colony colour |
White |
White |
White |
White |
| Colony pattern in PDA media |
Stellate |
Stellate |
Stellate |
Stellate |
| Mycelial fluffiness |
Appressed |
Appressed |
Scanty fluffy |
Appressed |
| Growth rate (mm/day) ± SE |
4.99 ± 0.09 a |
4.88 ± 0.32 a |
4.28 ± 0.51 ab |
4.02 ± 0.58 b |
| Sporangial characteristics |
|
|
|
|
| Shape |
Ovoid |
Ovoid |
Obpyriform |
Ellipsoid |
| Papilla |
Papillate |
Papillate |
Papillate |
Semi-papillate |
| Mean length (µm) ± MSE |
56.71 ± 1.44 b |
51.53 ± 1.35 b |
80.49 ± 2.20 a |
56.591 ± 1.63 b |
| Mean breadth (µm) ± MSE |
36.21 ± 0.81 bc |
34.25 ± 0.99 c |
44.13 ± 0.93 a |
39.27 ± 0.74 b |
| Length/Breadth ratio |
1.32–2.27 |
0.68–2.24 |
1.39–2.47 |
1.19–1.97 |
| Mean width of exit pore (µm) ± MSE |
6.93 ± 0.26 b |
8.36 ± 0.23 a |
8.67 ± 0.24 a |
8.19 ± 0.29 a |
| Chlamydospore characteristics |
|
|
|
|
| Shape |
Globose and plerotic with smooth wall |
Globose and plerotic with smooth wall |
Globose and plerotic with smooth wall |
Globose and slightly aplerotic with smooth wall |
| Mean diameter (µm) ± MSE |
31.26 ± 0.58 c |
36.49 ± 0.85 b |
39.94 ± 0.93 a |
36.64 ± 0.70 b |
| Range size (µm) |
25.53–38.29 |
27.10–50.42 |
30.92–51.18 |
28.65–44.62 |
Means within rows with the same letters are not significantly different by Tukey’s Studentized Range (HSD) Test at p ≤ 0.05. Average of 30 sporangia measurement.
All isolates exhibited chlamydospores with a globose shape and smooth wall (Figs. 4e, f, g, and h). Notably, the chlamydospores of PSDG, PKK, and PPHG isolates featured a plerotic wall, as described by Villa et al. (2006). In plerotic chlamydospores, there is no space between the oospore wall and the oogonium wall, effectively filling the entire oogonium. In contrast, the PMM isolate (Fig. 4h) displayed chlamydospores with a slightly aplerotic wall, as outlined by Martin et al. (2012), where space exists between the oospore and oogonium walls. The mean diameter of chlamydospores in this study ranged from 31.26 to 39.94 µm. These measurements align with the average chlamydospore diameter reported by Mchau and Coffey (1994), which is 36.2 ± 9.6 µm.
Phytophthora palmivora has been classified as group II by Waterhouse (1963) based on sporangium features and reproductive behavior. The morphological characteristics observed in the isolates from this study align with those described for P. palmivora in publications by Waterhouse (1963), Drenth and Sendall (2001), and Latifah et al. (2018)
Molecular characterization of Phytophthora isolates
DNA sequence analysis of the genomic ITS and mitochondrial COX regions was employed to identify the 21 isolates at the species level. All ITS and COX sequences analyzed have been submitted to GenBank, as detailed in Table 4 and Table 5. The PCR amplification of the ITS region from the durian Phytophthora sp. isolates yielded approximately 900 base pairs (bp) (Fig. 5). This aligns with previous findings by Bowman et al. (2007), Cooke et al. (2000), and Latifah et al. (2018), which amplified the P. palmivora ITS-rDNA region using ITS6 and ITS4 primers, resulting in a fragment of about 900 bp.
In Table 4, the sequences of the ITS region exhibited high homology (99–100%) with sequences from P. palmivora available in GenBank, as determined using the BLAST algorithm.
| No. |
Isolates |
GenBank Accession nos. |
Genbank closest hit |
Similarity |
Species |
|---|---|---|---|---|---|
| 1 |
PSDG01 |
OP558551 |
ON834450 |
99.88 |
P. palmivora |
| 2 |
PSDG02 |
OP558552 |
OL616293 |
100.00 |
P. palmivora |
| 3 |
PSDG03 |
OP558553 |
ON834450 |
100.00 |
P. palmivora |
| 4 |
PSDG04 |
OP558554 |
ON834450 |
99.88 |
P. palmivora |
| 5 |
PSDG05 |
OP558555 |
ON834450 |
100.00 |
P. palmivora |
| 6 |
PSDG06 |
OP558556 |
ON834450 |
100.00 |
P. palmivora |
| 7 |
PSDG07 |
OP558557 |
ON834450 |
99.88 |
P. palmivora |
| 8 |
PSDG08 |
OP558558 |
KY475630 |
100.00 |
P. palmivora |
| 9 |
PSDG09 |
OP558559 |
OL616293 |
100.00 |
P. palmivora |
| 10 |
PSDG10 |
OP558560 |
MH219876 |
100.00 |
P. palmivora |
| 11 |
PKK01 |
OP558561 |
ON834450 |
100.00 |
P. palmivora |
| 12 |
PKK02 |
OP558562 |
ON834450 |
100.00 |
P. palmivora |
| 13 |
PKK03 |
OP558563 |
ON834450 |
100.00 |
P. palmivora |
| 14 |
PKK04 |
OP558564 |
ON834450 |
100.00 |
P. palmivora |
| 15 |
PPHG01 |
OP558565 |
ON834450 |
99.88 |
P. palmivora |
| 16 |
PPHG02 |
OP558566 |
MH219876 |
100.00 |
P. palmivora |
| 17 |
PPHG03 |
OP558567 |
MH219876 |
100.00 |
P. palmivora |
| 18 |
PPHG04 |
OP558568 |
ON834450 |
100.00 |
P. palmivora |
| 19 |
PMM01 |
OP558569 |
KU308390 |
96.05 |
P. palmivora |
| 20 |
PMM02 |
OP558570 |
KU308390 |
98.60 |
P. palmivora |
| 21 |
PMM03 |
OP558571 |
ON834450 |
98.34 |
P. palmivora |
The phylogenetic tree based on the ITS nucleotide sequences, as shown in Fig. 6 summarizes 31 nucleotide sequences of Phytophthora species, with one Pythium species as an outgroup. Analysis with five additional P. palmivora ITS sequences retrieved from GenBank revealed similar results, with all P. palmivora isolates clustered into one clade with a strong bootstrap value of 100.
The fragments amplified for the COXI and COXII genes using the oligonucleotides FMPh-10b and FMPh-8b were 400–414 bp for the isolates in this study (Fig. 7). In a study conducted by Martin et al. (2004), COXI and COXII primers amplified the targeted regions of Phytophthora sp. with a length of 457 bp when these genes were used as a multi-locus combination.
For the COX region, preliminary BLASTn results indicated a close identity (99–100%) with P. palmivora isolates JF771543 and MN650587, as shown in Table 5.
| No. |
Isolate code |
GenBank Accession nos. |
Genbank closest hit |
Similarity |
Species |
|---|---|---|---|---|---|
| 1 |
PSDG01 |
OP605626 |
JF771543 |
99.70 |
P. palmivora |
| 2 |
PSDG02 |
OP605627 |
JF771543 |
99.70 |
P. palmivora |
| 3 |
PSDG03 |
OP605628 |
JF771543 |
99.70 |
P. palmivora |
| 4 |
PSDG04 |
OP605629 |
JF771543 |
99.70 |
P. palmivora |
| 5 |
PSDG05 |
OP605630 |
JF771543 |
99.70 |
P. palmivora |
| 6 |
PSDG06 |
OP605631 |
JF771543 |
99.70 |
P. palmivora |
| 7 |
PSDG07 |
OP605632 |
MN650587 |
99.42 |
P. palmivora |
| 8 |
PSDG08 |
OP605633 |
JF771543 |
99.70 |
P. palmivora |
| 9 |
PSDG09 |
OP605634 |
JF771543 |
99.70 |
P. palmivora |
| 10 |
PSDG10 |
OP605635 |
JF771543 |
99.70 |
P. palmivora |
| 11 |
PKK01 |
OP605636 |
JF771543 |
99.70 |
P. palmivora |
| 12 |
PKK02 |
OP605637 |
JF771543 |
99.70 |
P. palmivora |
| 13 |
PKK03 |
OP605638 |
JF771543 |
99.70 |
P. palmivora |
| 14 |
PKK04 |
OP605639 |
JF771543 |
99.70 |
P. palmivora |
| 15 |
PPHG01 |
OP605640 |
JF771543 |
99.70 |
P. palmivora |
| 16 |
PPHG02 |
OP605641 |
JF771543 |
99.70 |
P. palmivora |
| 17 |
PPHG03 |
OP605642 |
JF771543 |
99.70 |
P. palmivora |
| 18 |
PPHG04 |
OP605643 |
JF771543 |
99.70 |
P. palmivora |
| 19 |
PMM01 |
OP605644 |
JF771543 |
99.70 |
P. palmivora |
| 20 |
PMM02 |
OP605645 |
JF771543 |
99.70 |
P. palmivora |
| 21 |
PMM03 |
OP605646 |
JF771543 |
99.70 |
P. palmivora |
The phylogenetic relationships within the Phytophthora genus, based on the COXI and COXII genes, were initially established by Martin and Tooley in 2003. As shown in Fig. 8, the taxon sampling included 33 sequences, with Pythium aphanidermatum serving as an outgroup. Phylogenetic analysis demonstrated that all 21 isolates from this research study clustered together within a clade, exhibiting a 100% bootstrap value.
Pathogenicity test
In this study, all 12 representative isolates were pathogenic to durian leaves, regardless of their origins. Following inoculation onto healthy durian leaves, all isolates induced distinct brown lesions and water-soaking symptoms within 2 days. In contrast, control leaves remained symptomless, as shown in Table 6. Consistent with the findings of Sarria et al. (2016), symptoms of P. palmivora, characterized by dark-brown lesions on inoculated leaves, were observed as early as 2 days post-inoculation. Similarly, water-soaking symptoms caused by P. palmivora were also reported on durian leaves (Mohamed Azni et al., 2019), with symptoms developing 4 days after inoculation. To confirm Phytophthora spp. as the pathogen responsible for these symptoms, re-isolation was performed using the margins of infected detached durian leaves plated on V8 agar. The pathogen was successfully isolated after 7 days of incubation at 28 ± 1.5°C, and the culture closely resembled the original pathogen previously inoculated.
Doohan (2003) confirmed that fungal pathogens vary in their optimal environmental conditions, necessary for inoculum production, dispersal, and disease development. In this study, isolates from four different states were subjected to the same conditions to observe their pathogenicity. As depicted in Fig. 9, the most virulent isolate was PKK02 from Perak, followed by PPHG03 from Pahang, and PSDG08 from Selangor, all of which exhibited moderate virulence with lesion diameters of 136.31 mm, 132.01 mm, and 131.13 mm, respectively, after 8 days of inoculation (Table 6). Conversely, leaves in the control group, inoculated with sterile water, showed no symptoms 8 days after inoculation.
According to Fig. 10, all tested isolates exhibited pathogenicity towards durian leaves. However, isolate PMM02 from Melaka displayed high virulence on the D10 durian variety, moderate virulence on Mousang King, and was avirulent towards D24..
| Factor |
Variables |
Lesion diameter (mm) |
||||
|---|---|---|---|---|---|---|
| |
|
Day 0 |
Day 2 |
Day 4 |
Day 6 |
Day 8 |
| Varieties |
D10 |
0.00 ± 0.00 a |
5.10 ± 0.44 b |
21.93 ± 2.53 a |
114.52 ± 5.31 a |
144.87 ± 1.87 a |
| |
D24 |
0.00 ± 0.00 a |
5.66 ± 0.47 b |
18.98 ± 2.18 a |
70.68 ± 5.20 b |
112.37 ± 5.40 b |
| |
Mousang King |
0.00 ± 0.00 a |
8.02 ± 0.42 a |
21.06 ± 0.87 a |
80.94 ± 3.57 b |
110.65 ± 4.30 b |
| Isolates |
PSDG07 |
0.00 ± 0.00 a |
7.23 ± 0.74 ab |
23.93 ± 1.59 a |
104.13 ± 8.34 a |
130.52 ± 4.10 a |
| |
PSDG08 |
0.00 ± 0.00 a |
7.55 ± 0.88 ab |
23.95 ± 4.96 a |
95.54 ± 8.08 a |
131.13 ± 4.60 a |
| |
PSDG09 |
0.00 ± 0.00 a |
8.32 ± 0.52 a |
28.45 ± 5.83 a |
99.49 ± 9.20 a |
129.33 ± 6.06 a |
| |
PKK01 |
0.00 ± 0.00 a |
8.13 ± 0.40 ab |
23.44 ± 3.94 a |
98.53 ± 8.24 a |
125.27 ± 4.66 a |
| |
PKK02 |
0.00 ± 0.00 a |
6.99 ± 1.09 ab |
24.03 ± 3.55 a |
102.71 ± 5.72 a |
136.31 ± 5.76 a |
| |
PKK03 |
0.00 ± 0.00 a |
7.73 ± 0.45 ab |
20.44 ± 3.09 a |
100.61 ± 9.28 a |
124.43 ± 6.04 a |
| |
PPHG01 |
0.00 ± 0.00 a |
7.28 ± 0.35 ab |
26.36 ± 5.36 a |
102.92 ± 8.44 a |
129.79 ± 5.58 a |
| |
PPHG03 |
0.00 ± 0.00 a |
5.67 ± 1.04 ab |
17.55 ± 1.43 ab |
95.34 ± 8.07 a |
132.01 ± 5.51 a |
| |
PPHG04 |
0.00 ± 0.00 a |
5.13 ± 0.92 b |
17.11 ± 0.65 ab |
83.80 ± 12.23 a |
129.75 ± 5.81 a |
| |
PMM01 |
0.00 ± 0.00 a |
5.25 ± 0.94 ab |
19.47 ± 3.21 a |
83.86 ± 10.11 a |
121.40 ± 5.33 a |
| |
PMM02 |
0.00 ± 0.00 a |
0.00 ± 0.00 c |
2.46 ± 1.08 b |
20.30 ± 10.66 b |
64.04 ± 20.98 b |
| |
PMM03 |
0.00 ± 0.00 a |
5.85 ± 0.83 ab |
20.69 ± 4.36 a |
77.34 ± 9.78 a |
117.58 ± 6.99 a |
| Variety |
- |
** |
ns |
** |
** |
|
| Isolate |
- |
** |
** |
** |
** |
|
| Variety x Isolate |
- |
ns |
ns |
ns |
** |
|
Lesion diameter (mm) developed on the leave are expressed as mean ± SE (standard error). Means with different letters within the same column are significantly different at p < 0.05 using Tukey test
In this study, it was observed that the agar disc containing P. palmivora mycelium produced lesions in three different durian varieties: D10, D24, and Musang King, with varying disease severity indexes. Lesion development was observed as early as day 2 after inoculation. As illustrated in Fig. 11, the disease severity index exhibited the highest percentage of lesions on Musang King leaves compared to the other durian varieties, just 2 days after inoculation (Table 6).
However, once the infection was established, P. palmivora multiplied within the host, releasing new sporangia into the environment through stomata or epidermal eruptions (Misman et al., 2022). Notably, in variety D10, a significantly higher percentage of lesions (144.87 mm) was observed at 8 days after inoculation (Table 7). In a screening of durian cultivars for their susceptibility to P. palmivora in Australia, D10 was found to be one of the most susceptible cultivars (Vawdrey et al., 2005b)
| Isolates |
Disease severity index (%) |
||
|---|---|---|---|
| D10 |
D24 |
Mousang King |
|
| Control |
25.00 |
25.00 |
25.00 |
| PSDG07 |
75.00 |
75.00 |
93.75 |
| PSDG08 |
56.25 |
68.75 |
93.75 |
| PSDG09 |
68.75 |
68.75 |
93.75 |
| PKK01 |
68.75 |
75.00 |
87.50 |
| PKK02 |
50.00 |
68.75 |
93.75 |
| PKK03 |
50.00 |
75.00 |
81.25 |
| PPHG01 |
75.00 |
68.75 |
81.25 |
| PPHG03 |
56.25 |
68.75 |
87.50 |
| PPHG04 |
56.25 |
68.75 |
81.25 |
| PMM01 |
56.25 |
56.25 |
81.25 |
| PMM02 |
25.00 |
25.00 |
31.25 |
| PMM03 |
56.25 |
62.50 |
81.25 |
A total of 21 Malaysian isolates of Phytophthora underwent morphological characterization studies. Observations of the cultural studies indicated that the isolates were identified as Phytophthora palmivora, consistent with Waterhouse's description (1974). According to Drenth and Sendall (2001), the presence of chlamydospores served as a diagnostic feature to support this identification, as not all Phytophthora species produce chlamydospores. Waterhouse (1974) had previously reported that P. palmivora naturally possesses the ability to produce chlamydospores. Chlamydospore production in the studied Phytophthora isolates was found to be abundant on agar, as mentioned by Drenth and Sendall (2001). In contrast, other species of Phytophthora tend to exhibit better chlamydospore production in liquid media. A study by Latifah et al. (2018) also confirmed abundant chlamydospore production by P. palmivora on agar media.
The PCR amplication of the ITS region exhibited a total of 13 out of the 21 isolates collected in this study had 99–100% identity with P. palmivora ex-type culture ON834450, causing stem canker on durian in Thailand. There have been reports of intraspecific level variations in P. citrophthora in the citrus plant in a study performed by Cohen et al. (2003) using the ITS region. However, in this study, there was no intraspecific variation for ITS-rDNA within the 21 of P. palmivora isolates sampled in Malaysia.
Phylogenetic tree of the COX region revealed that the isolates from durian and sequences of P. palmivora obtained from the present study and other species of this genus obtained in Genbank showed that all isolates obtained in this study clustered in high bootstrap support (76%) with the strain of P. palmivora. Other Phytophthora species were clustered into separate clades based on high distance from the isolates. An advantage of the COX primer is its use as a universal primer for the Phytophthora genus. Intra-specific variation in COX is lower than in the ITS-rRNA region, which is specific for amplification of Phytophthora spp. (Rahman et al., 2014).
The nucleotide search database in NCBI showed high similarity with existing P. palmivora sequences. The molecular data provides more precise and accurate data for species identification than morphological identification. Sequences of the ITS rDNA region (Lee and Taylor, 1992) and COX region (Martin et al., 2014) have been frequently used to identify phylogenetic relationships among several Phytophthora species and have clarified some taxonomic relationships within the genus (Cooke et al., 2000; Förster et al., 2000). Thus, all 21 isolates were confirmed through ITS and COX sequencing as P. palmivora. The results are in agreement with the morphological identification.
Despite having similar morphological features, isolates of the same species might be either pathogenic or non-pathogenic towards the host plant (Mohamed Azni et al., 2017). The results in Table 6 indicated that durian varieties D10, D24, and Mousang King were susceptible to P. palmivora species. The surface characteristics of durian leaves aid the pre-penetration of P. palmivora into the host (O’Gara et al., 2004). This is because motile zoospores can attach randomly onto the adaxial side of durian leaves that features a continuous cuticle with no stomata or trichomes (Misman et al. 2022). Phytophthora palmivora binds, generates extensive hyphae, and sporulates under favourable environmental conditions, thus completing the life cycle on infected durian tissue within eight hours of inoculation (Vawdrey et al., 2005a). The pathogenicity test in this study demonstrated that all tested isolates were moderately or highly virulence on durian as summarized in Table 6.
McMahon and Purwantara (2004) stated that the P. palmivora population has a wide range of strains, but not all are pathogenic. The existence of a unique RXLR effector, which contributes to the diverse functional and co-evolutionary diversity of the P. palmivora isolates, may explain the variations in aggressiveness among P. palmivora isolates (Mohamed Azni et al., 2019). The detached-leaf bioassays using durian leaves of D10, D24 and Mousang King varieties showed that D10 was proven to be more susceptible to P. palmivora.
Thus, it is critical to address the significance of this study to effectively control P. palmivora, accurate identification of the pathogen and understanding the pathogenicity and aggressiveness of the pathogen are necessary.
Acknowledgments
This study was funded by the Malaysian Ministry of Higher Education, under the Fundamental Research Grant Scheme (FRGS), grant reference code FRGS/1/2019/WAB01/UPM/02/20. The authors would also like to thank Universiti Putra Malaysia and MARDI for providing research facilities for this study.
Author contribution
NDND and SII conceived the study. NDND gathered samples from different states and performed morphological analyses with TS. NDND performed the molecular analyses and interpreted the data with the help of SII. NDND and SII wrote the manuscript with contributions from the co-authors, especially NA and TS.
Data availability
The datasets generated and analysed during the current study are available from the corresponding author on reasonable request.
Conflict of interest. The authors declare no competing interests.
- Bouwmeester H, Heuvelink GBM, Stoorvogel JJ (2016) Mapping crop diseases using survey data: The case of bacterial wilt in bananas in the East African highlands. European Journal of Agronomy 74:173-184
- Bowman KD, Albrecht U, Graham JH, Bright DB (2007) Detection of Phytophthora nicotianae and P. palmivora in citrus roots using PCR-RFLP in comparison with other methods. European Journal of Plant Pathology 119(2):143-158
- Cohen S, Allasia V, Venard P, Notter S, Vernière C, Panabières F (2003) Intraspecific variation in Phytophthora citrophthora from citrus trees in Eastern Corsica. European Journal of Plant Pathology 109(8):791-805
- Cooke BM (2006) Disease assessment and yield loss. In: Cooke BM, Gareth JD, Kaye B (Eds.) The epidemiology of plant diseases. Springer. pp. 43-80
- Cooke DEL, Drenth A, Duncan J, Wagels G, Brasier CM (2000) A molecular phylogeny of Phytophthora and related oomycetes. Fungal Genetics and Biology 30(1):17-32
- DOA. Department of Agriculture Malaysia, Fruit crop statistics 2020. Available at: http://www.doa.gov.my/index/resources/aktiviti_sumber/sumber_awam/maklumat_pertanian/perangkaan_tanaman/perangkaan_buah_2020.pdf. Accessed on December 13, 2021
- Doohan FM, Brennan J, Cooke BM (2003) Influence of climatic factors on Fusarium species pathogenic to cereals. In: Xu X, Bailey JA, Cooke BM (Eds.) Epidemiology of Mycotoxin Producing Fungi. Springer. pp. 755-768
- Drenth A, Sendall B (2001) Practical guide to detection and identification of Phytophthora. CRC Press.
- Erwin DC, Ribeiro OK (1996) Phytophthora diseases worldwide. American Phytopathological Society (APS) Press. USA
- Förster H, Cummings MP, Coffey MD (2000) Phylogenetic relationships of Phytophthora species based on ribosomal ITS 1 DNA sequence analysis with emphasis on Waterhouse groups V and VI. Mycological Research 104:1055-1061
- Kumar S, Stecher G, Tamura K (2016) MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Molecular Biology and Evolution 33(7):1870-1874
- Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Higgins DG (2007) Clustal W and Clustal X version 2.0. Bioinformatics 23(21):2947-2948
- Latifah M, Kamaruzaman S, Abidin MAZ, Nusaibah SA (2018) Identification of Phytophthora spp. from perennial crops in Malaysia, its pathogenicity and cross-pathogenicity. Sains Malaysiana 47(5):909-921
- Lee SB, Taylor JW (1992) Phylogeny of five fungus-like protoctistan Phytophthora species, inferred from the internal transcribed spacers of ribosomal DNA. Molecular Biology and Evolution 9(4):636-653
- Maizatul-Suriza M, Dickinson M, Idris AS (2019) Molecular characterization of Phytophthora palmivora responsible for bud rot disease of oil palm in Colombia. World Journal of Microbiology and Biotechnology 35(3):1-23
- Martin FN, Tooley PW (2003) Phylogenetic relationships among Phytophthora species inferred from sequence analysis of mitochondrially encoded cytochrome oxidase I and II genes. Mycologia 95(2):269-284
- Martin FN, Abad ZG, Balci Y, Ivors K (2012) Identification and detection of Phytophthora: Reviewing our progress, identifying our needs. Plant Disease 96(8):1080-1103
- Martin FN, Blair JE, Coffey MD (2014) A combined mitochondrial and nuclear multilocus phylogeny of the genus Phytophthora. Fungal Genetics and Biology 66:19-32
- Martin FN, Tooley PW, Blomquist C (2004) Molecular detection of Phytophthora ramorum, the causal agent of sudden oak death in California, and two additional species commonly recovered from diseased plant material. Phytopathology 94(6):621-631
- Mchau GR, Coffey MD (1994) Isozyme diversity in Phytophthora palmivora: evidence for a southeast Asian centre of origin. Mycological Research 98(9):1035-1043
- McMahon P, Purwantara A (2004) Phytophthora on cocoa. In: Drenth A, Guest DI (Eds.) Diversity and management of Phytophthora in Southeast Asia. Australian Centre for International Agricultural Research (ACIAR) pp. 104-115
- Misman N, Samsulrizal NH, Noh AL, Wahab MA, Ahmad K, Ahmad Azmi NS (2022) Host range and control strategies of Phytophthora palmivora in Southeast Asia perennial crops. Pertanika Journal of Tropical Agricultural Science 45(4):991-1019
- Miyake N, Nagai H (2019) Pathogenicity of Phytophthora palmivora to fig fruits after its long-term storage in water. Journal of General Plant Pathology 85(4):251-256
- Mohamed Azni INA, Sundram S, Ramachandran V (2019) Pathogenicity of Malaysian Phytophthora palmivora on cocoa, durian, rubber and oil palm determines the threat of bud rot disease. Forest Pathology 49(6):e12557
- Mohamed Azni INA, Sundram S, Ramachandran V, Abu Seman I (2017) An in vitro investigation of Malaysian Phytophthora palmivora isolates and pathogenicity study on oil palm. Journal of Phytopathology 165(11-12):800-812
- O’Gara E, Sangchote S, Fitzgerald L, Wood D, Seng AC, Guest DI (2004) Infection biology of Phytophthora palmivora Butl. in Durio zibethinus L. (Durian) and responses induced by phosphonate. In: Drenth A, Guest DI (Eds.) Diversity and management of Phytophthora in Southeast Asia. Australian Centre for International Agricultural Research (ACIAR). pp. 42-52
- Pongpisutta R, Sangchote S (2004) Morphological and host range variability in Phytophthora palmivora from durian in Thailand. In: Drenth A, Guest DI (Eds.) Diversity and management of Phytophthora in Southeast Asia. Australian Centre for International Agricultural Research (ACIAR). pp. 53
- Rahman MZ, Uematsu S, Coffey MD, Uzuhashi S, Suga H, Kageyama K (2014) Re-evaluation of Japanese Phytophthora isolates based on molecular phylogenetic analyses. Mycoscience 55(4):314-327
- Reeslev M, Kjoller A (1995) Comparison of biomass dry weights and radial growth rates of fungal colonies on media solidified with different gelling compounds. Applied and Environmental Microbiology 61(12): 4236-4239
- Sarria GA, Martinez G, Varon F, Drenth A, Guest DI (2016) Histopathological studies of the process of Phytophthora palmivora infection in oil palm. European Journal of Plant Pathology 145(1):39-51
- Tsao PH, Ocana G (1969) Selective isolation of species of Phytophthora from natural soils on an improved antibiotic medium. Nature 223(5206):636-638
- UN. United Nations, Durian Global Market Report 2018. Available at: http://www.plantationsinternational.com/ docs/durian-market.pdf. Accessed on December 13, 2021
- Vawdrey LL, Langdon P, Martin T (2005a) Incidence and pathogenicity of Phytophthora palmivora and Pythium vexans associated with durian decline in far northern Queensland. Australasian Plant Pathology 34:127-128
- Vawdrey LL, Martin TM, De Faveri J (2005b) A detached leaf bioassay to screen Durian cultivars for susceptibility to Phytophthora palmivora. Australasian Plant Pathology 34(2):251-253
- Villa NO, Kageyama K, Asano T, Suga H (2006) Phylogenetic relationships of Pythium and Phytophthora species based on ITS rDNA, cytochrome oxidase II and β-tubulin gene sequences. Mycologia 98(3):410-422
- Waterhouse GM (1963) Key to the species of Phytophthora de Bary. Commonwealth Mycological Institute, Kew, UK. Mycologia 92:22
- Waterhouse GM (1974) Phytophthora palmivora and some related species. In: Gregory PH (Ed.) Phytophthora disease of cocoa. Longman. pp. 51-70