Rest Profoundly Protects Against Cardiac Remodeling and Benefits Repair

doi:10.21203/rs.3.rs-334421/v1

Download PDF

Biological Sciences - Article

Rest Profoundly Protects Against Cardiac Remodeling and Benefits Repair

https://doi.org/10.21203/rs.3.rs-334421/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 21 Nov, 2022

Read the published version in JCI Insight →

Version 1

posted

You are reading this latest preprint version

Cardiovascular disease is a leading cause of morbidity and mortality worldwide¹. Although rest has long been considered beneficial to patients², remarkably there are no evidence-based experimental models determining how it benefits disease outcomes. Here, we create a novel experimental rest model in mice, whereby light-induced manipulation of the circadian system briefly extends the rest period by 4 hours each morning. We found, in two different cardiovascular disease conditions (cardiac hypertrophy, myocardial infarction), that imposing a short, extended period of rest each day persistently reduces cardiac remodeling, as compared to control mice subjected to only normal periods of rest, supporting the therapeutic benefits of rest to slow functional decompensation in heart disease. Mechanistically, rest reduces hemodynamic stress on the cardiovascular system, imposing changes on myofilament contractile function in the heart independently consistent within each disease phenotype. Molecular analyses reveal attenuation of cardiac remodeling genes, consistent with the benefits on cardiac structure and function. These same cardiac remodeling genes underlie the pathophysiology of many major human cardiovascular conditions, as demonstrated by interrogating open-source transcriptomic data, and thus patients with other conditions may also benefit from a morning rest period in a similar manner. In summary, we report that rest is a key driver of physiology, leading to the development of an entirely new field on the nature of rest, and provide a strong rationale for advancement of rest based therapy for major clinical diseases.

Cardiac & Cardiovascular Systems

Evidence-based Experimental Models

Circadian System

Cardiac Remodeling

Slow Functional Decompensation

Heart Disease

Hemodynamic Stress

Myofilament Contractile Function

Cardiovascular disease is a major healthcare and economic burden, with complex clinical phenotypes that frequently progress towards heart failure, for which there is no cure. Circadian rhythms of daily rest and activity contribute to the pathogenesis and pathophysiology of cardiovascular disease^3,4. Physicians have long aligned with the notion that rest benefits patient outcomes². Indeed Hippocrates, the father of medicine, is quoted as saying “rest as soon as there is pain”. However, clinical recommendations have irrationally tended towards absolute bed rest, resulting in a conundrum as studies infer no benefits or even worse outcomes with complete immobilization in bed⁵. Clinical studies also lack clarity as they focus only on the negative consequences of disruption on the heart, for example due to insufficient sleep^6-9, social jetlag¹⁰, or shiftwork¹¹. Similarly, experimental rodent studies also only focus on the adverse effects of circadian disruption or environmental desynchrony on the heart (reviewed in^12-14), and thus fail to recapitulate the full range of benefits of rest on cardiovascular healing. Indeed, there is little definitive evidence supporting how or why rest benefits heart health and repair. As a result, fundamental physiological and molecular mechanisms of rest remain unclear, and there are no evidence-based data available to benefit individuals with cardiovascular disease. This experimental study in mice co-opts the circadian system to add a short period of early morning rest, in addition to the normal night time rest period, to demonstrate for the first time how rest drives physiologic and molecular responses to benefit cardiovascular disease outcomes.

An ‘extended-rest’ mouse model protects against cardiovascular disease

Rest is a fundamental aspect of human biology, yet little is known about the biological effects of a brief daily rest period on healing of peripheral organs such as the heart. To determine this, male C57BL/6N wild-type mice were subjected to two different heart disease models, each of which recapitulates a major human cardiovascular disease (cardiac hypertrophy, myocardial infarction), followed by imposition of a short extended daily rest period, and benefits were observed in vivo. We first examined what happens in pathological cardiac hypertrophy, using the murine transverse aortic constriction (TAC) model. Following recovery from surgery, mice were randomized to either: i) a normal 12 hour (h) light: 12 h dark cycle (normal model; LD 12:12, control) or ii) 12 h light, plus an additional 4 h of blue light (420-520 nm) to stimulate the retinal photoreceptors of the circadian system and delay the onset of activity¹⁵, followed by 8 h dark (rest model; LBD 12:4:8, +Rest). Animals were maintained under these conditions for 4 weeks post-surgery, which recapitulates the cardiac hypertrophy phenotype in this model (Fig. 1a). As expected, the TAC mice developed cardiac hypertrophy, consistent with previous studies^16-18. In contrast, we found that mice provided additional daily rest post-TAC (TAC+Rest) developed less adverse cardiac remodeling and maintained better cardiac function, as shown by echocardiography (Fig. 1b). Indeed, as compared to TAC hearts from mice maintained on just a normal light: dark cycle, those in the rest group had significantly smaller left ventricular internal dimensions at diastole (LVIDd) and systole (LVIDs) and better ejection fraction (% EF) and fractional shortening (% FS) by 4 weeks in vivo (Fig. 1c, Extended Data Table 1). The extended rest period also protected against the development of cardiac hypertrophy (Fig. 1d), as evidenced by significantly smaller heart weight (HW) and HW: body weight (HW:BW) ratios, as compared to controls (Fig. 1e). We next examined what happens in ischemic heart disease, using the permanent left anterior descending coronary artery ligation model of myocardial infarction (MI). Following recovery from surgery, mice were randomized to the same treatment groups, either control (normal LD 12:12), or the rest model (LBD 12:4:8) to stimulate the circadian system mediated delay of activity onset. Animals were maintained for up to 8 weeks post-MI, which recapitulates progression to heart failure in this model (Fig. 1f). As expected, the MI mice developed adverse cardiac remodeling, consistent with our previous studies^19-21. In contrast, we discovered that the MI+Rest mice developed significantly less left ventricular dilation (Fig. 1g) and longitudinal echocardiographic evaluation revealed better preserved cardiac function by 8 weeks post-MI (Fig. 1h and Extended Data Table 2). The extended rest period also protected against infarct expansion, resulting in smaller scars and better infarct thickness and integrity, as demonstrated by histopathology at 8 weeks post-MI (Fig. 1i-k). Collectively, these data demonstrate using two different models of acquired heart disease, that an additional brief period of rest each morning significantly limits adverse cardiac remodeling and improves long-term outcomes.

Light-induced manipulation of the circadian system to impose rest

The data thus far suggest that exposure to a brief extended daily period of rest profoundly preserves cardiac structure and function in two murine models that mirror the clinical features of human cardiovascular disease. Taking advantage of light as the primary zeitgeber regulating daily circadian rhythms of rest and activity, we evaluated the effects of spectral distribution, as the intrinsically photosensitive melanopsin containing retinal ganglionic cells which mediate most of the effects of light on the circadian mechanism are sensitive to short-wavelength (e.g. blue) but not long-wavelength (e.g. red) light^22-24. The sensitivity of the circadian system to light for imposing rest in murine heart disease is unknown.

Analysis of 24 h locomotor activity using running wheel actigraphy revealed that an additional 4 h of normal white light during what would otherwise be the start of the active period, resulted in a 4 h extended rest period (Fig. 2a-b). Importantly, with the extended period of rest in the morning hours, the animals still maintained a normal circadian period of ~24 h (Fig. 2a) even though the number of hours per day spent at rest were significantly increased (Fig. 2c). Moreover, we determined that short-wavelength blue light alone (420-520 nm) was sufficient to delay activity onset, while maintaining a normal circadian period of ~24 h (Fig. 2d), thus imposing more hours per day spent at rest (Fig. 2e-f). In contrast, mice exposed to red light showed no change daily activity patterns, as expected, as the circadian system is not sensitive to long-wavelength light (>620 nm) (Extended Data Fig. 1). These observations are consistent with the notion that the rest model mechanistically co-opts the circadian system to interrogate the benefits of a brief daily period of rest on cardiac pathophysiology.

In contrast with our findings in mice subjected to the normal LD 12:12 cycle, we detected reduced hemodynamic load in mice during the extended rest period, by in vivo radiotelemetry. Mice had significantly lower systolic (SBP) and diastolic (DBP) blood pressure, concurrent with lower cardiac afterload (mean arterial pressure; MAP) when provided with 4 h of additional rest during the early morning hours (+Rest) (Fig. 2g). Heart rate (HR) was also significantly reduced under the rest model, as compared to controls (Fig. 2h). Our mammalian physiology undergoes profound daily rhythms in blood pressure and heart rate that are important for cardiovascular health^25,26. A short period of additional rest thus reduces hemodynamic stress on the heart, consistent with the notion that our circadian rhythms critically regulate cardiovascular physiology.

Rest induced contractile function and phosphorylation of sarcomeric myofilaments and precision remodeling in a cardiac disease specific manner

The current paradigm of cardiac pathophysiology holds that the cardiac sarcomere is the basic contractile unit of the heart²⁷, and that sarcomeric dysfunction drives changes in cardiac muscle contractility central to impaired cardiac function²⁸. The structure and function of the cardiac sarcomere is regulated by phosphorylation of the myofilament proteins^28,29. In heart failure, altered myofilament phosphorylation is a key driver of contractile dysfunction and disease progression³⁰. As a result, targeting the post-translational modification of cardiac myofilaments has become a new frontier in improving cardiac function in heart failure³¹. Our model may provide a novel and promising non-pharmaceutical approach, but the effects of briefly extending morning rest on contractility parameters of the remodeling heart are unknown.

To test for sarcomeric relevance, TAC hearts were first examined using an actomyosin MgATPase activity assay³². As compared to healthy hearts under normal L:D conditions, the TAC hearts had significantly reduced maximal MgATPase activity (Fig. 3a), and EC₅₀ was similarly decreased (Fig. 3b), suggestive of impaired sarcomere activity at high Ca²⁺ concentrations. These findings coincided with the increased cardiac afterload in the TAC hearts (e.g. MAP) (Fig. 3c). In contrast, with the brief additional period of rest, TAC+Rest hearts had better maximal MgATPase activity (Fig. 3d), normalized EC₅₀ (Fig. 3e), and reduced cardiac afterload (Fig. 3f), SBP, DBP and HR (Extended Data Fig. 2a-b), where values were maintained similar to sham controls. Strikingly, and in accordance with our observations at the sarcomere level, TAC+Rest hearts had significantly higher phosphorylation levels of desmin and troponin T (TnT) (Fig. 3g), providing a biological basis underlying reduced stress on the heart. Collectively, these observations are consistent with the notion that the brief morning period of rest offsets pathological myocardial remodeling by preserving contractile function at the level of the cardiac sarcomere.

We next investigated how rest influences sarcomere function in remodeling myocardium post-MI. As compared to healthy hearts under normal L:D, the MI hearts maintained normal actomyosin MgATPase activity at all levels of calcium (Fig. 3h), however we did note that EC₅₀ was increased (Fig. 3i), suggestive of a change in myofilament calcium sensitivity, and coinciding with decreased cardiac contractility as demonstrated by reduced dP/dt_max and dP/dt_min values (Fig. 3j). In contrast, with the brief additional period of rest, MI+Rest hearts had reduced maximal MgATPase activity (Fig. 3k), with no change in EC₅₀ (Fig. 3l), suggestive of reduced myofilament energy (ATP) consumption, which coincided with improved cardiac contractility as demonstrated by increased dP/dt_max and dP/dt_min (Fig. 3m), and by increased SBP and improved left ventricular functional parameters demonstrated by PV loop hemodynamics (Extended Data 2c-g). Moreover, MI+Rest hearts showed improved intrinsic cardiac contractility independent of hemodynamic preload, as evidenced by greater slope of the end-systolic pressure volume relationship (ESPVR) (Extended Data Fig. 2g). Mechanistically, we observed a significant decrease in the phosphorylation of myosin binding protein C (MyBP-C), TnT, and tropomyosin (Tm) in MI+Rest hearts (Fig. 3n), consistent with the reduced myofilament ATPase activity. Thus, rest helps to preserve cardiac contractile function post-MI, which is important for protecting against progression to heart failure. Importantly these data also reveal that rest benefits the heart in a disease phenotype specific manner, remarkable precision medicine tailored to benefit different cardiac pathologies.

Rest responsive pathways in experimental and human cardiovascular disease

Evidence thus far suggests that rest imposes unique structural and functional benefits on the remodeling heart. To elucidate a genetic basis for rest acting on the heart, we used mRNA arrays to quantify the cardiac transcriptomes of healthy mice maintained under the brief daily extended rest period. Beginning with a background set of 28,137 known protein-coding mouse transcripts, principal components analyses clearly identified two different groups of global gene expression, one from the control hearts and one from the extended rest hearts (Fig. 4a). From this, we defined “rest gene” as any gene in the extended rest group identified as robustly expressed on GeneSpring analyses, with at least a >1.3-fold change versus control hearts. In this context we identified 91 rest genes in the heart (Fig. 4b and Supplementary Table 1). Next, we used the Gene Ontology database as a basis for our pathway network, and found many rest genes encode critical regulators of cardiac growth, renewal and remodeling(Fig. 4c and Extended Data Fig. 3). For example, regulator of calcineurin 1 (Rcan1)³³, natriuretic peptide B (Nppb)³⁴, REL proto-oncogene, NF-κB subunit (Rel)³⁵, transferrin receptor (Tfrc)³⁶, Egl-9 family hypoxia inducible factor 3 (Egln3)³⁷, ankyrin repeat domain 23 (Ankrd23)³⁸, uncoupling protein 3 (Ucp3)³⁹, pyruvate dehydrogenase kinase 4 (Pdk4)⁴⁰, actin alpha 1 (Acta1)⁴¹, and 3-hydroxy-3-methylglutaryl-CoA synthase 2 (Hmgsc2)⁴², all of which play critical roles in the pathophysiology of cardiovascular diseases. These biologically significant rest genes were validated by real-time PCR (Fig. 4d).

To test for human relevance, we turned to microarray datasets of control and failing human hearts (Extended Data Table 3). Strikingly, the rest genes and sarcomere gene products identified in our experimental rest studies are clear biomarker targets in human heart disease (Fig. 4e), supporting the notion that rest can benefit both experimental and clinical cardiovascular disease conditions. Seizing upon the recent observation that many clinical drugs target gene products with circadian rhythmicity⁴³, we also observed that many of our identified rest genes exhibit circadian rhythmicity (Fig. 4f and Extended Data Table 4), and thus can likely be influenced by the molecular clock mechanism consistent with the biological basis of our model system. Finally, to infer whether rest may provide benefits in addition to contemporary drug therapy, we also investigated which of the best-selling and commonly taken heart drugs target rest gene pathways. Notably, 2/3rds of the top prescribed cardiovascular drugs listed by the American Heart Association target rest-responsive gene products pathways (Fig. 4f and Extended Data Table 4), leading us to speculate that drug efficacy can be improved upon in conjunction with an additional brief period of daily rest.

The data presented here are consistent with the general hypothesis that rest plays a key role in cardiac remodeling and improves outcomes. Given the limitations of current preclinical models to study rest, we developed a novel murine model that allows us to recapitulate the clinical phenotypes of human heart diseases and study the physiologic and molecular benefits of rest on cardiac repair. We postulate that briefly extending daily rest, by using light to co-opt the circadian biology of rodents, plays a critical role in triggering the pro-cardiac responses. Certainly, the importance of circadian rhythms for cardiovascular health has been demonstrated in experimental^20,44,45 and clinical studies^46,47. However, while studies examining the effects of circadian rhythm disruption^16,19 or disturbed sleep^48,49 on cardiovascular healing provide some insights into exacerbating pathophysiology, they do not help explain how to benefit healing, nor provide feasible strategies for patients with cardiovascular disease. Using multiple approaches in preclinical models of heart disease and human gene data from patients with cardiovascular disease, we uncovered evidence implicating rest on benefiting cardiac structure and function, reducing hemodynamic stress, preserving contractile function at the level of the cardiac sarcomere, that rest acts in a precision therapy manner such that it is disease-phenotype specific, and we identified rest genes that have daily rhythms and underlie human heart disease and are common targets of drug therapies (Fig. 4g). Indeed, our findings implicate rest as a master mediator of pathways critical in the pathophysiology of cardiovascular disease.

Strategies to add a brief daily period of rest can be applied alongside and to elevate contemporary therapies for heart disease. Our observations are certainly not conclusive for human patients, but they have enormous implications for benefitting treatment of cardiovascular disease, a leading cause of death worldwide. We hope that our preclinical study will stimulate the initiation of an entirely new field – the nature of rest – along with clinical trials reappraising the value of rest as an important long-term lifestyle approach leading to longer and healthier lives.

Using a remarkably simple strategy, we developed a novel evidence-based murine model to study the benefits of promoting brief daily rest as cardiovascular disease therapy, and especially during the critical early period of cardiovascular pathogenesis and cardiac repair, and which can have applications to healing from any clinical disease.

Acknowledgements

This work was supported by grants from the Canadian Institutes of Health Research (CIHR) to T.A.M. C.J.R. is supported by a CIHR PhD award. T.A.M. is a career investigator of the Heart and Stroke Foundation of Canada, and the Distinguished Chair of Molecular Cardiovascular Research at the University of Guelph.

Author contributions

C.J.R. and T.A.M. conceptualized the study and designed the experiments. C.J.R., F.J.A., T.N.K, W.G.P., and T.A.M. performed experiments, analyzed and/or interpreted the experimental results. C.J.R. and T.A.M. prepared the figures and drafted the manuscript. All authors have read and given permission to the paper.

Competing interests

The authors declare no competing interests.

Additional information

Supplementary Information is available for this paper.

Correspondence and requests for materials should be addressed to Dr. Tami A. Martino.

1 Roth, G. A. et al. Global Burden of Cardiovascular Diseases and Risk Factors, 1990-2019: Update From the GBD 2019 Study. J Am Coll Cardiol 76, 2982-3021, doi:10.1016/j.jacc.2020.11.010 (2020).

2 Babcock, R. H. Rest in the treatment of diseases of the heart. Read at the Meeting of the Tri-State Medical Society at Jacksonville Ill. JAMA XXIII, 739-741, doi:10.1001/jama.1894.02421250001001 (1894).

3 Martino, T. A. & Sole, M. J. Molecular time: an often overlooked dimension to cardiovascular disease. Circ Res 105, 1047-1061, doi:10.1161/CIRCRESAHA.109.206201 (2009).

4 Martino, T. A. & Young, M. E. Influence of the cardiomyocyte circadian clock on cardiac physiology and pathophysiology. J Biol Rhythms 30, 183-205, doi:10.1177/0748730415575246 (2015).

5 Allen, C., Glasziou, P. & Del Mar, C. Bed rest: a potentially harmful treatment needing more careful evaluation. Lancet 354, 1229-1233, doi:10.1016/s0140-6736(98)10063-6 (1999).

6 Ayas, N. T. et al. A prospective study of sleep duration and coronary heart disease in women. Arch Intern Med 163, 205-209 (2003).

7 Alibhai, F. J., Tsimakouridze, E. V., Reitz, C. J., Pyle, W. G. & Martino, T. A. Consequences of Circadian and Sleep Disturbances for the Cardiovascular System. Can J Cardiol, doi:10.1016/j.cjca.2015.01.015 (2015).

8 Eckle, T. Editorial: Health Impact and Management of a Disrupted Circadian Rhythm and Sleep in Critical Illnesses. Curr Pharm Des 21, 3428-3430, doi:10.2174/1381612821999150709123504 (2015).

9 Daghlas, I. et al. Sleep Duration and Myocardial Infarction. J Am Coll Cardiol 74, 1304-1314, doi:10.1016/j.jacc.2019.07.022 (2019).

10 Wong, P. M., Hasler, B. P., Kamarck, T. W., Muldoon, M. F. & Manuck, S. B. Social Jetlag, Chronotype, and Cardiometabolic Risk. J Clin Endocrinol Metab 100, 4612-4620, doi:10.1210/jc.2015-2923 (2015).

11 Knutsson, A., Akerstedt, T., Jonsson, B. G. & Orth-Gomer, K. Increased risk of ischaemic heart disease in shift workers. Lancet 2, 89-92 (1986).

12 Reitz, C. J. & Martino, T. A. Disruption of Circadian Rhythms and Sleep on Critical Illness and the Impact on Cardiovascular Events. Curr Pharm Des 21, 3505-3511, doi:10.2174/1381612821666150706105926 (2015).

13 Rana, S., Prabhu, S. D. & Young, M. E. Chronobiological Influence Over Cardiovascular Function: The Good, the Bad, and the Ugly. Circ Res 126, 258-279, doi:10.1161/CIRCRESAHA.119.313349 (2020).

14 Thosar, S. S., Butler, M. P. & Shea, S. A. Role of the circadian system in cardiovascular disease. J Clin Invest 128, 2157-2167, doi:10.1172/JCI80590 (2018).

15 Provencio, I. & Foster, R. G. Circadian rhythms in mice can be regulated by photoreceptors with cone-like characteristics. Brain Res 694, 183-190 (1995).

16 Martino, T. A. et al. Disturbed diurnal rhythm alters gene expression and exacerbates cardiovascular disease with rescue by resynchronization. Hypertension 49, 1104-1113, doi:10.1161/HYPERTENSIONAHA.106.083568 (2007).

17 Martino, T. A. et al. The primary benefits of angiotensin-converting enzyme inhibition on cardiac remodeling occur during sleep time in murine pressure overload hypertrophy. J Am Coll Cardiol 57, 2020-2028, doi:10.1016/j.jacc.2010.11.022 (2011).

18 Tsimakouridze, E. V. et al. Chronomics of pressure overload-induced cardiac hypertrophy in mice reveals altered day/night gene expression and biomarkers of heart disease. Chronobiol Int 29, 810-821, doi:10.3109/07420528.2012.691145 (2012).

19 Alibhai, F. J. et al. Short-term disruption of diurnal rhythms after murine myocardial infarction adversely affects long-term myocardial structure and function. Circ Res 114, 1713-1722, doi:10.1161/CIRCRESAHA.114.302995 (2014).

20 Bennardo, M. et al. Day-night dependence of gene expression and inflammatory responses in the remodeling murine heart post-myocardial infarction. Am J Physiol Regul Integr Comp Physiol 311, R1243-R1254, doi:10.1152/ajpregu.00200.2016 (2016).

21 Reitz, C. J. et al. SR9009 administered for one day after myocardial ischemia-reperfusion prevents heart failure in mice by targeting the cardiac inflammasome. Commun Biol 2, 353, doi:10.1038/s42003-019-0595-z (2019).

22 Blume, C., Garbazza, C. & Spitschan, M. Effects of light on human circadian rhythms, sleep and mood. Somnologie (Berl) 23, 147-156, doi:10.1007/s11818-019-00215-x (2019).

23 Berson, D. M., Dunn, F. A. & Takao, M. Phototransduction by retinal ganglion cells that set the circadian clock. Science 295, 1070-1073, doi:10.1126/science.1067262 (2002).

24 Takahashi, J. S., DeCoursey, P. J., Bauman, L. & Menaker, M. Spectral sensitivity of a novel photoreceptive system mediating entrainment of mammalian circadian rhythms. Nature 308, 186-188, doi:10.1038/308186a0 (1984).

25 Clarke, J. M., Hamer, J., Shelton, J. R., Taylor, S. & Venning, G. R. The rhythm of the normal human heart. Lancet 1, 508-512 (1976).

26 Millar-Craig, M. W., Bishop, C. N. & Raftery, E. B. Circadian variation of blood-pressure. Lancet 1, 795-797 (1978).

27 Martin, T. G. & Kirk, J. A. Under construction: The dynamic assembly, maintenance, and degradation of the cardiac sarcomere. J Mol Cell Cardiol 148, 89-102, doi:10.1016/j.yjmcc.2020.08.018 (2020).

28 Hamdani, N. et al. Sarcomeric dysfunction in heart failure. Cardiovasc Res 77, 649-658, doi:10.1093/cvr/cvm079 (2008).

29 Lorenzen-Schmidt, I., Clarke, S. B. & Pyle, W. G. The neglected messengers: Control of cardiac myofilaments by protein phosphatases. J Mol Cell Cardiol 101, 81-89, doi:10.1016/j.yjmcc.2016.10.002 (2016).

30 Belin, R. J. et al. Augmented protein kinase C-alpha-induced myofilament protein phosphorylation contributes to myofilament dysfunction in experimental congestive heart failure. Circ Res 101, 195-204, doi:10.1161/CIRCRESAHA.107.148288 (2007).

31 Hwang, P. M. & Sykes, B. D. Targeting the sarcomere to correct muscle function. Nat Rev Drug Discov 14, 313-328, doi:10.1038/nrd4554 (2015).

32 Podobed, P. et al. The day/night proteome in the murine heart. Am J Physiol Regul Integr Comp Physiol 307, R121-137, doi:10.1152/ajpregu.00011.2014 (2014).

33 Sachan, N. et al. Sustained hemodynamic stress disrupts normal circadian rhythms in calcineurin-dependent signaling and protein phosphorylation in the heart. Circ Res 108, 437-445, doi:10.1161/CIRCRESAHA.110.235309 (2011).

34 Goetze, J. P. et al. Cardiac natriuretic peptides. Nat Rev Cardiol 17, 698-717, doi:10.1038/s41569-020-0381-0 (2020).

35 Gaspar-Pereira, S. et al. The NF-kappaB subunit c-Rel stimulates cardiac hypertrophy and fibrosis. Am J Pathol 180, 929-939, doi:10.1016/j.ajpath.2011.11.007 (2012).

36 Xu, W. et al. Lethal Cardiomyopathy in Mice Lacking Transferrin Receptor in the Heart. Cell Rep 13, 533-545, doi:10.1016/j.celrep.2015.09.023 (2015).

37 Xie, L. et al. Depletion of PHD3 protects heart from ischemia/reperfusion injury by inhibiting cardiomyocyte apoptosis. J Mol Cell Cardiol 80, 156-165, doi:10.1016/j.yjmcc.2015.01.007 (2015).

38 Buyandelger, B. et al. Genetics of mechanosensation in the heart. J Cardiovasc Transl Res 4, 238-244, doi:10.1007/s12265-011-9262-6 (2011).

39 Laskowski, K. R. & Russell, R. R., 3rd. Uncoupling proteins in heart failure. Curr Heart Fail Rep 5, 75-79, doi:10.1007/s11897-008-0013-1 (2008).

40 Cardoso, A. C. et al. Mitochondrial Substrate Utilization Regulates Cardiomyocyte Cell Cycle Progression. Nat Metab 2, 167-178 (2020).

41 Lim, D. S., Roberts, R. & Marian, A. J. Expression profiling of cardiac genes in human hypertrophic cardiomyopathy: insight into the pathogenesis of phenotypes. J Am Coll Cardiol 38, 1175-1180, doi:10.1016/s0735-1097(01)01509-1 (2001).

42 Shukla, S. K. et al. HMGCS2 is a key ketogenic enzyme potentially involved in type 1 diabetes with high cardiovascular risk. Sci Rep 7, 4590, doi:10.1038/s41598-017-04469-z (2017).

43 Zhang, R., Lahens, N. F., Ballance, H. I., Hughes, M. E. & Hogenesch, J. B. A circadian gene expression atlas in mammals: implications for biology and medicine. Proc Natl Acad Sci U S A 111, 16219-16224, doi:10.1073/pnas.1408886111 (2014).

44 Young, M. E., Razeghi, P., Cedars, A. M., Guthrie, P. H. & Taegtmeyer, H. Intrinsic Diurnal Variations in Cardiac Metabolism and Contractile Function. Circulation Research 89, 1199-1208, doi:10.1161/hh2401.100741 (2001).

45 Martino, T. A. et al. Circadian rhythm disorganization produces profound cardiovascular and renal disease in hamsters. Am J Physiol Regul Integr Comp Physiol 294, R1675-1683, doi:10.1152/ajpregu.00829.2007 (2008).

46 Muller, J. E., Tofler, G. H. & Stone, P. H. Circadian variation and triggers of onset of acute cardiovascular disease. Circulation 79, 733-743, doi:10.1161/01.cir.79.4.733 (1989).

47 Scheer, F. A. et al. Impact of the human circadian system, exercise, and their interaction on cardiovascular function. Proc Natl Acad Sci U S A 107, 20541-20546, doi:10.1073/pnas.1006749107 (2010).

48 Krittanawong, C. et al. Association between short and long sleep durations and cardiovascular outcomes: a systematic review and meta-analysis. Eur Heart J Acute Cardiovasc Care, 2048872617741733, doi:10.1177/2048872617741733 (2017).

49 Javaheri, S. et al. Sleep apnea in 81 ambulatory male patients with stable heart failure. Types and their prevalences, consequences, and presentations. Circulation 97, 2154-2159, doi:10.1161/01.cir.97.21.2154 (1998).

Experimental animals

All studies were carried out in accordance with the guidelines of the Canadian Council on Animal Care and were reviewed and approved by the University of Guelph Institutional Animal Care and Use Committee. All animals were housed at the University of Guelph Central Animal Facilities. Standard rodent chow and water were provided ad libitum. Rest and activity were recorded from 8-week-old male C57BL/6N mice (Charles River Laboratories), using individual cages equipped with running wheels (Colbourn Instruments), as described^21,50, and data were collected and analyzed using ClockLab Software (Actimetrics). Rest was measured as hours per day with < 100 counts of activity. Animals were placed on either i) a “control” normal light (L) dark (D) cycle (LD 12:12), or ii) an extended light cycle to induce rest using white light (LD 16:8), or iii) an extended period of light under red light (>620 nm wavelength; LR 12:12) or iv) “extended rest” induced by blue light (420-520 nm wavelength, LBD 12:4:8, rest model) targeting the circadian system to manipulate rest and activity. Light wavelengths were filtered using blue Roscolux 74 or red Roscolux 27 (Rosco Laboratories) over white fluorescent lights (Octron T8; Sylvania). Cardiac hypertrophy was surgically induced by transverse aortic constriction (TAC) as previously described^16-18,50. Myocardial infarction was surgically induced by left anterior descending coronary artery ligation as described^19,51. All surgeries were performed between zeitgeber time (ZT) 01 and ZT04 to avoid confounding circadian effects, and used the same methods for anesthesia, intubation, and analgesia as previously described, and mice were given a subcutaneous injection of buprenorphine (0.1 mg/kg) for post-operative analgesia upon awakening, and at 8 hours and 24 hours post-operatively. Following recovery, starting on the first night post-surgery, mice were housed under control or extended light regimens for up to 8 weeks.

Echocardiography

Cardiac structure and function were assessed at baseline, 1- and 4-weeks post-TAC, or at baseline, 1-, 4-, and 8-weeks post-MI using a GE Vivid e90 ultrasound machine (GE Medical Systems) with an L8-18i-D 15 MHz linear array transducer under light anesthesia (1.0% isoflurane). Images were analyzed on an offline system using EchoPAC (GE Medical Systems). Measurements were taken at the mid-papillary level and used to determine left ventricular internal dimension at diastole (LVIDd), left ventricular internal dimension at systole (LVIDs), % ejection fraction (% EF), % fractional shortening (% FS), interventricular septal wall thickness at diastole (IVSd), left ventricular posterior wall thickness at diastole (LVPWd), and heart rate (HR). For the TAC studies, a total of 44 mice were used (n = 11 mice/group). For the MI studies, 20 mice were used (n = 10 mice/group). At least 5 images per animal were used for analysis, and means are presented.

In vivo pressure-volume hemodynamics

At 8 weeks post-MI, mice were anesthetized with 4% isoflurane, intubated, and ventilated. A 1.2Fr pressure-volume catheter (Transonic) was inserted via the right carotid artery and advanced into the ascending aorta for blood pressure measurements. The catheter was then advanced into the LV. Real time physiologic LV and aortic pressure measurements were recorded on an ADInstrument PowerLab, including left ventricular end systolic pressure (LVESP), diastolic pressure (LVEDP), systolic volume (LVESV), diastolic volume (LVEDV), stroke volume (SV), cardiac output (CO), maximum and minimum first derivatives of LV pressure (dP/dt_max; dP/dt_min), and systolic/diastolic blood pressures (SBP/DBP). Mean arterial blood pressure (MAP) was calculated as DBP + (SBP-DBP)/3. After PV measurements were obtained, the inferior vena cava was briefly occluded to block venous return to determine the end-systolic PV relationship⁵². Continuously recorded pressures were analyzed with Lab Chart 7 (Colorado Creeks, USA). A total of 18 mice were used (n = 9 mice/group), with data reported as mean ± s.e.m.

In vivo radiotelemetry

Diurnal cardiovascular hemodynamics was assessed using PA-C10 murine telemetry probes (Data Sciences International) to collect continuous blood pressure and heart rate data from conscious, freely moving mice, as previously described^17,50. Animals were anesthetized with 4% isoflurane, intubated, ventilated (model 687; Harvard Apparatus), and maintained at 2.5% isoflurane throughout the procedure. The right carotid artery was isolated and the telemeter catheter was implanted to the level of the aortic arch via the carotid artery. The telemeter transmitter unit was implanted in a subcutaneous skin pouch and the neck incision was closed using silk 6-0 suture (Covidien). Mice were administered buprenorphine (0.1 mg per kg) analgesia upon awakening and at 8 hours and 24 hours postoperatively. Recordings were initiated at 1 week following telemeter implantation and measurements were collected over three continuous 24-hour cycles for each light condition. Following baseline telemetry recordings, mice were subjected to transverse aortic constriction (TAC) surgery. At 4 weeks post-TAC, measurements were collected over three additional days under each light cycle. Systolic (SBP) and diastolic (DBP) blood pressure, mean arterial pressure (MAP), and heart rate (HR) were analysed using the Data Quest IV system (Data Sciences International). Measurements were taken every 5 min for 30 seconds and averaged into 1-hour bins according to ZT time. A total of 4 mice were used, enabling a paired analysis of the same mice before and after all experimental interventions, with data reported as mean ± s.e.m.

Histology

At 8 weeks post-MI, mice were euthanized following hemodynamic assessments with isoflurane and cervical dislocation. Body weight (BW), heart weight (HW) and tibia length (TL) were measured for each animal. Hearts were removed, perfused with 1 M KCl, fixed in 10% neutral buffered formalin for 48 h, and paraffin embedded. Hearts were then sectioned at 5 µm thickness, from apex to base, collecting 10 sections every 300 µm. Sections were stained with Masson’s trichrome, mounted using Cytoseal 60 mounting media (Thermo Scientific) and visualized with a Nikon E600 microscope using Q-Capture software (QImaging; Surrey, BC) and quantified using Image J 1.46 (NIH). Infarct thickness was determined from a minimum of 5 measurements/section over equidistant points along the infarct region. LV diameter was determined from sections collected at mid-papillary level. Relative infarct size was determined by dividing the sum of the endocardial and epicardial circumference occupied by the infarct by the sum of the total LV epicardial and endocardial circumferences. A total of 10 mice were used (n = 5 mice/group), with data presented as mean ± s.e.m.

Myofilament isolation, actomyosin MgATPase assay, and protein phosphorylation

At 4 weeks post-surgery. TAC, MI and sham animals were euthanized by isoflurane and cervical dislocation at ZT15. Hearts were collected, snap frozen in liquid nitrogen, and stored at -80°C until use. Cardiac myofilaments were isolated by differential centrifugation using the protocol described by Podobed et al.³². Actomyosin MgATPase activity in isolated cardiac myofilaments was determined using a modified Carter assay, as described previously^19,32. Isolated myofilament proteins were separated using 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and protein phosphorylation levels were quantified using the PRO-Q Diamond phosphoprotein gel stain (Invitrogen), following the protocol of Podobed et al.³². Gels were then stained with Coomassie to determine total protein. Gel imaging was performed on a Bio-Rad ChemiDoc MP Imaging System (Bio-Rad) and analysed using ImageJ (NIH) with protein phosphorylation normalized to total protein. Samples were run, stained, and imaged at the same time on separate gels, and normalized to actin.

RNA isolation, microarray, and bioinformatics analyses

After 4 weeks under either the rest model or control conditions, healthy mice were euthanized by isoflurane and cervical dislocation at ZT07. Hearts were collected and snap frozen in liquid nitrogen and stored at -80°C until use. Total RNA from murine heart tissue was isolated using the miRNeasy Mini Kit (Qiagen), as previously described⁵⁰. RNA quantity and quality were assessed by Nanodrop (260/280 ≥ 2; Thermo Scientific) and RNA ScreenTape (RIN ≥ 7; Agilent). Whole genome microarray analyses were performed using the Affymetrix GeneChip Mouse Gene 2.0 ST array, which interrogates 35,240 RefSeq coding and non-coding transcripts (GEO Accession: GSE115567). Gene expression analyses were performed on 6 individual mouse heart samples. Bioinformatics analyses were performed using GeneSpring GX v14.9 (Agilent Technologies). Raw .cel files were loaded into a project file with exon analysis and Affymetrix exon expression experiment settings and a biological significance workflow analysis. The most recent mouse gene 2.0 ST array annotation technology (MoGene-2_0-st_na36_mm10_2016-07-06) was used to perform all analyses. Raw fluorescence data were normalized across all chips using the exon robust multiarray summarization algorithm. Experiment parameters for sample groups and replicate structure were defined, and launched as a group-level interpretation. Quality control across all samples was assessed by log2(normalized signal values) expression of 8 control hybridization probes across all chips, and group level clustering was analyzed by principal components analysis. The probeset filter parameter was defined to include all 34,351 probeset entities, then filtered by expression using a lower cut-off of 60 raw fluorescence units. Differentially expressed genes were determined by fold change analysis of all entities with ≥ 1.3-fold change in expression between rest vs. control hearts (Supplementary Table 1). Hierarchical cluster analysis of this gene cassette generated heat maps of entity expression relative to control hearts. Gene Ontology (GO) analysis was performed on differentially expressed gene lists using the Database for Annotation, Visualization, and Integrated Discovery (DAVID) Functional Annotation Tool (DAVID Bioinformatics 6.8, NIAID/NIH)⁵³. Circos plots were generated using Circos v.0.69-9⁵⁴.

Quantitative real time polymerase chain reaction (qRT-PCR)

Analysis of mRNA expression by qRT-PCR was performed on a ViiA7 real time PCR system (Applied Biosystems) using the Power SYBR Green RNA-to-Ct one step kit (Life Technologies) under the following protocol: reverse transcription at 48°C for 30 min and 95°C for 10 min for 1 cycle, followed by amplification at 95°C for 15 sec and 60°C for 1 min for 40 cycles, followed by hold at room temperature. The following RT-PCR primer sequences were used, including forward and reverse sequences for each gene, respectively:

Rcan1 exon 4 isoform mouse CCCGTGAAAAAGCAGAATGC, TCCTTGTCATATGTTCTGAAGAGGG; Nppb mouse GCGAGACAAGGGAGAACAC, GCGGTGACAGATAAAGGAAAAG; Rel mouse CAGAGTGACTTCAAGGGAAC, GTTAGGCACCGAGTCTTTAG; Tfrc mouse CACTCGCCCAAGTTATATCC, GCACGGTGATACTCATACTG; Egln3 mouse CCCGAACTCTGTACGAAAC, CTGCTTGTGGGATTCTAGC; Ankrd23 mouse TCCAGGGCATGAGAGAAG, GGCTGCTACTGGTAGAAATG; Ucp3 mouse CCCAACATCACAAGAAATGCC, ACAGAAGCCAGCTCCAAAG; Pdk4 mouse CGCCAGAATTAAACCTCACAC, TTCTTGATGCTCGACCGTG; Acta1 mouse AGACCTTCAACGTGCCTG, CGTCCCCAGAATCCAACAC; Hmgcs2 mouse CACCTGCTACTAACCTTG, CAAGAGGACACTTTCAGG; histone mouse GCAAGAGTGCGCCCTCTACTG, GGCCTCACTTGCCTCCTGCAA. Relative gene expression was normalized to histone using the delta delta CT method, as described previously^19,20.

Human myocardial gene expression microarray analyses

Human myocardial gene expression data were obtained using publicly available datasets from the Gene Expression Omnibus (GEO) database⁵⁵. Raw .cel microarray files were downloaded from 6 independent datasets examining myocardial gene expression from LV biopsies from a total of 140 patients. Datasets included patients with aortic stenosis (AS)⁵⁶, dilated cardiomyopathy (DCM)^57-59, ischemic cardiomyopathy (ICM)^58-60, and non-failing controls (GEO datasets: GSE1145 (AS), GSE10161 (AS), GSE3585 (DCM), GSE42955 (DCM, ICM), GSE79962 (DCM, ICM), GSE16499 (ICM); see Extended Data Table 3). Raw microarray files were analysed from each dataset, using GeneSpring GX v14.9 (Agilent Technologies Inc.), as described above. All probeset entity lists were then interrogated for rest-responsive genes identified from our murine studies, and analysed as fold change in expression from non-failing control hearts. See Extended Data Table 3 for n-values and microarray technologies for each dataset.

Cardiac medications targeting rest pathways

A list of the top 66 commonly prescribed cardiovascular medications was obtained from the American Heart Association (AHA) website⁶¹. All molecular drug targets were determined using the DrugBank database⁶². Lists were then curated for target genes with known rhythmic transcripts (JTK P-value < 0.05) based on analyses from mouse heart tissue using the CircaDB database⁶³ and for rest-responsive genes identified from our rest model microarray analyses in the murine heart.

Statistical analyses

Values are presented as mean ± s.e.m. Statistical comparisons were made by paired or unpaired Student’s t-test, as applicable. All analyses were performed using GraphPad Prism 8 (GraphPad Software) or Excel (Microsoft). A P-value ≤ 0.05 was considered statistically significant. All endpoints, n-values, and statistics are provided in detail in the Figure legends and in the Extended Data.

Data availability

The authors declare that all supporting data are available with the article, extended data, supplementary files, or from the corresponding author upon reasonable request. Microarray data were deposited to the GEO database, accession #GSE115567.

Publicly available microarray datasets were downloaded and analyzed from the GEO database, as described in the methods and outlined in Extended Data Table 3.

Methods References

32 Podobed, P. et al. The day/night proteome in the murine heart. Am J Physiol Regul Integr Comp Physiol 307, R121-137, doi:10.1152/ajpregu.00011.2014 (2014).

50 Alibhai, F. J. et al. Disrupting the key circadian regulator CLOCK leads to age-dependent cardiovascular disease. J Mol Cell Cardiol 105, 24-37, doi:10.1016/j.yjmcc.2017.01.008 (2017).

51 Mistry, P. et al. Circadian influence on the microbiome improves heart failure outcomes. J Mol Cell Cardiol 149, 54-72, doi:10.1016/j.yjmcc.2020.09.006 (2020).

52 Wang, W. et al. Loss of Apelin exacerbates myocardial infarction adverse remodeling and ischemia-reperfusion injury: therapeutic potential of synthetic Apelin analogues. Journal of the American Heart Association 2, e000249, doi:10.1161/JAHA.113.000249 (2013).

53 Huang da, W., Sherman, B. T. & Lempicki, R. A. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat Protoc 4, 44-57, doi:10.1038/nprot.2008.211 (2009).

54 Krzywinski, M. et al. Circos: an information aesthetic for comparative genomics. Genome Res 19, 1639-1645, doi:10.1101/gr.092759.109 (2009).

55 Edgar, R., Domrachev, M. & Lash, A. E. Gene Expression Omnibus: NCBI gene expression and hybridization array data repository. Nucleic Acids Res 30, 207-210, doi:10.1093/nar/30.1.207 (2002).

56 Petretto, E. et al. Integrated genomic approaches implicate osteoglycin (Ogn) in the regulation of left ventricular mass. Nat Genet 40, 546-552, doi:10.1038/ng.134 (2008).

57 Barth, A. S. et al. Identification of a common gene expression signature in dilated cardiomyopathy across independent microarray studies. J Am Coll Cardiol 48, 1610-1617, doi:10.1016/j.jacc.2006.07.026 (2006).

58 Molina-Navarro, M. M. et al. Differential gene expression of cardiac ion channels in human dilated cardiomyopathy. PLoS One 8, e79792, doi:10.1371/journal.pone.0079792 (2013).

59 Matkovich, S. J. et al. Widespread Down-Regulation of Cardiac Mitochondrial and Sarcomeric Genes in Patients With Sepsis. Crit Care Med 45, 407-414, doi:10.1097/CCM.0000000000002207 (2017).

60 Kong, S. W. et al. Heart failure-associated changes in RNA splicing of sarcomere genes. Circ Cardiovasc Genet 3, 138-146, doi:10.1161/CIRCGENETICS.109.904698 (2010).

61 AHA. American Heart Association. Cardiac Medications. 2019. Available at: https://www.heart.org/en/health-topics/heart-attack/treatment-of-a-heart-attack/cardiac-medications. Accessed August 20, 2019. (2019).

62 Wishart, D. S. et al. DrugBank 5.0: a major update to the DrugBank database for 2018. Nucleic Acids Res 46, D1074-D1082, doi:10.1093/nar/gkx1037 (2018).

63 Pizarro, A., Hayer, K., Lahens, N. F. & Hogenesch, J. B. CircaDB: a database of mammalian circadian gene expression profiles. Nucleic Acids Res 41, D1009-1013, doi:10.1093/nar/gks1161 (2013).

There is NO Competing Interest.

Reitzetal.RestandtheHeartSupplementaryInformationMar16.docx
Supplementary Information
ReitzetalExtendedDataFig1.pdf
Extended Data Fig. 1 Long-wavelength light shows no effect on diurnal activity rhythms in mice. (a) Running wheel actigraphy (left) and periodogram quantification (right) of 24 h locomotor activity under a normal LD 12:12 cycle, and (b) similar activity profiles under 12 h light: 12 h red light (>620 nm) (LR). n=5 mice/group. Data are represented as mean ± s.e.m.
ReitzetalExtendedDataFigure2.pdf
Extended Data Fig. 2 Rest alters cardiovascular hemodynamics to benefit cardiac contractility in a disease phenotype-specific manner. (a) A short period of extended rest lowers cardiac afterload, as evidenced by diurnal systolic (SBP) and diastolic (DBP) blood pressure and quantification of MAP and (b) lowers cardiac workload, shown by reduced heart rate (HR) during rest, in TAC+Rest hearts vs. TAC controls, at 4 weeks post-surgery. n=4 mice/group, *P<0.005 TAC vs. TAC+Rest, paired Student’s t-test. (c) MI lowers SBP as compared to sham mice, and (d) this is restored in mice maintained under the rest model up to 8 weeks post-MI. (e) MI+Rest hearts show better pressure-volume hemodynamic profiles in vivo, including (f) greater left ventricular end systolic pressures (LVESP), and (g) this is independent of preload, as evidenced by greater slope of the end-systolic pressure volume relationship. n=9 mice/group. *P<0.05 MI vs. MI+Rest, by unpaired Student’s t-test. Data are represented as mean ± s.e.m.
ReitzetalExtendedDataFigure3.pdf
Extended Data Fig. 3 Rest alters cardiac gene biomarkers underlying cardiac growth, renewal, and remodeling. (a) Gene ontology (GO) cellular compartment and biological process correlations, illustrates genes up-regulated (blue) or down-regulated (yellow) in the heart with rest. Circos plot visualizes key biological processes regulated by rest that are involved in cardiac growth, repair, and remodeling and links to the subcellular compartments where these pathways are localized. ECM = extracellular matrix. n=3 hearts/group for microarray transcriptomics and bioinformatics analyses.
ReitzetalExtendedDataTable1.pdf
Extended Data Table 1 Rest limits adverse cardiac remodeling in pressure overload-induced cardiac hypertrophy in mice LVIDd, left ventricle internal dimensions at diastole; LVIDs, LV internal dimensions at systole; % EF, % ejection fraction; % FS, % fractional shortening; HR, heart rate; IVSd, interventricular septal wall thickness at diastole; LVPWd, left ventricular posterior wall thickness at diastole; HW, heart weight; HW:BW, HW:body weight ratio; HW:TL, HW:tibia length ratio. *P<0.05, **P<0.001 TAC control vs. TAC+Rest, by unpaired Student’s t-test. n=11 mice/group for echocardiography, n=15 mice/group for morphometry. Data are mean ± s.e.m.
ReitzetalExtendedDataTable2.pdf
Extended Data Table 2 Rest benefits cardiac structure and function post-myocardial infarction in mice LVIDd, left ventricle internal dimensions at diastole; LVIDs, LV internal dimensions at systole; % EF, % ejection fraction; % FS, % fractional shortening; HR, heart rate; SBP, systolic blood pressure; DBP, diastolic blood pressure; MAP, mean arterial pressure; LVESP, left ventricular end systolic pressure; LVEDP, left ventricular end diastolic pressure; LVESV, left ventricular end systolic volume; LVEDV, left ventricular end diastolic volume; SV, stroke volume; CO, cardiac output; dP/dtmax and dP/dtmin, maximum and minimum first derivative of LV pressure; ESPVR, end systolic pressure-volume relationship; HW, heart weight; HW:BW, HW:body weight ratio; HW:TL, HW:tibia length ratio. *P<0.05, **P<0.001 MI control vs. MI+Rest, by unpaired Student’s t-test. n=10 mice/group for echocardiography, n=9 mice/group for hemodynamics and morphometry. Data are mean ± s.e.m.
ReitzetalExtendedDataTable3.pdf
Extended Data Table 3 GEO datasets of human myocardial tissue gene expression
ReitzetalExtendedDataTable4.pdf
Extended Data Table 4 Commonly prescribed cardiac medications listed by the American Heart Association target rhythmic and rest-responsive genes in the heart

Download PDF

Journal Publication

published 21 Nov, 2022

Read the published version in JCI Insight →

Version 1

posted

You are reading this latest preprint version

Rest Profoundly Protects Against Cardiac Remodeling and Benefits Repair

Status:

Journal Publication

Version 1

Abstract

Figures

Main

Discussion

Declarations

References

Methods

Additional Declarations

Supplementary Files

Status:

Journal Publication

Version 1