iPSCs Culture
iPSCs (kindly provided by Guangzhou Stem cell and Regenerative Laboratory, China) were cultured in Essential 8 (E8) medium (Stem cell, Vancouver, Canada) in 6-well plates with pre-coated Matrigel (Corning, New York, USA). For passaging, the cells were gently washed with phosphate buffer saline (PBS) (Thermo Fisher Scientific, Waltham, MA, USA), incubated with cell dissociation solution (PBS containing 1.8 g/l NaCl and 0.5 mM Ethylene Diamine Tetraacrtic Acid (Solarbio, Beijing, China), followed by pipetting with appropriate amount of E8 medium. Y-27632 (10 μM, Stem cell, Canada) was added in the culture medium after each splitting.
Construction of lentiviral plasmid and package
The FTH1 fragment was synthesized according to the Genebank sequence NM_012848 (by GENEWIZ Biotechnology company, China) and cloned into the T vector. FTH1 was further amplified to have a fragment with blunt ends by using the primers as follows: 5’-3’: CGGTGAATTCCTCGAGACTAGTTCTAGAGCCACCATGACCACCGCGTCT; 3’-5’: CTCCTCGCCCTTGCTCACCATGATACCGGTAGGGCCGGGATTCTCCTCCA. The fragment was cloned into the plasmid pLVX -EGFP (MiaoLing Plasmid, Wuhan, China) by seamless cloning to construct the plasmid pLVX-FTH1-T2A-EGFP. iRFP was amplified by PCR from the plasmid TET-O-FUW-T2A-iRFP (a kind gift from Prof. Zhang) by using the primers: 5’-3’: CCTGGGACACGGTGATGAGAGCGGATCCGAGGGCAGAGGAAGTCTTCT; 3’-5’: TGTTAGAAGACTTCCTCTGCCCTCAGCGCTCTCTTCCATCACGC. The iRFP fragment was cloned into the plasmid pLVX-FTH1-T2A-EGFP by seamless cloning method to get a final construct pLVX-FTH1-iRFP-EGFP.
We used four-plasmids packaging system to package lentivirus. The 293T packing cell line (Cell Bank, Chinese Academy of Sciences) were maintained in the Dulbecco’s Modified Eagle medium (DMEM) (Thermo Fisher Scientific, USA) with 10% (v/v) Fetal Bovine Serum (FBS) (Thermo Fisher Scientific, USA). When the cell density reached 80%, the pLVX-FTH1-iRFP-EGFP and the mixed package plasmids were co-transfected the cells by using Lipofectamine 2000 (Thermo Fisher Scientific, USA). The medium containing virus was collected 48h after transfection, followed by centrifugation at 1000 g for 10 min at 4 oC. The supernatant was collected, and concentrated by using Lenti-x concentration kit (TaKaRa, Japan). The pellets were re-suspended with appropriate amount of PBS (1/10-1/100 of the original volume) and stored at -80oC for further experiment.
Infection of iPSCs with lentivirus
The lentivirus FTH1-iRFP-EGFP (Vfre) was added at a dose of Multiplicity of Infection (MOI) value 2 to 5 together with 2.5 mg/l Polybrene to the iPSC culture for 12 h. Later, the medium containing virus was removed and fresh E8 medium was added as usual. Vfre-infected iPSCs were harvested 48h after the infection for the subsequent experiments.
Western blot (WB)
The sampling of untreated iPSCs, EGFP-infected iPSCs and Vfre-infected iPSCs for WB analysis was performed as described before (n=4 per group) (Chen et al. 2020). Samples were lysed and immunoblotted to detect FTH1 (1:1000; Abcam, Cambridge, UK) andβ-Actin (1:1000) (Santa Cruz, Texas, USA). The bands were visualized, scanned and quantified with ImageJ (National Institutes of Health, NIH) after subtraction of local background.
In vitro iron uptake assay
EGFP-infected iPSCs or Vfre-infected iPSCs were treated with ferric citrate (FAC, Sigma-Aldrich, Shanghai, China) in E8 medium at doses of 0, 200 or 500 μM respectively. After 5 days of culture, the iPSCs was washed by PBS three times to remove free iron ions. Then 106 of iPSCs were collected into a 1.5 ml centrifuge tube and fixed by 10 g/l agarose for 15-20 min. The cells were scanned with MRI (MAGNETOM Skyra, SIEMENS, Germany) using the following parameters: Gradient echo, flip angle 20°, repetition time (TR)/echo time (TE) = 3000/82 ms, field of view (FOV) = 60 × 60 mm2, matrix size = 160 × 120, slice thickness, 2 mm. The images were analyzed with RadiAnt DICOM Viewer software (Medixant, Poznan, Poland).
Vfre-infected iPSCs transplantation into the rat brain
All animal experiments were performed according to the Regulations in China (Regulations for the administration of affairs concerning experimental animals, 2017) and approved by the Institutional Animal Care and Use committee at Chinese Academy of Sciences. 24 of male SD rats (SPF Biotechnology Co., Ltd. Beijing, China) were subjected to the transplantation surgery and randomly assigned to the subsequent imaging assays. Vfre-infected iPSCs were dissociated and re-suspended in saline at a density of 106 cells/μl. 6x106 of Vfre-infected iPSCs in 6μl of saline were injected into the left striatum of rats at two of the following coordinates (AP: +1.2 mm, ML: +2.2 mm, DV: -4.0 and -6.0 mm). The same amount of saline was injected into the right striatum at the corresponding coordinates as a self-control for each rat. Transplantation was performed at a rate of 1 μl/min for 3 min, leaving the needle in place for 5 min and slowly lifting it out. After the surgical procedure, animals were monitored for recovery and returned to the home cage.
In Vivo MRI
For in vivo MRI, the rats transplanted with Vfre-infected iPSCs were anesthetized with 10% chloral hydrate, and scanned 3rd, 9th, 15th, 21th, 27th and 60th day after the surgery. MRI was conducted at a 3.0 T MRI scanner using a 2 cm dual surface coil. T2-weighted signal was acquired using the following parameters to image: Gradient echo, flip angle 20°, TR/TE = 3000/82 ms, FOV = 60 × 60 mm2, matrix size = 160 × 120, slice thickness, 2 mm. The data were analyzed with RadiAnt DICOM Viewer software.
Near-infrared fluorescence imaging
The near-infrared fluorescence imaging was performed by using the Kodak In-Vivo MultiSpectral Imaging System FX (Kodak, USA) on the rats 3, 9 and 15 days after the transplantation surgery, respectively. Rats were anesthetized in a holding chamber of the anesthetic gas machine (RWD Life Science, Shenzhen, China) with 40 g/l isoflurane (RWD Life Science, Shenzhen, China). The anesthetized animals were placed in the imaging system, and scanned using near-infrared fluorescence at a setting of 663/682 nm (excitation/emission), 60s exposure and 3.0 cm camera height. A sustained ventilation with 2–3.5% (v/v) isoflurane was provided during the scanning process to keep the rats still.
Immunohistochemistry and Prussian blue stain
Rats were perfused with 4% paraformaldehyde 30 days or 60 days after the transplantation surgery. The brains were carefully removed, dehydrated with sucrose and flash-frozen in dry ice/isopentane and subsequently stored at -80oC until sectioning. Serial coronal cryosection at a thickness of 30 µm over the striatum were prepared. Sections were blocked with 30 g/l Bovine serum albumin (BSA) in PBST, sequentially incubated with antisera against GFP (1:1000, Abcam, Cambridge, UK). Immunoreactivity was visualized using appropriate Alexa Fluor-conjugated secondary antibodies (Invitrogen). DAPI (Beyotime, Shanghai, China) was counterstained for 15min. Images were acquired with Laser scanning confocal microscope (Zeiss, Jena, Germany).
The cryosections of rat brain were evaluated for iron deposits by using Prussian Blue Staining Kit (Solarbio, Beijing, China). The working solution was prepared by mixing equal volume of 200 g/l hydrochloric acid and 100 g/l potassium ferrocyanide just before use. Sections were incubated with the working solution, washed and counterstained with nuclear fast red.